iq sybr green supermix Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Bio-Rad iq sybr green supermixr
    Analysis of endogenous MMP1 gene transcription by quantitative-PCR. MeWo cells were treated with different concentration (0, 10, 30, 50, 70, 90 nM) of target designed siRNA (506 siRNA and 859 siRNA) and incubated for 24 h. After incubation, the total RNA was extracted using TRIzol Reagent. The cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit. MMP1 and GAPDH gene expression was carried out using Quantitative-PCR/iQ™ <t>SYBR</t> ® Green <t>Supermix</t> (Bio-rad, California). (A) was the 1.5% agarose gel electrophoresis assay of the PCR products of different siRNA treatments. (B) was the quantified results of the expression quantity of relative expression of the MMP1 mRNA normalized against GAPDH mRNA and compared to blank (without treatment of siRNA).
    Iq Sybr Green Supermixr, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 12905 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iq sybr green supermixr/product/Bio-Rad
    Average 99 stars, based on 12905 article reviews
    Price from $9.99 to $1999.99
    iq sybr green supermixr - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    Analysis of endogenous MMP1 gene transcription by quantitative-PCR. MeWo cells were treated with different concentration (0, 10, 30, 50, 70, 90 nM) of target designed siRNA (506 siRNA and 859 siRNA) and incubated for 24 h. After incubation, the total RNA was extracted using TRIzol Reagent. The cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit. MMP1 and GAPDH gene expression was carried out using Quantitative-PCR/iQ™ SYBR ® Green Supermix (Bio-rad, California). (A) was the 1.5% agarose gel electrophoresis assay of the PCR products of different siRNA treatments. (B) was the quantified results of the expression quantity of relative expression of the MMP1 mRNA normalized against GAPDH mRNA and compared to blank (without treatment of siRNA).

    Journal: Biotechnology Reports

    Article Title: Effect of small interfering RNAs on matrix metalloproteinase 1 expression

    doi: 10.1016/j.btre.2014.07.003

    Figure Lengend Snippet: Analysis of endogenous MMP1 gene transcription by quantitative-PCR. MeWo cells were treated with different concentration (0, 10, 30, 50, 70, 90 nM) of target designed siRNA (506 siRNA and 859 siRNA) and incubated for 24 h. After incubation, the total RNA was extracted using TRIzol Reagent. The cDNA was synthesized using 1 μg of total RNA by reverse-transcription using iScript™ cDNA synthesis kit. MMP1 and GAPDH gene expression was carried out using Quantitative-PCR/iQ™ SYBR ® Green Supermix (Bio-rad, California). (A) was the 1.5% agarose gel electrophoresis assay of the PCR products of different siRNA treatments. (B) was the quantified results of the expression quantity of relative expression of the MMP1 mRNA normalized against GAPDH mRNA and compared to blank (without treatment of siRNA).

    Article Snippet: For real-time PCR analysis of MMP1 and GAPDH gene expression was carried out using iQ™ SYBR® Green Supermix (Bio-rad, California), the primers used were: • MMP1 forward: AGTCAAGTTTGTGGCTTATGGA • MMP1 reverse: TTGTCACTGAAGCTGCTCTC • GAPDH forward: GTCGGAGTCAACGGATTT • GAPDH reverse: CAACAATATCCACTTTACCAGAG Briefly, the reaction mixture containing 2 μL cDNA, 1 μL forward primer (0.5 μM), 1 μL reverse primer (0.5 μM), 10 μL iQ SYBR Green Supermix, and 6 μL RNase-free water was prepared.

    Techniques: Real-time Polymerase Chain Reaction, Concentration Assay, Incubation, Synthesized, Expressing, SYBR Green Assay, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    (A and B). 293T cells were transfected with our experimental and control plasmids and 24 hours later the cells were washed and treated with IFNβ at 1000 U/ml for an additional 12 h. Total cellular RNA was then extracted and cDNA was generated by reverse transcription. Real-time PCRs were carried out using SYBR green supermix. MxA hand ISG15 relative gene expression was calculated using the comparative threshold cycle method, employing 18S rRNA and GAPDH as references. (C and D). 293T cells were transfected with our experimental and control plasmids and 24 hours later the cells were washed and treated with IFN-γ (5 ng/ml) for 12 hours. Total cellular RNA was then extracted and cDNA was generated by reverse transcription. Real-time PCRs were carried out using SYBR green supermix. IP10 and IRF1 relative gene expression was calculated using the comparative threshold cycle method, employing 18S rRNA and GAPDH as references

    Journal: Virus research

    Article Title: La Piedad Michoacán Mexico Virus V protein antagonizes type I interferon response by binding STAT2 protein and preventing STATs nuclear translocation

    doi: 10.1016/j.virusres.2015.10.027

    Figure Lengend Snippet: (A and B). 293T cells were transfected with our experimental and control plasmids and 24 hours later the cells were washed and treated with IFNβ at 1000 U/ml for an additional 12 h. Total cellular RNA was then extracted and cDNA was generated by reverse transcription. Real-time PCRs were carried out using SYBR green supermix. MxA hand ISG15 relative gene expression was calculated using the comparative threshold cycle method, employing 18S rRNA and GAPDH as references. (C and D). 293T cells were transfected with our experimental and control plasmids and 24 hours later the cells were washed and treated with IFN-γ (5 ng/ml) for 12 hours. Total cellular RNA was then extracted and cDNA was generated by reverse transcription. Real-time PCRs were carried out using SYBR green supermix. IP10 and IRF1 relative gene expression was calculated using the comparative threshold cycle method, employing 18S rRNA and GAPDH as references

    Article Snippet: Real-time PCRs were carried out using SYBR green supermix (BioRad).

    Techniques: Transfection, Generated, SYBR Green Assay, Expressing