igf-1 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher gene exp igf1 mm00439560 m1
    Upregulation of a myopia protective gene EGR1 by violet light (VL) exposure. (a) A result of principal component analysis (PCA) ( Sharov et al., 2015 ) in 4 groups. And they were further divided into positive and negative groups. (b) Genes in PC1 group were responsive to VL. FDR, false discovery rate. (c) EGR1 , myopia protective gene, was only clustered gene to PC1 group among previously reported myopia related genes. The previously reported myopia promoting genes such as TGF1 , <t>IGF1</t> were not found in PC1 group in vivo , which means they did not respond to VL. (d) Relative mRNA expression of EGR1 in chick chorioretinal tissue after VL exposure (n = 5). Note that VL exposure induces significant upregulation of EGR1 . (e) Relative mRNA expression of EGR1 in chick chorioretinal tissue after VL and blue light exposure (n = 4, 5). Note that VL exposure induced significantly higher upregulation of EGR1 than blue light. (f) Relative mRNA expression of EGR1 in chick chorioretinal tissue after 50, 100, and 400 μW/cm 2 of VL exposure (n = 5). There were significant differences in mRNA expression of EGR1 between 50 and 400 μW/cm 2 groups. (g) Relative mRNA expression of known myopia-related genes after 380 nm light exposure to the murine photoreceptor 661 W cells detected by real-time RT-PCR (n = 4). Note that EGR1 is significantly upregulated among those genes. (h) Relative mRNA expression of EGR1 after from 360 nm to 400 nm light exposure to 661 W cells (n = 4). * P
    Gene Exp Igf1 Mm00439560 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 394 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp igf1 mm00439560 m1/product/Thermo Fisher
    Average 99 stars, based on 394 article reviews
    Price from $9.99 to $1999.99
    gene exp igf1 mm00439560 m1 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Millipore igf 1
    Myocardin up-regulation induced by insulin and <t>IGF-1</t> can be attenuated by the antioxidant agents. A , catalase is able to attenuate myocardin levels upon treatment with insulin. The neonatal rat cardiomyocytes were infected with Ad-β-galactosidase
    Igf 1, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1788 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/Millipore
    Average 99 stars, based on 1788 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    95
    R&D Systems igf 1
    POA microinjection of <t>IGF-1</t> causes a dose-dependent hyperthermic response. A , profile of dose-dependent effects on CBT of POA injection of IGF-1 ( n = 6 mice/group) for 6 h after injection ( arrow shows time of injection). B , AUC analysis showing the significant
    Igf 1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 3566 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/R&D Systems
    Average 95 stars, based on 3566 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    95/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc igf 1r
    Effect of CoCl 2 -induced hypoxia on HIF-1α, <t>IGF-1R</t> and VEGF protein expression. (A) The HepG2 cells were treated with 0, 50, 100, 200, 400 or 800 μmol/l CoCl 2 for 12 h. (B) The HepG2 cells were treated for 0,4,8,12, 24 or 48 h with 200 μmol/l CoCl 2 . A significant difference in HIF-1α, IGF-1R and VEGF mRNA expression was observed when cells were treated with 200 and 400 μmol/l CoCl 2 , and for 8, 12, 24 and 48 h, compared with the control (P
    Igf 1r, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1001 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1r/product/Cell Signaling Technology Inc
    Average 99 stars, based on 1001 article reviews
    Price from $9.99 to $1999.99
    igf 1r - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    igf 1  (Abcam)
    99
    Abcam igf 1
    Effects of prolactin (PRL) (25 ng/mL and 50 ng/mL) on metabolic pathway and <t>IGF-1</t> expression. ( A ) Pathway enrichment predicted by Metaboanalyst and metabolic breakdown based on ( A , B ) Nicotinate and quinolinate metabolism, and ( D – F ) free amino acid flux, ( G ) geranyl pyrophosphate, ( H ) oculose-8-phosphate-oculose-1-phosphate flux, ( I – K ) lactate and coenzyme A flux, (L-P) NAD+/NADH and ATP, ADP, and AMP flux. (Q-T) Representative western blots and quantification of bands by densitometry for IGF-1, IGF-2, and IGF-1R. Western blots were converted to greyscale. Statistical significance determined by a two-way ANOVA. Experiments were performed in triplicate. Error bars represent standard error of the mean. *p
    Igf 1, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 545 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/Abcam
    Average 99 stars, based on 545 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    Prospec igf 1
    <t>IGF-1</t> can improve the memory in a new environment of septic rats. Notes: Compared with training session in each group, the number of crossings and rearings in testing session is reduced in sham-operative, antibiotic + IGF-1, and IGF-1 groups (Student’s t -test, * P
    Igf 1, supplied by Prospec, used in various techniques. Bioz Stars score: 92/100, based on 170 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/Prospec
    Average 92 stars, based on 170 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Santa Cruz Biotechnology igf 1
    Reduced DETCs around a wound resulted in the weakened production of <t>IGF-1</t> and KGF in the epidermis of diabetic mice. Wild-type C57BL/6J mice were administered daily i.p. injections of STZ or vehicle control for 6 days, and received full-thickness wounds in their back skin 4 weeks after STZ treatment. A. Reduced expression of IGF-1 and KGF in the epidermis around the wound of diabetic mice. On day 1 after wounding, the epidermis around wound of STZ-induced diabetic or control mice was obtained to detect the protein expression of IGF-1 and KGF by Western blot. B. Diabetic mice displayed significantly fewer DETCs in the intact epidermis and wounded epidermis compared with wild-type controls. DETCs numbers were increased upon wounding in wild-type controls compared with diabetic mice. The epidermis in the intact skin and around the wound at day 1 after wounding of STZ-induced diabetic or control mice were obtained to examine the number of DETCs by using FACS. *p
    Igf 1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 504 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/Santa Cruz Biotechnology
    Average 92 stars, based on 504 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Novozymes igf 1
    MEK1 regulates oxidative stress and mitochondrial membrane function in ER + breast cancer cells . (a through c) MEK1 downregulation blocked the prosurvival effects of <t>IGF-1</t> and enhanced ROS and mitochondrial membrane depolarization in hormonally treated breast cancer cells. (a) Western blot shows effective RNAi targeting of MEK1, which was carried out for 48 hours before cells were treated with E2, E2 + 4-OHT, or E2 + 4-OHT + MIF for 24 hours. Protein was isolated from cells and analyzed for MEK1 expression with immunoblot analysis. (b, c) Cell populations with reduced MEK1 expression were analyzed at 6 and 72 hours for ROS and mitochondrial membrane depolarization, respectively. (d through f) MEK1 overexpression reduced ROS and mitochondrial membrane depolarization in hormonally treated breast cancer cells. Transient transfection of MEK1 cDNA (MEK1-GFP vector) increased MEK1 expression above levels seen in vector-only (pEGFP-1)-transfected control cells at 24 and 48 hours, as determined by immunoblot analysis (d) , and reduced ROS levels and mitochondrial membrane depolarization at 24 and 72 hours, respectively (e, f) . Values are expressed as mean ± SD ( n = 3). Significant differences are designated as follows: (a) Scrambled versus SiMEK, E2 (± IGF-1); (b) Scrambled versus SiMEK, E2 + 4-OHT (± IGF-1); (c) Scrambled versus SiMEK, E2 + MIF (± IGF-1); (d) Scrambled versus SiMEK, E2 + 4-OHT + MIF; (e) pEGFP-N1 versus MEK1-GFP, E2 + 4-OHT; (f) pEGFP-N1 versus MEK1-GFP, E2 + MIF; (g) pEGFP-N1, E2 + 4-OHT + MIF versus MEK1-GFP, E2 + 4-OHT + MIF. * P
    Igf 1, supplied by Novozymes, used in various techniques. Bioz Stars score: 92/100, based on 215 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/Novozymes
    Average 92 stars, based on 215 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Genzyme igf 1
    A: Gel mobility assay illustrating p53 binding to its consensus sequence in the bax promoter. Nuclear extracts were obtained from nonstretched myocytes (NS) at 16 hours and stretched myocytes (S) at 6 and 16 hours (h) in the absence and presence of <t>IGF-1.</t> IGF-1 decreased p53 DNA binding activity at both time points. The arrow indicates the position of p53 shifted band. The p53-specific band, corresponding to nuclear extract obtained at 16 hours after stretch, was subject to competition with an excess of unlabeled self oligonucleotide (C) and with a monoclonal p53 antibody (Ab). The addition of an irrelevant antibody (Irr) or preincubation with an unlabeled mutated form of bax (Bax mut) did not interfere with p53 binding. Bax, bax probe in the absence of nuclear extracts. Optical density data were as follows: NS = 0.46 ± 0.22 ( n = 5), S-6 hours = 1.83 ± 0.37 ( n = 5), P
    Igf 1, supplied by Genzyme, used in various techniques. Bioz Stars score: 92/100, based on 92 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/Genzyme
    Average 92 stars, based on 92 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Immunodiagnostic Systems igf 1
    Kaplan–Meier curves of event-free survival (left column) and overall survival (right column) for <t>IGF-1,</t> IGF-BP3, and molar IGF-1 (nm/L):IGF-BP3 (nm/L) ratio levels under or above the cutoff point. Note: P -values are given for the univariate analyses of the Cox regression analyses. Abbreviations: IGF-1, insulin-like growth factor 1; IGF-BP3, insulin-like growth factor-binding protein 3; EFS, event-free survival; OS, overall survival.
    Igf 1, supplied by Immunodiagnostic Systems, used in various techniques. Bioz Stars score: 92/100, based on 194 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/Immunodiagnostic Systems
    Average 92 stars, based on 194 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Thermo Fisher igf 1
    Akt is necessary and sufficient for <t>IGF-1–mediated</t> myocyte survival. A, Representative image of TUNEL (TNL)-positive cardiac myocytes in culture. Cardiac myocytes were cultured in absence of serum for 48 hours. Cells were stained with Hoechst, TUNEL, and anti– α -sarcomeric actin antibody. B, Effects of Akt-expressing adenovirus vectors on cardiac myocyte survival. Cultured cells were infected with mock (no virus) or adenovirus vectors expressing β -galactosidase, wild-type, dominant-negative, or constitutively active Akt ( β -gal, wtAkt, dnAkt, and myrAkt, respectively). After infection, cells were cultured in presence of indicated concentrations of IGF-1 for 48 hours. Myocyte viability was assessed by staining with Hoechst and TUNEL. Cultured cells were identified as cardiomyocytes by staining with anti– α -sarcomeric actin antibody. Data are shown as mean±SEM (n=4).
    Igf 1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 850 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/Thermo Fisher
    Average 92 stars, based on 850 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    igf 1  (ALPCO)
    92
    ALPCO igf 1
    Hepatic <t>Igf-1</t> transgene does not resolve hepatic lipid metabolism in Li-GHRKO mice. A and B : Liver gene expression of key players in lipid metabolism was determined by real-time PCR ( n = 8/genotype). C : SCD-1 index determined by the ratio of hepatic stearic and oleic acid concentrations determined by GC/MS. D : Hepatic gene expression of key players in glycolysis (GLUT2, glucokinase [GCK], and liver pyruvate kinase [PKLr]) and gluconeogenesis (PC, PCK1, and glucose 6 phosphatase [G6PC]). Liver RNA extracted from 16- to 24-week-old male mice and processed for real-time PCR assay. E : Hepatic glycogen content assayed in livers of 16-week-old male mice. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P
    Igf 1, supplied by ALPCO, used in various techniques. Bioz Stars score: 92/100, based on 161 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/ALPCO
    Average 92 stars, based on 161 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Genentech igf1
    <t>IGF1</t> increases the proportion of pH3-positive Sox9-EGFP Low cells only during crypt regeneration. A ) Immunofluorescence demonstrates increased number of pH3-positive cells per crypt section in IGF1-treated mice vs. vehicle-treated controls at 5 days after
    Igf1, supplied by Genentech, used in various techniques. Bioz Stars score: 92/100, based on 79 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf1/product/Genentech
    Average 92 stars, based on 79 article reviews
    Price from $9.99 to $1999.99
    igf1 - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    93
    DiaSorin igf 1
    Subgroup analyses of the association between circulating insulin-like growth factor-1 <t>(IGF-1)</t> concentrations and breast cancer risk in the UK Biobank (per 5 nmol/L increment) HR=hazard ratio; CI=confidence interval. Multivariable Cox regression model using age as the underlying time variable and stratified by Townsend deprivation index (fifths), region of the recruitment assessment center, and age at recruitment (5-year categories). Models adjusted for total physical activity (
    Igf 1, supplied by DiaSorin, used in various techniques. Bioz Stars score: 93/100, based on 102 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/DiaSorin
    Average 93 stars, based on 102 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    90
    RayBiotech igf 1
    Levels of GH and <t>IGF-1</t> hormones in WT and En2 −/− mice . (A,B) ELISA quantification of GH (A) and IGF-1 (B) levels in serum and hippocampal (hippo) and liver protein extracts, as indicated. Values are plotted as mean ± SEM (five animals per genotype, in duplicate; * p
    Igf 1, supplied by RayBiotech, used in various techniques. Bioz Stars score: 90/100, based on 124 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/RayBiotech
    Average 90 stars, based on 124 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    91
    Ciba Geigy igf1
    Dose-dependent effects of <t>IGF1</t> and insulin on signalling, proliferation, and apoptosis in A549 cells. Cells were exposed to IGF1 or insulin as described for Figs. 2 and 4 , and data are shown as in Fig. 8 for Saos-2/B10 cells. Top panel Western blot showing p-Akt/PKB, p-ERK1/2, bottom panel stimulation of DNA synthesis ( n = 7 in triplicate) and inhibition of apoptosis ( n = 2 in triplicate), expressed relative to control ( log scale ). c denotes control, *** p
    Igf1, supplied by Ciba Geigy, used in various techniques. Bioz Stars score: 91/100, based on 68 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf1/product/Ciba Geigy
    Average 91 stars, based on 68 article reviews
    Price from $9.99 to $1999.99
    igf1 - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    92
    Ipsen Group igf 1
    Adherence: Significant increase in serum <t>IGF-1</t> levels during the therapy period when compared with baseline.
    Igf 1, supplied by Ipsen Group, used in various techniques. Bioz Stars score: 92/100, based on 57 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/Ipsen Group
    Average 92 stars, based on 57 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    99
    R&D Systems recombinant human igf 1
    ACL is an mTOR regulated phosphoprotein A. MS/MS spectra of ACL phosphopeptide identified by SILAC. The sequence of a tryptic peptide matched to human ACL and the SILAC ratio (heavy-labeled/light-labeled (H/L)) for ACL peptide is shown for the corresponding spectra. B. and C. MDA361 cells were treated with 1 μmol/L WYE-132 for the indicated times (B) or with various inhibitors for 24 h (C) followed by immunoblotting. D. DNA sequence alignment of human, rat, mouse and xenopus ACL gene. E. HEK293 cells were serum-depleted overnight, treated with inhibitors for 30 min, stimulated with 100 ng/mL <t>IGF-1</t> followed by immunoblotting. F. HEK293 cells were grown in medium with 1% FBS overnight, treated with DMSO, 1 μmol/L WYE-132 or 1 μmol/L rapamycin for 2 h. The cells were then stimulated for 2 h with 100 ng/mL IGF-1 and 14 C-glucose, and analyzed for de novo lipid synthesis as described in Methods. Statistical analysis: **, p
    Recombinant Human Igf 1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 99/100, based on 133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant human igf 1/product/R&D Systems
    Average 99 stars, based on 133 article reviews
    Price from $9.99 to $1999.99
    recombinant human igf 1 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    97
    PeproTech recombinant human igf 1
    GCS-100 treatment is associated with modulation of cell-signaling proteins and inhibits <t>IGF-1</t> and TNF-α pathway stimulation . (A-B) RPMI 8226 cells were exposed to 500 μg/mL GCS-100 for up to 48 hours and after preparation of whole-cell lysates examined by Western blot. A total of 50 μg of protein was separated using 12% SDS-PAGE, transferred to PVDF membrane, and probed using the indicated antibodies. (C-E) RPMI 8226 cells were incubated in serum-free media for 1 hour and then cultured with 500 μg/mL GCS-100 or control media for 2 hours. Cells were then stimulated with TNF-α (5 ng/mL), IGF-1 (100 ng/mL), or IL-6 (10 ng/mL) for 30 minutes. Whole-cell lysates were prepared and 50 μg of protein resolved using 12% gel, transferred to PVDF, and probed with the indicated antibodies. β-Actin was used as a loading control.
    Recombinant Human Igf 1, supplied by PeproTech, used in various techniques. Bioz Stars score: 97/100, based on 121 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant human igf 1/product/PeproTech
    Average 97 stars, based on 121 article reviews
    Price from $9.99 to $1999.99
    recombinant human igf 1 - by Bioz Stars, 2020-09
    97/100 stars
      Buy from Supplier

    90
    Quest Diagnostics igf 1
    Group differences in changes in <t>IGF-1</t> levels over 12 mo adjusted for age. The PILL group had significant reductions in IGF-1 levels over 12 mo compared with the PATCH and NONE groups.
    Igf 1, supplied by Quest Diagnostics, used in various techniques. Bioz Stars score: 90/100, based on 59 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igf 1/product/Quest Diagnostics
    Average 90 stars, based on 59 article reviews
    Price from $9.99 to $1999.99
    igf 1 - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    Image Search Results


    Upregulation of a myopia protective gene EGR1 by violet light (VL) exposure. (a) A result of principal component analysis (PCA) ( Sharov et al., 2015 ) in 4 groups. And they were further divided into positive and negative groups. (b) Genes in PC1 group were responsive to VL. FDR, false discovery rate. (c) EGR1 , myopia protective gene, was only clustered gene to PC1 group among previously reported myopia related genes. The previously reported myopia promoting genes such as TGF1 , IGF1 were not found in PC1 group in vivo , which means they did not respond to VL. (d) Relative mRNA expression of EGR1 in chick chorioretinal tissue after VL exposure (n = 5). Note that VL exposure induces significant upregulation of EGR1 . (e) Relative mRNA expression of EGR1 in chick chorioretinal tissue after VL and blue light exposure (n = 4, 5). Note that VL exposure induced significantly higher upregulation of EGR1 than blue light. (f) Relative mRNA expression of EGR1 in chick chorioretinal tissue after 50, 100, and 400 μW/cm 2 of VL exposure (n = 5). There were significant differences in mRNA expression of EGR1 between 50 and 400 μW/cm 2 groups. (g) Relative mRNA expression of known myopia-related genes after 380 nm light exposure to the murine photoreceptor 661 W cells detected by real-time RT-PCR (n = 4). Note that EGR1 is significantly upregulated among those genes. (h) Relative mRNA expression of EGR1 after from 360 nm to 400 nm light exposure to 661 W cells (n = 4). * P

    Journal: EBioMedicine

    Article Title: Violet Light Exposure Can Be a Preventive Strategy Against Myopia Progression

    doi: 10.1016/j.ebiom.2016.12.007

    Figure Lengend Snippet: Upregulation of a myopia protective gene EGR1 by violet light (VL) exposure. (a) A result of principal component analysis (PCA) ( Sharov et al., 2015 ) in 4 groups. And they were further divided into positive and negative groups. (b) Genes in PC1 group were responsive to VL. FDR, false discovery rate. (c) EGR1 , myopia protective gene, was only clustered gene to PC1 group among previously reported myopia related genes. The previously reported myopia promoting genes such as TGF1 , IGF1 were not found in PC1 group in vivo , which means they did not respond to VL. (d) Relative mRNA expression of EGR1 in chick chorioretinal tissue after VL exposure (n = 5). Note that VL exposure induces significant upregulation of EGR1 . (e) Relative mRNA expression of EGR1 in chick chorioretinal tissue after VL and blue light exposure (n = 4, 5). Note that VL exposure induced significantly higher upregulation of EGR1 than blue light. (f) Relative mRNA expression of EGR1 in chick chorioretinal tissue after 50, 100, and 400 μW/cm 2 of VL exposure (n = 5). There were significant differences in mRNA expression of EGR1 between 50 and 400 μW/cm 2 groups. (g) Relative mRNA expression of known myopia-related genes after 380 nm light exposure to the murine photoreceptor 661 W cells detected by real-time RT-PCR (n = 4). Note that EGR1 is significantly upregulated among those genes. (h) Relative mRNA expression of EGR1 after from 360 nm to 400 nm light exposure to 661 W cells (n = 4). * P

    Article Snippet: Quantitative PCR assays were performed on a StepOnePlus Real-Time PCR System using TaqMan Universal PCR master mix (Life Technologies, Carlsbad, USA) with TaqMan Gene Expression Assay Mix of Bmp2 (Mm01340178_m1), Ednrb (Mm00432989_m1), Egr1 (Mm00656724_m1), Fgf2 (Mm00433287_m1), Igf1 (Mm00439560_m1), Il18 (Mm00434225_m1), Irbp (Mm00450076_m1), Lumican (Mm01248292_m1), Sfrp1 (Mm00489161_m1), Tgfb1 (Mm01178820_m1), Vegfa (Mm01281449_m1), Vip (Mm00660234_m1), and Wnt2b (Mm00437330_m1) or Platinum SYBR Green qPCR SuperMix-UDG (Life Technologies, Carlsbad, USA) with a chick EGR1 primer (Forward: ACTAACTCGTCACATTCGCA, Reverse: TGCTGAGACCGAAGCTGCCT) ( ).

    Techniques: In Vivo, Expressing, Quantitative RT-PCR

    Myocardin up-regulation induced by insulin and IGF-1 can be attenuated by the antioxidant agents. A , catalase is able to attenuate myocardin levels upon treatment with insulin. The neonatal rat cardiomyocytes were infected with Ad-β-galactosidase

    Journal:

    Article Title: Foxo3a Inhibits Cardiomyocyte Hypertrophy through Transactivating Catalase *

    doi: 10.1074/jbc.M805514200

    Figure Lengend Snippet: Myocardin up-regulation induced by insulin and IGF-1 can be attenuated by the antioxidant agents. A , catalase is able to attenuate myocardin levels upon treatment with insulin. The neonatal rat cardiomyocytes were infected with Ad-β-galactosidase

    Article Snippet: Materials —Insulin, N -acetyl- l -cysteine (NAC), and IGF-1 were purchased from Sigma.

    Techniques: Infection

    Myocardin is required for insulin and IGF-1 to induce hypertrophy. A , myocardin is up-regulated in response to insulin treatment. The neonatal rat cardiomyocytes were treated with 20 μg/ml insulin, and then harvested at the indicated times

    Journal:

    Article Title: Foxo3a Inhibits Cardiomyocyte Hypertrophy through Transactivating Catalase *

    doi: 10.1074/jbc.M805514200

    Figure Lengend Snippet: Myocardin is required for insulin and IGF-1 to induce hypertrophy. A , myocardin is up-regulated in response to insulin treatment. The neonatal rat cardiomyocytes were treated with 20 μg/ml insulin, and then harvested at the indicated times

    Article Snippet: Materials —Insulin, N -acetyl- l -cysteine (NAC), and IGF-1 were purchased from Sigma.

    Techniques:

    The addition of recombinant IGF1 and the inhibitor of IGF1, AG1024. (A) The graph indicates the granulosa cell proliferation of no-growth follicles. The follicles were separated into two groups, containing theca cells (–) or no theca cells (–), and cultured in a medium containing recombinant IGF1 (50 ng/ml). The numbers of samples used in this experiment were as follows: theca cell (–)/IGF1 (–), 19; theca cell (–)/IGF1 (+), 19; theca cell (+)/IGF1 (–), 51; theca cell (+)/IGF1 (+), 26. (B) The graph indicates the granulosa cell proliferation of no-growth follicles without theca cells. These follicles were cultured in a medium containing AG1024 or AG1024/recombinant IGF1 (50 or 100 ng/ml). The numbers of samples used in this experiment were as follows: AG1024l (–)/IGF1 (–), 12; AG1024 (+)/IGF1 (–), 22; AG1024l (+)/IGF1 (50), 16; AG1024 (+)/IGF1 (100), 13. (C) The graph indicated the granulosa cell proliferation of no-growth follicles containing theca cells. These follicles were cultured in a medium containing AG1024 or AG1024/recombinant IGF1 (50 or 100 ng/ml). The numbers of samples used in this experiment were as follows: AG1024l (–)/IGF1 (–), 47; AG1024 (+)/IGF1 (–), 45; AG1024l (+)/IGF1 (50), 28; AG1024 (+)/IGF1 (100), 31. Statistical significance is indicated by an asterisk (*P

    Journal: The Journal of Reproduction and Development

    Article Title: Regulation of secondary follicle growth by theca cells and insulin-like growth factor 1

    doi: 10.1262/jrd.2014-107

    Figure Lengend Snippet: The addition of recombinant IGF1 and the inhibitor of IGF1, AG1024. (A) The graph indicates the granulosa cell proliferation of no-growth follicles. The follicles were separated into two groups, containing theca cells (–) or no theca cells (–), and cultured in a medium containing recombinant IGF1 (50 ng/ml). The numbers of samples used in this experiment were as follows: theca cell (–)/IGF1 (–), 19; theca cell (–)/IGF1 (+), 19; theca cell (+)/IGF1 (–), 51; theca cell (+)/IGF1 (+), 26. (B) The graph indicates the granulosa cell proliferation of no-growth follicles without theca cells. These follicles were cultured in a medium containing AG1024 or AG1024/recombinant IGF1 (50 or 100 ng/ml). The numbers of samples used in this experiment were as follows: AG1024l (–)/IGF1 (–), 12; AG1024 (+)/IGF1 (–), 22; AG1024l (+)/IGF1 (50), 16; AG1024 (+)/IGF1 (100), 13. (C) The graph indicated the granulosa cell proliferation of no-growth follicles containing theca cells. These follicles were cultured in a medium containing AG1024 or AG1024/recombinant IGF1 (50 or 100 ng/ml). The numbers of samples used in this experiment were as follows: AG1024l (–)/IGF1 (–), 47; AG1024 (+)/IGF1 (–), 45; AG1024l (+)/IGF1 (50), 28; AG1024 (+)/IGF1 (100), 31. Statistical significance is indicated by an asterisk (*P

    Article Snippet: Expression of Igf1 mRNA in cultured follicles We checked the mRNA expression levels of GDF9, BMP15 and IGF1 in each growth rate group.

    Techniques: Recombinant, Cell Culture

    Proposed model for theca cell control of IGF1 expression and granulosa cell proliferation. (A) A secondary follicle containing no theca cells. (B) A follicle containing theca cells. Black circles, oocyte; gray circles, granulosa cells; gray flat circles, theca cells.

    Journal: The Journal of Reproduction and Development

    Article Title: Regulation of secondary follicle growth by theca cells and insulin-like growth factor 1

    doi: 10.1262/jrd.2014-107

    Figure Lengend Snippet: Proposed model for theca cell control of IGF1 expression and granulosa cell proliferation. (A) A secondary follicle containing no theca cells. (B) A follicle containing theca cells. Black circles, oocyte; gray circles, granulosa cells; gray flat circles, theca cells.

    Article Snippet: Expression of Igf1 mRNA in cultured follicles We checked the mRNA expression levels of GDF9, BMP15 and IGF1 in each growth rate group.

    Techniques: Expressing

    The theca cell layer increased the expression of Igf1 mRNA in the culture of secondary follicles in the no-growth group. (A) The expression level of Igf 1 mRNA of cultured secondary follicles with theca cells was higher than in those without theca cells. The total mRNA of each group was extracted from ten follicles. (B) The expression level of Igf1 mRNA of culture granulosa cells. We compared the expression level of each group, cultured granulosa cells and co-cultured granulosa cells with theca cells. Statistical significance is indicated by an asterisk (*P

    Journal: The Journal of Reproduction and Development

    Article Title: Regulation of secondary follicle growth by theca cells and insulin-like growth factor 1

    doi: 10.1262/jrd.2014-107

    Figure Lengend Snippet: The theca cell layer increased the expression of Igf1 mRNA in the culture of secondary follicles in the no-growth group. (A) The expression level of Igf 1 mRNA of cultured secondary follicles with theca cells was higher than in those without theca cells. The total mRNA of each group was extracted from ten follicles. (B) The expression level of Igf1 mRNA of culture granulosa cells. We compared the expression level of each group, cultured granulosa cells and co-cultured granulosa cells with theca cells. Statistical significance is indicated by an asterisk (*P

    Article Snippet: Expression of Igf1 mRNA in cultured follicles We checked the mRNA expression levels of GDF9, BMP15 and IGF1 in each growth rate group.

    Techniques: Expressing, Cell Culture

    Expression of Igf1 mRNA depended on the growth rate of the cultured secondary follicles. We evaluated the expression level of Igf1 mRNA in each group on culture day 3. Statistical significance is indicated by an asterisk (**P

    Journal: The Journal of Reproduction and Development

    Article Title: Regulation of secondary follicle growth by theca cells and insulin-like growth factor 1

    doi: 10.1262/jrd.2014-107

    Figure Lengend Snippet: Expression of Igf1 mRNA depended on the growth rate of the cultured secondary follicles. We evaluated the expression level of Igf1 mRNA in each group on culture day 3. Statistical significance is indicated by an asterisk (**P

    Article Snippet: Expression of Igf1 mRNA in cultured follicles We checked the mRNA expression levels of GDF9, BMP15 and IGF1 in each growth rate group.

    Techniques: Expressing, Cell Culture

    POA microinjection of IGF-1 causes a dose-dependent hyperthermic response. A , profile of dose-dependent effects on CBT of POA injection of IGF-1 ( n = 6 mice/group) for 6 h after injection ( arrow shows time of injection). B , AUC analysis showing the significant

    Journal: The Journal of Biological Chemistry

    Article Title: Insulin-like Growth Factor 1-mediated Hyperthermia Involves Anterior Hypothalamic Insulin Receptors *

    doi: 10.1074/jbc.M110.188540

    Figure Lengend Snippet: POA microinjection of IGF-1 causes a dose-dependent hyperthermic response. A , profile of dose-dependent effects on CBT of POA injection of IGF-1 ( n = 6 mice/group) for 6 h after injection ( arrow shows time of injection). B , AUC analysis showing the significant

    Article Snippet: IGF-1 injection into the POA caused a significant dose-dependent hyperthermic response ( , A and B ) that was not due to changes in locomotor activity ( C ) between vehicle and IGF-1 injected mice, respectively.

    Techniques: Injection, Mouse Assay

    Lack of neuronal IR expression in NIRKO mice reduces IGF-1-mediated hyperthermic effect. A , NIRKO mice display a reduced hyperthermic response to IGF-1 POA injection compared with wild-type littermates ( squares , IGF-1; triangles , vehicle; white , NIRKO

    Journal: The Journal of Biological Chemistry

    Article Title: Insulin-like Growth Factor 1-mediated Hyperthermia Involves Anterior Hypothalamic Insulin Receptors *

    doi: 10.1074/jbc.M110.188540

    Figure Lengend Snippet: Lack of neuronal IR expression in NIRKO mice reduces IGF-1-mediated hyperthermic effect. A , NIRKO mice display a reduced hyperthermic response to IGF-1 POA injection compared with wild-type littermates ( squares , IGF-1; triangles , vehicle; white , NIRKO

    Article Snippet: IGF-1 injection into the POA caused a significant dose-dependent hyperthermic response ( , A and B ) that was not due to changes in locomotor activity ( C ) between vehicle and IGF-1 injected mice, respectively.

    Techniques: Expressing, Mouse Assay, Injection

    POA injection of IGF-1 increases fatty acid utilization and BAT activity. A , oxygen consumption in mice is increased after administration of IGF-1 to the POA compared with vehicle treatment. B , carbon dioxide production in mice is increased after administration

    Journal: The Journal of Biological Chemistry

    Article Title: Insulin-like Growth Factor 1-mediated Hyperthermia Involves Anterior Hypothalamic Insulin Receptors *

    doi: 10.1074/jbc.M110.188540

    Figure Lengend Snippet: POA injection of IGF-1 increases fatty acid utilization and BAT activity. A , oxygen consumption in mice is increased after administration of IGF-1 to the POA compared with vehicle treatment. B , carbon dioxide production in mice is increased after administration

    Article Snippet: IGF-1 injection into the POA caused a significant dose-dependent hyperthermic response ( , A and B ) that was not due to changes in locomotor activity ( C ) between vehicle and IGF-1 injected mice, respectively.

    Techniques: Injection, Activity Assay, Mouse Assay

    IGF-1 acts specifically at the POA to elicit a hyperthermic response. A , graph showing the differential effects on CBT of the injection of 10 ng of IGF-1 in the POA, the DMH, and the RPa ( circles , POA; triangles , DMH; diamonds , RPa; white , IGF-1; black

    Journal: The Journal of Biological Chemistry

    Article Title: Insulin-like Growth Factor 1-mediated Hyperthermia Involves Anterior Hypothalamic Insulin Receptors *

    doi: 10.1074/jbc.M110.188540

    Figure Lengend Snippet: IGF-1 acts specifically at the POA to elicit a hyperthermic response. A , graph showing the differential effects on CBT of the injection of 10 ng of IGF-1 in the POA, the DMH, and the RPa ( circles , POA; triangles , DMH; diamonds , RPa; white , IGF-1; black

    Article Snippet: IGF-1 injection into the POA caused a significant dose-dependent hyperthermic response ( , A and B ) that was not due to changes in locomotor activity ( C ) between vehicle and IGF-1 injected mice, respectively.

    Techniques: Injection, Recombinase Polymerase Amplification

    POA injection of IGF-1 increases BAT activity. A , changes in interscapular BAT temperature, measured with an indwelling thermister, after injection of vehicle or IGF-1 (10 ng) to the POA or DMH ( squares , POA; triangles , DMH; white , IGF-1; black , vehicle;

    Journal: The Journal of Biological Chemistry

    Article Title: Insulin-like Growth Factor 1-mediated Hyperthermia Involves Anterior Hypothalamic Insulin Receptors *

    doi: 10.1074/jbc.M110.188540

    Figure Lengend Snippet: POA injection of IGF-1 increases BAT activity. A , changes in interscapular BAT temperature, measured with an indwelling thermister, after injection of vehicle or IGF-1 (10 ng) to the POA or DMH ( squares , POA; triangles , DMH; white , IGF-1; black , vehicle;

    Article Snippet: IGF-1 injection into the POA caused a significant dose-dependent hyperthermic response ( , A and B ) that was not due to changes in locomotor activity ( C ) between vehicle and IGF-1 injected mice, respectively.

    Techniques: Injection, Activity Assay

    Hyperthermic effects of POA injection of IGF-1 are inhibited by PQ401, an IGF-1 tyrosine kinase inhibitor. A , 6-h profile of the effects of PQ401 pretreatment on IGF-1-induced elevation of CBT. B , 6-h profile of the effects of PQ401 pretreatment on IGF-1-induced

    Journal: The Journal of Biological Chemistry

    Article Title: Insulin-like Growth Factor 1-mediated Hyperthermia Involves Anterior Hypothalamic Insulin Receptors *

    doi: 10.1074/jbc.M110.188540

    Figure Lengend Snippet: Hyperthermic effects of POA injection of IGF-1 are inhibited by PQ401, an IGF-1 tyrosine kinase inhibitor. A , 6-h profile of the effects of PQ401 pretreatment on IGF-1-induced elevation of CBT. B , 6-h profile of the effects of PQ401 pretreatment on IGF-1-induced

    Article Snippet: IGF-1 injection into the POA caused a significant dose-dependent hyperthermic response ( , A and B ) that was not due to changes in locomotor activity ( C ) between vehicle and IGF-1 injected mice, respectively.

    Techniques: Injection

    Effect of CoCl 2 -induced hypoxia on HIF-1α, IGF-1R and VEGF protein expression. (A) The HepG2 cells were treated with 0, 50, 100, 200, 400 or 800 μmol/l CoCl 2 for 12 h. (B) The HepG2 cells were treated for 0,4,8,12, 24 or 48 h with 200 μmol/l CoCl 2 . A significant difference in HIF-1α, IGF-1R and VEGF mRNA expression was observed when cells were treated with 200 and 400 μmol/l CoCl 2 , and for 8, 12, 24 and 48 h, compared with the control (P

    Journal: Oncology Letters

    Article Title: Effect of hypoxia on hypoxia inducible factor-1α, insulin-like growth factor I and vascular endothelial growth factor expression in hepatocellular carcinoma HepG2 cells

    doi: 10.3892/ol.2015.2879

    Figure Lengend Snippet: Effect of CoCl 2 -induced hypoxia on HIF-1α, IGF-1R and VEGF protein expression. (A) The HepG2 cells were treated with 0, 50, 100, 200, 400 or 800 μmol/l CoCl 2 for 12 h. (B) The HepG2 cells were treated for 0,4,8,12, 24 or 48 h with 200 μmol/l CoCl 2 . A significant difference in HIF-1α, IGF-1R and VEGF mRNA expression was observed when cells were treated with 200 and 400 μmol/l CoCl 2 , and for 8, 12, 24 and 48 h, compared with the control (P

    Article Snippet: Goat anti-rabbit HIF-1α, IGF-1R and VEGF monoclonal antibodies were purchased from Cell Signaling Technology (Beverly, MA, USA).

    Techniques: Expressing

    Effect of CoCl 2 - induced hypoxia on the expression of HIF-1α, IGF-1R and VEGF mRNA. (A) The HepG2 cells were treated with 0, 50, 100, 200, 400 or 800 μmol/l CoCl 2 for 12 h. (B) The HepG2 cells were treated for 0, 4, 8, 12, 24 or 48 h with 200 μmol/l CoCl 2 . A significant difference in HIF-1α, IGF-1R and VEGF protein expression was observed when cells were treated with 200 and 400 μmol/l CoCl 2 , and for 12, 24 and 48 h, compared with the control (P

    Journal: Oncology Letters

    Article Title: Effect of hypoxia on hypoxia inducible factor-1α, insulin-like growth factor I and vascular endothelial growth factor expression in hepatocellular carcinoma HepG2 cells

    doi: 10.3892/ol.2015.2879

    Figure Lengend Snippet: Effect of CoCl 2 - induced hypoxia on the expression of HIF-1α, IGF-1R and VEGF mRNA. (A) The HepG2 cells were treated with 0, 50, 100, 200, 400 or 800 μmol/l CoCl 2 for 12 h. (B) The HepG2 cells were treated for 0, 4, 8, 12, 24 or 48 h with 200 μmol/l CoCl 2 . A significant difference in HIF-1α, IGF-1R and VEGF protein expression was observed when cells were treated with 200 and 400 μmol/l CoCl 2 , and for 12, 24 and 48 h, compared with the control (P

    Article Snippet: Goat anti-rabbit HIF-1α, IGF-1R and VEGF monoclonal antibodies were purchased from Cell Signaling Technology (Beverly, MA, USA).

    Techniques: Expressing

    Insulin/IGF-1 promotes colon cancer cells proliferation and cell cycle progression in vitro . MC38 cells were cultured with various concentrations of insulin and IGF-1 for 72 hours. Control groups were treated with PBS. (A) Cell morphology was observed. (B) Cells were harvested for proliferation analysis with CCK-8 assay. *P

    Journal: PLoS ONE

    Article Title: The Activation of ERK1/2 and JNK MAPK Signaling by Insulin/IGF-1 Is Responsible for the Development of Colon Cancer with Type 2 Diabetes Mellitus

    doi: 10.1371/journal.pone.0149822

    Figure Lengend Snippet: Insulin/IGF-1 promotes colon cancer cells proliferation and cell cycle progression in vitro . MC38 cells were cultured with various concentrations of insulin and IGF-1 for 72 hours. Control groups were treated with PBS. (A) Cell morphology was observed. (B) Cells were harvested for proliferation analysis with CCK-8 assay. *P

    Article Snippet: The apoptosis assay showed that insulin and IGF-1 alone or both together decreased the total apoptotic cells ( ) .

    Techniques: In Vitro, Cell Culture, CCK-8 Assay

    Insulin/IGF-1 activates ERK1/2 and JNK signaling of colon cancer cells in vitro . MC38 cells were cultured with insulin and IGF-1 alone or both together for 72 hours and then collected for western blotting analysis. Control groups were treated with PBS. (A) Western blotting analysis of p-ERK1/2, ERK1/2, p-JNK, JNK, p-P38 and P38 protein expression in treated cells. GAPDH served as a loading control. The blots shown are representative of three separate experiments. Semi-quantitation for the expressions of (B) ERK1/2 and pERK1/2, (C) JNK and p-JNK, (D) P38 and p-P38 proteins. Fold changes were normalized by control groups. *P

    Journal: PLoS ONE

    Article Title: The Activation of ERK1/2 and JNK MAPK Signaling by Insulin/IGF-1 Is Responsible for the Development of Colon Cancer with Type 2 Diabetes Mellitus

    doi: 10.1371/journal.pone.0149822

    Figure Lengend Snippet: Insulin/IGF-1 activates ERK1/2 and JNK signaling of colon cancer cells in vitro . MC38 cells were cultured with insulin and IGF-1 alone or both together for 72 hours and then collected for western blotting analysis. Control groups were treated with PBS. (A) Western blotting analysis of p-ERK1/2, ERK1/2, p-JNK, JNK, p-P38 and P38 protein expression in treated cells. GAPDH served as a loading control. The blots shown are representative of three separate experiments. Semi-quantitation for the expressions of (B) ERK1/2 and pERK1/2, (C) JNK and p-JNK, (D) P38 and p-P38 proteins. Fold changes were normalized by control groups. *P

    Article Snippet: The apoptosis assay showed that insulin and IGF-1 alone or both together decreased the total apoptotic cells ( ) .

    Techniques: In Vitro, Cell Culture, Western Blot, Expressing, Quantitation Assay

    Endogenous insulin/IGF-1 accelerates colon tumor growth in a mouse type 2 diabetes model. 2 × 10 6 MC38 cells suspended in 0.1 ml of PBS were subcutaneously injected into the db/db and db/+ mice to initiate tumor growth in vivo . (A) Tumor size was measured every 3 days. *P

    Journal: PLoS ONE

    Article Title: The Activation of ERK1/2 and JNK MAPK Signaling by Insulin/IGF-1 Is Responsible for the Development of Colon Cancer with Type 2 Diabetes Mellitus

    doi: 10.1371/journal.pone.0149822

    Figure Lengend Snippet: Endogenous insulin/IGF-1 accelerates colon tumor growth in a mouse type 2 diabetes model. 2 × 10 6 MC38 cells suspended in 0.1 ml of PBS were subcutaneously injected into the db/db and db/+ mice to initiate tumor growth in vivo . (A) Tumor size was measured every 3 days. *P

    Article Snippet: The apoptosis assay showed that insulin and IGF-1 alone or both together decreased the total apoptotic cells ( ) .

    Techniques: Injection, Mouse Assay, In Vivo

    Establishment of type 2 diabetes model with db/db mice. Male db/db mice were used as mouse type 2 diabetes models, while db/+ littermates as normal controls. Body weight (A), blood glucose (B), insulin (C) and IGF-1 (D) were determined before MC38 cells injection at 8 th week. *P

    Journal: PLoS ONE

    Article Title: The Activation of ERK1/2 and JNK MAPK Signaling by Insulin/IGF-1 Is Responsible for the Development of Colon Cancer with Type 2 Diabetes Mellitus

    doi: 10.1371/journal.pone.0149822

    Figure Lengend Snippet: Establishment of type 2 diabetes model with db/db mice. Male db/db mice were used as mouse type 2 diabetes models, while db/+ littermates as normal controls. Body weight (A), blood glucose (B), insulin (C) and IGF-1 (D) were determined before MC38 cells injection at 8 th week. *P

    Article Snippet: The apoptosis assay showed that insulin and IGF-1 alone or both together decreased the total apoptotic cells ( ) .

    Techniques: Mouse Assay, Injection

    Insulin/IGF-1 inhibits colon cancer cells apoptosis in vitro . MC38 cells were cultured with insulin and IGF-1 alone or both together for 72 hours. Control groups were treated with PBS. (A) Cells were harvested for apoptosis analysis by Annexin V and PI staining on flow cytometry. The early stage (Annexin V+/PI-) and late stage (Annexin V+/PI+) apoptotic events were gated. The data shown are representative of three separate experiments. Quantification of total percentage (B) and early/late stage percentage (B) of apoptotic cells after the treatments. *P

    Journal: PLoS ONE

    Article Title: The Activation of ERK1/2 and JNK MAPK Signaling by Insulin/IGF-1 Is Responsible for the Development of Colon Cancer with Type 2 Diabetes Mellitus

    doi: 10.1371/journal.pone.0149822

    Figure Lengend Snippet: Insulin/IGF-1 inhibits colon cancer cells apoptosis in vitro . MC38 cells were cultured with insulin and IGF-1 alone or both together for 72 hours. Control groups were treated with PBS. (A) Cells were harvested for apoptosis analysis by Annexin V and PI staining on flow cytometry. The early stage (Annexin V+/PI-) and late stage (Annexin V+/PI+) apoptotic events were gated. The data shown are representative of three separate experiments. Quantification of total percentage (B) and early/late stage percentage (B) of apoptotic cells after the treatments. *P

    Article Snippet: The apoptosis assay showed that insulin and IGF-1 alone or both together decreased the total apoptotic cells ( ) .

    Techniques: In Vitro, Cell Culture, Staining, Flow Cytometry, Cytometry

    Inhibition of ERK1/2 or JNK signaling abolishes the proliferative and anti-apoptotic effects of insulin/IGF-1 in vitro . MC38 cells were cultured with insulin and IGF-1 alone or both together for 72 hours. ERK1/2 inhibitor PD98059 (B), JNK inhibitor SP600125 (C) or their vehicle DMSO added to the cultures when MC38 cells were treated with both insulin and IGF-1. (A) Cells were collected for proliferation analysis with CCK-8 assay at 24, 48 and 72 hour. **P

    Journal: PLoS ONE

    Article Title: The Activation of ERK1/2 and JNK MAPK Signaling by Insulin/IGF-1 Is Responsible for the Development of Colon Cancer with Type 2 Diabetes Mellitus

    doi: 10.1371/journal.pone.0149822

    Figure Lengend Snippet: Inhibition of ERK1/2 or JNK signaling abolishes the proliferative and anti-apoptotic effects of insulin/IGF-1 in vitro . MC38 cells were cultured with insulin and IGF-1 alone or both together for 72 hours. ERK1/2 inhibitor PD98059 (B), JNK inhibitor SP600125 (C) or their vehicle DMSO added to the cultures when MC38 cells were treated with both insulin and IGF-1. (A) Cells were collected for proliferation analysis with CCK-8 assay at 24, 48 and 72 hour. **P

    Article Snippet: The apoptosis assay showed that insulin and IGF-1 alone or both together decreased the total apoptotic cells ( ) .

    Techniques: Inhibition, In Vitro, Cell Culture, CCK-8 Assay

    Effects of prolactin (PRL) (25 ng/mL and 50 ng/mL) on metabolic pathway and IGF-1 expression. ( A ) Pathway enrichment predicted by Metaboanalyst and metabolic breakdown based on ( A , B ) Nicotinate and quinolinate metabolism, and ( D – F ) free amino acid flux, ( G ) geranyl pyrophosphate, ( H ) oculose-8-phosphate-oculose-1-phosphate flux, ( I – K ) lactate and coenzyme A flux, (L-P) NAD+/NADH and ATP, ADP, and AMP flux. (Q-T) Representative western blots and quantification of bands by densitometry for IGF-1, IGF-2, and IGF-1R. Western blots were converted to greyscale. Statistical significance determined by a two-way ANOVA. Experiments were performed in triplicate. Error bars represent standard error of the mean. *p

    Journal: Scientific Reports

    Article Title: Differential Effects of Hormones on Cellular Metabolism in Keratoconus In Vitro

    doi: 10.1038/srep42896

    Figure Lengend Snippet: Effects of prolactin (PRL) (25 ng/mL and 50 ng/mL) on metabolic pathway and IGF-1 expression. ( A ) Pathway enrichment predicted by Metaboanalyst and metabolic breakdown based on ( A , B ) Nicotinate and quinolinate metabolism, and ( D – F ) free amino acid flux, ( G ) geranyl pyrophosphate, ( H ) oculose-8-phosphate-oculose-1-phosphate flux, ( I – K ) lactate and coenzyme A flux, (L-P) NAD+/NADH and ATP, ADP, and AMP flux. (Q-T) Representative western blots and quantification of bands by densitometry for IGF-1, IGF-2, and IGF-1R. Western blots were converted to greyscale. Statistical significance determined by a two-way ANOVA. Experiments were performed in triplicate. Error bars represent standard error of the mean. *p

    Article Snippet: Anti-human rabbit primary antibodies were incubated with membrane overnight at 4 °C with rocking at concentrations of 1:500–1:1000: β-actin (Abcam, ab82227, Cambridge, MA), IGF-1 (Abcam, ab9572, Cambridge, MA), IGF-1R (Abcam, ab131476, Cambridge, MA), IGF-2 (Abcam, ab9574, Cambridge, MA).

    Techniques: Expressing, Western Blot

    Effects of 17β-estradiol (E2) (2.5 ng/mL and 5 ng/mL) on metabolic pathways and IGF-1 expression in HCFs and HKCs. ( A ) Chemical structure of E2 and enrichment pathways identified in HCFs by MetaboAnalyst. (#denotes pathways highlighted by metabolite breakdown). Quantitative determination of metabolite levels by targeted LC-MS/MS important in ( B – C ) steroid biosynthesis and metabolism, ( D , E ) pantothenate and geranyl pyrophosphate flux, ( F , G ) histidine metabolism, ( H , I ) Vitamin B6 metabolism, and ( J , K ) glycolytic and flavone flux, and ( L – P ) amino acid flux with increasing E2 concentrations detected by LC-MS/MS. ( Q – T ) Representative western blots and quantification of protein levels measured by densitometry. Western blots were converted to greyscale. Statistical significance determined by a two-way ANOVA. Experiments were performed in triplicate. Error bars represent standard error of the mean. *p

    Journal: Scientific Reports

    Article Title: Differential Effects of Hormones on Cellular Metabolism in Keratoconus In Vitro

    doi: 10.1038/srep42896

    Figure Lengend Snippet: Effects of 17β-estradiol (E2) (2.5 ng/mL and 5 ng/mL) on metabolic pathways and IGF-1 expression in HCFs and HKCs. ( A ) Chemical structure of E2 and enrichment pathways identified in HCFs by MetaboAnalyst. (#denotes pathways highlighted by metabolite breakdown). Quantitative determination of metabolite levels by targeted LC-MS/MS important in ( B – C ) steroid biosynthesis and metabolism, ( D , E ) pantothenate and geranyl pyrophosphate flux, ( F , G ) histidine metabolism, ( H , I ) Vitamin B6 metabolism, and ( J , K ) glycolytic and flavone flux, and ( L – P ) amino acid flux with increasing E2 concentrations detected by LC-MS/MS. ( Q – T ) Representative western blots and quantification of protein levels measured by densitometry. Western blots were converted to greyscale. Statistical significance determined by a two-way ANOVA. Experiments were performed in triplicate. Error bars represent standard error of the mean. *p

    Article Snippet: Anti-human rabbit primary antibodies were incubated with membrane overnight at 4 °C with rocking at concentrations of 1:500–1:1000: β-actin (Abcam, ab82227, Cambridge, MA), IGF-1 (Abcam, ab9572, Cambridge, MA), IGF-1R (Abcam, ab131476, Cambridge, MA), IGF-2 (Abcam, ab9574, Cambridge, MA).

    Techniques: Expressing, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Western Blot

    Effects of DHEA on metabolic pathways and IGF-1 expression in healthy human corneal fibroblasts (HCFs) and human keratoconus cells (HKCs). ( A ) Chemical structure of DHEA and enrichment pathways identified in HCFs by MetaboAnalyst following DHEA treatment. (# denotes pathways highlighted by metabolite breakdown). Quantitative determination of metabolite levels by targeted LC-MS/MS important in ( B , C ) steroid biosynthesis and metabolism, ( D – H ) phospholipid biosynthesis and signaling, and ( I – J ) pyridines, and ( K ) purine metabolism. ( L – P ) NAD+/NADH, ATP, ADP, and AMP flux in HCFs and HKCs detected by LC-MS/MS. ( Q – T ) Representative western blots and quantification of protein levels measured by densitometry showing a significant reduction in IGF-1 and its active receptor IGF-1R with no change in IGF-2 expression following DHEA treatment (2.5 ng/mL and 5 ng/mL). Western blots were converted to greyscale. Statistical significance determined by a two-way ANOVA. Experiments were performed in triplicate. Error bars represent standard error of the mean. *p

    Journal: Scientific Reports

    Article Title: Differential Effects of Hormones on Cellular Metabolism in Keratoconus In Vitro

    doi: 10.1038/srep42896

    Figure Lengend Snippet: Effects of DHEA on metabolic pathways and IGF-1 expression in healthy human corneal fibroblasts (HCFs) and human keratoconus cells (HKCs). ( A ) Chemical structure of DHEA and enrichment pathways identified in HCFs by MetaboAnalyst following DHEA treatment. (# denotes pathways highlighted by metabolite breakdown). Quantitative determination of metabolite levels by targeted LC-MS/MS important in ( B , C ) steroid biosynthesis and metabolism, ( D – H ) phospholipid biosynthesis and signaling, and ( I – J ) pyridines, and ( K ) purine metabolism. ( L – P ) NAD+/NADH, ATP, ADP, and AMP flux in HCFs and HKCs detected by LC-MS/MS. ( Q – T ) Representative western blots and quantification of protein levels measured by densitometry showing a significant reduction in IGF-1 and its active receptor IGF-1R with no change in IGF-2 expression following DHEA treatment (2.5 ng/mL and 5 ng/mL). Western blots were converted to greyscale. Statistical significance determined by a two-way ANOVA. Experiments were performed in triplicate. Error bars represent standard error of the mean. *p

    Article Snippet: Anti-human rabbit primary antibodies were incubated with membrane overnight at 4 °C with rocking at concentrations of 1:500–1:1000: β-actin (Abcam, ab82227, Cambridge, MA), IGF-1 (Abcam, ab9572, Cambridge, MA), IGF-1R (Abcam, ab131476, Cambridge, MA), IGF-2 (Abcam, ab9574, Cambridge, MA).

    Techniques: Expressing, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Western Blot

    GRPs were highly enriched for gene expression of stemness, IGF1, and IGF1R. A. Quantitative RT-PCR was performed with primers specific for CD133, Oct4, Sox2, Nanog, CXCR4, and ALDH1A1, which are stemness genes in PC9 or HCC827 parental cells and GRPs. B. Quantitative RT-PCR was performed with primers specific for IGF1 and IGF1R in PC9 or HCC827 parental cells and GRPs. Data were normalized to actin expression. *p

    Journal: PLoS ONE

    Article Title: Hypoxia Increases Gefitinib-Resistant Lung Cancer Stem Cells through the Activation of Insulin-Like Growth Factor 1 Receptor

    doi: 10.1371/journal.pone.0086459

    Figure Lengend Snippet: GRPs were highly enriched for gene expression of stemness, IGF1, and IGF1R. A. Quantitative RT-PCR was performed with primers specific for CD133, Oct4, Sox2, Nanog, CXCR4, and ALDH1A1, which are stemness genes in PC9 or HCC827 parental cells and GRPs. B. Quantitative RT-PCR was performed with primers specific for IGF1 and IGF1R in PC9 or HCC827 parental cells and GRPs. Data were normalized to actin expression. *p

    Article Snippet: Taken together, these findings suggest that the small population of NSCLC cells that were highly enriched for gene expression of stemness and IGF1 survived and could resume proliferating under treatment a high concentration of gefitinib.

    Techniques: Expressing, Quantitative RT-PCR

    IGF1R was phosphorylated on hypoxic GRPs, and knockdown of IGF1 decreased the population of CD133- and Oct4-positive hypoxic GRPs. A. Quantitative RT-PCR was performed with primers specific for IGF1 in PC9 or HCC827 parental cells, GRPs, and hypoxic GRPs. Data were normalized to actin expression. **p

    Journal: PLoS ONE

    Article Title: Hypoxia Increases Gefitinib-Resistant Lung Cancer Stem Cells through the Activation of Insulin-Like Growth Factor 1 Receptor

    doi: 10.1371/journal.pone.0086459

    Figure Lengend Snippet: IGF1R was phosphorylated on hypoxic GRPs, and knockdown of IGF1 decreased the population of CD133- and Oct4-positive hypoxic GRPs. A. Quantitative RT-PCR was performed with primers specific for IGF1 in PC9 or HCC827 parental cells, GRPs, and hypoxic GRPs. Data were normalized to actin expression. **p

    Article Snippet: Taken together, these findings suggest that the small population of NSCLC cells that were highly enriched for gene expression of stemness and IGF1 survived and could resume proliferating under treatment a high concentration of gefitinib.

    Techniques: Quantitative RT-PCR, Expressing

    Hypoxia regulates IGF1 expression through HIF1α, and the inhibition of HIF1α or IGF1R decreased CD133- and Oct4-positive GRPs under hypoxia. A. HIF1α expression was suppressed in PC9 or HCC827 hypoxic GRPs by treatment with 50 µM, 100 µM, and 200 µM YC-1 in Lab-Tek chamber slides. Immunofluorescence staining for IGF1, phosphorylated IGF1R (pIGF1R), CD133, and Oct4 was then performed. The numbers of IGF1-, pIGF1R-, CD133-, and Oct4-positive cells were counted, and the ratio of these cells was calculated in five fields from each experiment. **p

    Journal: PLoS ONE

    Article Title: Hypoxia Increases Gefitinib-Resistant Lung Cancer Stem Cells through the Activation of Insulin-Like Growth Factor 1 Receptor

    doi: 10.1371/journal.pone.0086459

    Figure Lengend Snippet: Hypoxia regulates IGF1 expression through HIF1α, and the inhibition of HIF1α or IGF1R decreased CD133- and Oct4-positive GRPs under hypoxia. A. HIF1α expression was suppressed in PC9 or HCC827 hypoxic GRPs by treatment with 50 µM, 100 µM, and 200 µM YC-1 in Lab-Tek chamber slides. Immunofluorescence staining for IGF1, phosphorylated IGF1R (pIGF1R), CD133, and Oct4 was then performed. The numbers of IGF1-, pIGF1R-, CD133-, and Oct4-positive cells were counted, and the ratio of these cells was calculated in five fields from each experiment. **p

    Article Snippet: Taken together, these findings suggest that the small population of NSCLC cells that were highly enriched for gene expression of stemness and IGF1 survived and could resume proliferating under treatment a high concentration of gefitinib.

    Techniques: Expressing, Inhibition, Immunofluorescence, Staining

    IGF-1 can improve the memory in a new environment of septic rats. Notes: Compared with training session in each group, the number of crossings and rearings in testing session is reduced in sham-operative, antibiotic + IGF-1, and IGF-1 groups (Student’s t -test, * P

    Journal: Neuropsychiatric Disease and Treatment

    Article Title: Effects of early administration of insulin-like growth factor-1 on cognitive function in septic encephalopathy

    doi: 10.2147/NDT.S190845

    Figure Lengend Snippet: IGF-1 can improve the memory in a new environment of septic rats. Notes: Compared with training session in each group, the number of crossings and rearings in testing session is reduced in sham-operative, antibiotic + IGF-1, and IGF-1 groups (Student’s t -test, * P

    Article Snippet: First, the effects of IGF-1 on survival, and cognitive and emotional changes of septic rats were observed.

    Techniques:

    IGF-1 cannot improve the impairment of noxious memory of septic rats when it is administrated at 12, 24, or 36 hours after CLP. Notes: Latency is longer in 0-hour and 6-hour groups (Kruskal–Walls H-test and Nemenyi test, * P

    Journal: Neuropsychiatric Disease and Treatment

    Article Title: Effects of early administration of insulin-like growth factor-1 on cognitive function in septic encephalopathy

    doi: 10.2147/NDT.S190845

    Figure Lengend Snippet: IGF-1 cannot improve the impairment of noxious memory of septic rats when it is administrated at 12, 24, or 36 hours after CLP. Notes: Latency is longer in 0-hour and 6-hour groups (Kruskal–Walls H-test and Nemenyi test, * P

    Article Snippet: First, the effects of IGF-1 on survival, and cognitive and emotional changes of septic rats were observed.

    Techniques:

    IGF-1 can improve the spatial learning and memory of septic rats. Notes: ( A ) Compared with the sham-operation group, escape latency was longer in the antibiotic and saline groups on the third and fourth days, while no significant differences were found among the four groups on the first two days (ANOVA, P > 0.1). ( B ) The number of times the rats reached the target quadrant was lower in the antibiotic and saline groups compared with the sham-operation group (ANOVA and Bonferroni’s test, * P

    Journal: Neuropsychiatric Disease and Treatment

    Article Title: Effects of early administration of insulin-like growth factor-1 on cognitive function in septic encephalopathy

    doi: 10.2147/NDT.S190845

    Figure Lengend Snippet: IGF-1 can improve the spatial learning and memory of septic rats. Notes: ( A ) Compared with the sham-operation group, escape latency was longer in the antibiotic and saline groups on the third and fourth days, while no significant differences were found among the four groups on the first two days (ANOVA, P > 0.1). ( B ) The number of times the rats reached the target quadrant was lower in the antibiotic and saline groups compared with the sham-operation group (ANOVA and Bonferroni’s test, * P

    Article Snippet: First, the effects of IGF-1 on survival, and cognitive and emotional changes of septic rats were observed.

    Techniques:

    IGF-1 could not improve the depressive-like symptoms which might be caused by SE. Notes: Compared with the sham-operative group, immobility time was prolonged in the antibiotic, antibiotic + IGF-1, saline, and IGF-1 groups ( * P

    Journal: Neuropsychiatric Disease and Treatment

    Article Title: Effects of early administration of insulin-like growth factor-1 on cognitive function in septic encephalopathy

    doi: 10.2147/NDT.S190845

    Figure Lengend Snippet: IGF-1 could not improve the depressive-like symptoms which might be caused by SE. Notes: Compared with the sham-operative group, immobility time was prolonged in the antibiotic, antibiotic + IGF-1, saline, and IGF-1 groups ( * P

    Article Snippet: First, the effects of IGF-1 on survival, and cognitive and emotional changes of septic rats were observed.

    Techniques:

    Inhibition of cell apoptosis in the hippocampus is associated with improvement of memory and learning during sepsis. Notes: ( A ) Cells stained with fluorescein-dUTP were visualized under a fluorescence microscope (40×). The nucleus was stained by DAPI (blue). Compared with the sham-operation group (n=9), the rates of apoptotic cells were higher in the antibiotic (n=9) and antibiotic + IGF-1 (n=7) groups (Kruskal–Walls H-test and Nemenyi test, * P

    Journal: Neuropsychiatric Disease and Treatment

    Article Title: Effects of early administration of insulin-like growth factor-1 on cognitive function in septic encephalopathy

    doi: 10.2147/NDT.S190845

    Figure Lengend Snippet: Inhibition of cell apoptosis in the hippocampus is associated with improvement of memory and learning during sepsis. Notes: ( A ) Cells stained with fluorescein-dUTP were visualized under a fluorescence microscope (40×). The nucleus was stained by DAPI (blue). Compared with the sham-operation group (n=9), the rates of apoptotic cells were higher in the antibiotic (n=9) and antibiotic + IGF-1 (n=7) groups (Kruskal–Walls H-test and Nemenyi test, * P

    Article Snippet: First, the effects of IGF-1 on survival, and cognitive and emotional changes of septic rats were observed.

    Techniques: Inhibition, Staining, Fluorescence, Microscopy

    IGF-1 cannot improve the spatial learning and memory of septic rats when it is administrated at 12, 24, or 36 hours after CLP. Notes: ( A ) Escape latency was shorter in the 0-hour and 6-hour groups compared with the other groups on the third and fourth days. No differences were found on the first 2 days among groups (ANOVA, P > 0.1). ( B ) The number of times the rats reached the target quadrant in the 0-hour and 6-hour IGF-1 groups was higher than that of the 12-hour, 24-hour, and 36-hour IGF-1 groups (ANOVA and Bonferroni’s test, * P

    Journal: Neuropsychiatric Disease and Treatment

    Article Title: Effects of early administration of insulin-like growth factor-1 on cognitive function in septic encephalopathy

    doi: 10.2147/NDT.S190845

    Figure Lengend Snippet: IGF-1 cannot improve the spatial learning and memory of septic rats when it is administrated at 12, 24, or 36 hours after CLP. Notes: ( A ) Escape latency was shorter in the 0-hour and 6-hour groups compared with the other groups on the third and fourth days. No differences were found on the first 2 days among groups (ANOVA, P > 0.1). ( B ) The number of times the rats reached the target quadrant in the 0-hour and 6-hour IGF-1 groups was higher than that of the 12-hour, 24-hour, and 36-hour IGF-1 groups (ANOVA and Bonferroni’s test, * P

    Article Snippet: First, the effects of IGF-1 on survival, and cognitive and emotional changes of septic rats were observed.

    Techniques:

    IGF-1 cannot improve the memory of septic rats in a new environment when it is administrated at 12, 24, or 36 hours after CLP. Notes: Compared with their own data in the training session, the number of crossings and rearings was decreased in the testing session in the 0-hour and 6-hour IGF-1 groups (Student’s t -test, * P

    Journal: Neuropsychiatric Disease and Treatment

    Article Title: Effects of early administration of insulin-like growth factor-1 on cognitive function in septic encephalopathy

    doi: 10.2147/NDT.S190845

    Figure Lengend Snippet: IGF-1 cannot improve the memory of septic rats in a new environment when it is administrated at 12, 24, or 36 hours after CLP. Notes: Compared with their own data in the training session, the number of crossings and rearings was decreased in the testing session in the 0-hour and 6-hour IGF-1 groups (Student’s t -test, * P

    Article Snippet: First, the effects of IGF-1 on survival, and cognitive and emotional changes of septic rats were observed.

    Techniques:

    Cytochorme C and TNFR are activated at different time points and IGF-1 can inhibit their expression. Notes: ( A ) Six hours after CLP, the expression of cytochrome C and caspase-9 is increased in antibiotic group (n=8) (ANOVA and Bonferroni’s test, * P

    Journal: Neuropsychiatric Disease and Treatment

    Article Title: Effects of early administration of insulin-like growth factor-1 on cognitive function in septic encephalopathy

    doi: 10.2147/NDT.S190845

    Figure Lengend Snippet: Cytochorme C and TNFR are activated at different time points and IGF-1 can inhibit their expression. Notes: ( A ) Six hours after CLP, the expression of cytochrome C and caspase-9 is increased in antibiotic group (n=8) (ANOVA and Bonferroni’s test, * P

    Article Snippet: First, the effects of IGF-1 on survival, and cognitive and emotional changes of septic rats were observed.

    Techniques: Expressing

    IGF-1 can relieve the impairment of noxious memory in septic rats. Notes: Compared with the training session, latency in the testing session was longer in the sham-operation, antibiotic + IGF-1, and IGF-1 groups (Nemenyi test, # P

    Journal: Neuropsychiatric Disease and Treatment

    Article Title: Effects of early administration of insulin-like growth factor-1 on cognitive function in septic encephalopathy

    doi: 10.2147/NDT.S190845

    Figure Lengend Snippet: IGF-1 can relieve the impairment of noxious memory in septic rats. Notes: Compared with the training session, latency in the testing session was longer in the sham-operation, antibiotic + IGF-1, and IGF-1 groups (Nemenyi test, # P

    Article Snippet: First, the effects of IGF-1 on survival, and cognitive and emotional changes of septic rats were observed.

    Techniques:

    IGF-1 cannot improve the survival rate of septic rats. Notes: No statistically significant difference was found between the antibiotic and antibiotic + IGF-1 groups, while survival was significantly reduced in the saline and IGF-1 groups compared with the antibiotic and antibiotic + IGF-1 groups. Abbreviation: IGF-1, insulin-like growth factor-1.

    Journal: Neuropsychiatric Disease and Treatment

    Article Title: Effects of early administration of insulin-like growth factor-1 on cognitive function in septic encephalopathy

    doi: 10.2147/NDT.S190845

    Figure Lengend Snippet: IGF-1 cannot improve the survival rate of septic rats. Notes: No statistically significant difference was found between the antibiotic and antibiotic + IGF-1 groups, while survival was significantly reduced in the saline and IGF-1 groups compared with the antibiotic and antibiotic + IGF-1 groups. Abbreviation: IGF-1, insulin-like growth factor-1.

    Article Snippet: First, the effects of IGF-1 on survival, and cognitive and emotional changes of septic rats were observed.

    Techniques:

    Reduced DETCs around a wound resulted in the weakened production of IGF-1 and KGF in the epidermis of diabetic mice. Wild-type C57BL/6J mice were administered daily i.p. injections of STZ or vehicle control for 6 days, and received full-thickness wounds in their back skin 4 weeks after STZ treatment. A. Reduced expression of IGF-1 and KGF in the epidermis around the wound of diabetic mice. On day 1 after wounding, the epidermis around wound of STZ-induced diabetic or control mice was obtained to detect the protein expression of IGF-1 and KGF by Western blot. B. Diabetic mice displayed significantly fewer DETCs in the intact epidermis and wounded epidermis compared with wild-type controls. DETCs numbers were increased upon wounding in wild-type controls compared with diabetic mice. The epidermis in the intact skin and around the wound at day 1 after wounding of STZ-induced diabetic or control mice were obtained to examine the number of DETCs by using FACS. *p

    Journal: American Journal of Translational Research

    Article Title: Dendritic epidermal T cells facilitate wound healing in diabetic mice

    doi:

    Figure Lengend Snippet: Reduced DETCs around a wound resulted in the weakened production of IGF-1 and KGF in the epidermis of diabetic mice. Wild-type C57BL/6J mice were administered daily i.p. injections of STZ or vehicle control for 6 days, and received full-thickness wounds in their back skin 4 weeks after STZ treatment. A. Reduced expression of IGF-1 and KGF in the epidermis around the wound of diabetic mice. On day 1 after wounding, the epidermis around wound of STZ-induced diabetic or control mice was obtained to detect the protein expression of IGF-1 and KGF by Western blot. B. Diabetic mice displayed significantly fewer DETCs in the intact epidermis and wounded epidermis compared with wild-type controls. DETCs numbers were increased upon wounding in wild-type controls compared with diabetic mice. The epidermis in the intact skin and around the wound at day 1 after wounding of STZ-induced diabetic or control mice were obtained to examine the number of DETCs by using FACS. *p

    Article Snippet: IGF-1 is an important growth factor that is closely associated with wound healing.

    Techniques: Mouse Assay, Expressing, Western Blot, FACS

    Diabetic wound healing conditions were improved by the application of DETCs. A. DETC application promoted the expression of IGF-1, KGF and PCNA in the epidermis around wound in diabetic mice. On day 4 after wounding, the epidermis around the wounds of STZ-induced diabetic mice was obtained to detect the expression of IGF-1, KGF and PCNA by Western blot. B. DETC application inhibited the apoptosis of epidermal cells around the wound in diabetic mice. Epidermal cells were stained with annexin V and propidium iodide (PI) to assess apoptosis and analyzed by flow cytometry. *p

    Journal: American Journal of Translational Research

    Article Title: Dendritic epidermal T cells facilitate wound healing in diabetic mice

    doi:

    Figure Lengend Snippet: Diabetic wound healing conditions were improved by the application of DETCs. A. DETC application promoted the expression of IGF-1, KGF and PCNA in the epidermis around wound in diabetic mice. On day 4 after wounding, the epidermis around the wounds of STZ-induced diabetic mice was obtained to detect the expression of IGF-1, KGF and PCNA by Western blot. B. DETC application inhibited the apoptosis of epidermal cells around the wound in diabetic mice. Epidermal cells were stained with annexin V and propidium iodide (PI) to assess apoptosis and analyzed by flow cytometry. *p

    Article Snippet: IGF-1 is an important growth factor that is closely associated with wound healing.

    Techniques: Expressing, Mouse Assay, Western Blot, Staining, Flow Cytometry, Cytometry

    MEK1 regulates oxidative stress and mitochondrial membrane function in ER + breast cancer cells . (a through c) MEK1 downregulation blocked the prosurvival effects of IGF-1 and enhanced ROS and mitochondrial membrane depolarization in hormonally treated breast cancer cells. (a) Western blot shows effective RNAi targeting of MEK1, which was carried out for 48 hours before cells were treated with E2, E2 + 4-OHT, or E2 + 4-OHT + MIF for 24 hours. Protein was isolated from cells and analyzed for MEK1 expression with immunoblot analysis. (b, c) Cell populations with reduced MEK1 expression were analyzed at 6 and 72 hours for ROS and mitochondrial membrane depolarization, respectively. (d through f) MEK1 overexpression reduced ROS and mitochondrial membrane depolarization in hormonally treated breast cancer cells. Transient transfection of MEK1 cDNA (MEK1-GFP vector) increased MEK1 expression above levels seen in vector-only (pEGFP-1)-transfected control cells at 24 and 48 hours, as determined by immunoblot analysis (d) , and reduced ROS levels and mitochondrial membrane depolarization at 24 and 72 hours, respectively (e, f) . Values are expressed as mean ± SD ( n = 3). Significant differences are designated as follows: (a) Scrambled versus SiMEK, E2 (± IGF-1); (b) Scrambled versus SiMEK, E2 + 4-OHT (± IGF-1); (c) Scrambled versus SiMEK, E2 + MIF (± IGF-1); (d) Scrambled versus SiMEK, E2 + 4-OHT + MIF; (e) pEGFP-N1 versus MEK1-GFP, E2 + 4-OHT; (f) pEGFP-N1 versus MEK1-GFP, E2 + MIF; (g) pEGFP-N1, E2 + 4-OHT + MIF versus MEK1-GFP, E2 + 4-OHT + MIF. * P

    Journal: Breast Cancer Research : BCR

    Article Title: Insulin-like growth factor 1 attenuates antiestrogen- and antiprogestin-induced apoptosis in ER+ breast cancer cells by MEK1 regulation of the BH3-only pro-apoptotic protein Bim

    doi: 10.1186/bcr3153

    Figure Lengend Snippet: MEK1 regulates oxidative stress and mitochondrial membrane function in ER + breast cancer cells . (a through c) MEK1 downregulation blocked the prosurvival effects of IGF-1 and enhanced ROS and mitochondrial membrane depolarization in hormonally treated breast cancer cells. (a) Western blot shows effective RNAi targeting of MEK1, which was carried out for 48 hours before cells were treated with E2, E2 + 4-OHT, or E2 + 4-OHT + MIF for 24 hours. Protein was isolated from cells and analyzed for MEK1 expression with immunoblot analysis. (b, c) Cell populations with reduced MEK1 expression were analyzed at 6 and 72 hours for ROS and mitochondrial membrane depolarization, respectively. (d through f) MEK1 overexpression reduced ROS and mitochondrial membrane depolarization in hormonally treated breast cancer cells. Transient transfection of MEK1 cDNA (MEK1-GFP vector) increased MEK1 expression above levels seen in vector-only (pEGFP-1)-transfected control cells at 24 and 48 hours, as determined by immunoblot analysis (d) , and reduced ROS levels and mitochondrial membrane depolarization at 24 and 72 hours, respectively (e, f) . Values are expressed as mean ± SD ( n = 3). Significant differences are designated as follows: (a) Scrambled versus SiMEK, E2 (± IGF-1); (b) Scrambled versus SiMEK, E2 + 4-OHT (± IGF-1); (c) Scrambled versus SiMEK, E2 + MIF (± IGF-1); (d) Scrambled versus SiMEK, E2 + 4-OHT + MIF; (e) pEGFP-N1 versus MEK1-GFP, E2 + 4-OHT; (f) pEGFP-N1 versus MEK1-GFP, E2 + MIF; (g) pEGFP-N1, E2 + 4-OHT + MIF versus MEK1-GFP, E2 + 4-OHT + MIF. * P

    Article Snippet: Under our treatment conditions and at multiple time points analyzed, cells treated with IGF-1 and E2 showed higher levels of MAPK1/2 phosphorylation (designated pMAPK) than did E2-treated or IGF-1-treated cells (Figure ; compare lane 5 with lane 1, and data not shown).

    Techniques: Western Blot, Isolation, Expressing, Over Expression, Transfection, Plasmid Preparation

    BimEL expression levels vary between ER + breast cancer cell models and correlate to apoptotic outcome in response to hormonal treatments and MEK1 blockade . (a, b) Cell-number determinations showed that IGF-1 stimulated T-47D cell growth via a MEK1-dependent proliferation pathway. T-47D cells were treated with the indicated hormones in the presence or absence of IGF-1 (20 ng/ml) plus and minus PD 98059 for 216 hours (a) or U0126 for 144 hours (b) . (c) Western blot showed BimEL levels relative to the levels of cle aved PARP in T-47D cells treated with hormones in the absence or presence of U0126 for 72 hours. The levels of ER and PR are provided for validation of the ER and PR status of T-47D and MCF-7 cells used in this study. (d) Western blot compared the levels of BimEL in MCF-7 versus T-47D cells treated with hormones plus or minus U0126 for 48 h. (e) ROS levels were determined for T-47D and MCF-7 cells treated with the indicated hormones in the presence or absence of IGF-1 plus or minus MEK1 blockade with U0126. (f) Western blot showed that treatment with MG132 caused an accumulation of phosphorylated Bim EL in MCF-7 cells, but not in T-47D cells. (a through f) As described in Materials and Methods, at the indicated times, cells were harvested and analyzed either for cell counts (a, b) , protein expression by SDS/PAGE and immunoblotting for BimEL, pBimEL, pro-caspase-3, pMAPK, and total MAPK or β-actin, which were used as loading controls (c, d) , or for ROS determination (e) .

    Journal: Breast Cancer Research : BCR

    Article Title: Insulin-like growth factor 1 attenuates antiestrogen- and antiprogestin-induced apoptosis in ER+ breast cancer cells by MEK1 regulation of the BH3-only pro-apoptotic protein Bim

    doi: 10.1186/bcr3153

    Figure Lengend Snippet: BimEL expression levels vary between ER + breast cancer cell models and correlate to apoptotic outcome in response to hormonal treatments and MEK1 blockade . (a, b) Cell-number determinations showed that IGF-1 stimulated T-47D cell growth via a MEK1-dependent proliferation pathway. T-47D cells were treated with the indicated hormones in the presence or absence of IGF-1 (20 ng/ml) plus and minus PD 98059 for 216 hours (a) or U0126 for 144 hours (b) . (c) Western blot showed BimEL levels relative to the levels of cle aved PARP in T-47D cells treated with hormones in the absence or presence of U0126 for 72 hours. The levels of ER and PR are provided for validation of the ER and PR status of T-47D and MCF-7 cells used in this study. (d) Western blot compared the levels of BimEL in MCF-7 versus T-47D cells treated with hormones plus or minus U0126 for 48 h. (e) ROS levels were determined for T-47D and MCF-7 cells treated with the indicated hormones in the presence or absence of IGF-1 plus or minus MEK1 blockade with U0126. (f) Western blot showed that treatment with MG132 caused an accumulation of phosphorylated Bim EL in MCF-7 cells, but not in T-47D cells. (a through f) As described in Materials and Methods, at the indicated times, cells were harvested and analyzed either for cell counts (a, b) , protein expression by SDS/PAGE and immunoblotting for BimEL, pBimEL, pro-caspase-3, pMAPK, and total MAPK or β-actin, which were used as loading controls (c, d) , or for ROS determination (e) .

    Article Snippet: Under our treatment conditions and at multiple time points analyzed, cells treated with IGF-1 and E2 showed higher levels of MAPK1/2 phosphorylation (designated pMAPK) than did E2-treated or IGF-1-treated cells (Figure ; compare lane 5 with lane 1, and data not shown).

    Techniques: Expressing, Western Blot, SDS Page

    RNAi targeting of BIM expression protects MCF-7 cells from apoptotic cell death induced by 4-OHT, MIF, and/or U0126 treatments . (a, c) BIM expression was reduced in all treatment groups by RNAi targeting. MCF-7 cells were seeded in DMEM/F12 medium containing 5% DCC FBS and, after 24 hours, transfected with scrambled or BIM-targeting RNAi. Forty-eight hours after transfection, the cells were treated with E2, E2 + 4-OHT, or E2 + 4-OHT + MIF in the absence (a) or presence of IGF-1 (20 ng/ml) (c, d) and/or U0126 (5 m M ). Cells were harvested for protein at 48 hours (a, c ) or 72 hours (d) after treatment and subjected to immunoblot analysis to determine levels of Bim, cleaved PARP, and cleaved lamin (a) β-actin levels served as a loading control. (b) BIM knockdown via siRNA targeting reduces the levels of ROS generated by 1 hour of treatment with 4-OHT and/or MIF. Values are expressed as mean ± SD. Statistical significance was identified between the following treatment groups: (a) scrambled E2 + 4-OHT versus siBimE2 +4-OHT; (b) scrambled E2 + MIF versus siBim E2 + MIF; (c) scrambled E2 + 4-OHT + MIF versus siBim E2 + 4-OHT + MIF; (d) scrambled E2 + 4-OHT + U0126 versus siBim E2 + 4-OHT + U0126; (e) scrambled E2 + MIF + U0126 versus siBim E2 + MIF + U0126; and (f) scrambled E2 + 4-OHT + MIF + U0126 versus siBim E2 + 4-OHT + MIF + U0126. * P

    Journal: Breast Cancer Research : BCR

    Article Title: Insulin-like growth factor 1 attenuates antiestrogen- and antiprogestin-induced apoptosis in ER+ breast cancer cells by MEK1 regulation of the BH3-only pro-apoptotic protein Bim

    doi: 10.1186/bcr3153

    Figure Lengend Snippet: RNAi targeting of BIM expression protects MCF-7 cells from apoptotic cell death induced by 4-OHT, MIF, and/or U0126 treatments . (a, c) BIM expression was reduced in all treatment groups by RNAi targeting. MCF-7 cells were seeded in DMEM/F12 medium containing 5% DCC FBS and, after 24 hours, transfected with scrambled or BIM-targeting RNAi. Forty-eight hours after transfection, the cells were treated with E2, E2 + 4-OHT, or E2 + 4-OHT + MIF in the absence (a) or presence of IGF-1 (20 ng/ml) (c, d) and/or U0126 (5 m M ). Cells were harvested for protein at 48 hours (a, c ) or 72 hours (d) after treatment and subjected to immunoblot analysis to determine levels of Bim, cleaved PARP, and cleaved lamin (a) β-actin levels served as a loading control. (b) BIM knockdown via siRNA targeting reduces the levels of ROS generated by 1 hour of treatment with 4-OHT and/or MIF. Values are expressed as mean ± SD. Statistical significance was identified between the following treatment groups: (a) scrambled E2 + 4-OHT versus siBimE2 +4-OHT; (b) scrambled E2 + MIF versus siBim E2 + MIF; (c) scrambled E2 + 4-OHT + MIF versus siBim E2 + 4-OHT + MIF; (d) scrambled E2 + 4-OHT + U0126 versus siBim E2 + 4-OHT + U0126; (e) scrambled E2 + MIF + U0126 versus siBim E2 + MIF + U0126; and (f) scrambled E2 + 4-OHT + MIF + U0126 versus siBim E2 + 4-OHT + MIF + U0126. * P

    Article Snippet: Under our treatment conditions and at multiple time points analyzed, cells treated with IGF-1 and E2 showed higher levels of MAPK1/2 phosphorylation (designated pMAPK) than did E2-treated or IGF-1-treated cells (Figure ; compare lane 5 with lane 1, and data not shown).

    Techniques: Expressing, Droplet Countercurrent Chromatography, Transfection, Generated

    A schematic representation of the role of BimEL and induction of apoptosis in ER + breast cancer cells . This model is a summary of data showing that MEK1 blockade, in addition to hormonal treatment (antiestrogen or antiprogestin treatment) will activate Bim via dephosphorylation and induce an ROS-dependent apoptotic cell death in some ER + breast cancer cells, particularly if IGF-1-induced IGF-IR signaling is active.

    Journal: Breast Cancer Research : BCR

    Article Title: Insulin-like growth factor 1 attenuates antiestrogen- and antiprogestin-induced apoptosis in ER+ breast cancer cells by MEK1 regulation of the BH3-only pro-apoptotic protein Bim

    doi: 10.1186/bcr3153

    Figure Lengend Snippet: A schematic representation of the role of BimEL and induction of apoptosis in ER + breast cancer cells . This model is a summary of data showing that MEK1 blockade, in addition to hormonal treatment (antiestrogen or antiprogestin treatment) will activate Bim via dephosphorylation and induce an ROS-dependent apoptotic cell death in some ER + breast cancer cells, particularly if IGF-1-induced IGF-IR signaling is active.

    Article Snippet: Under our treatment conditions and at multiple time points analyzed, cells treated with IGF-1 and E2 showed higher levels of MAPK1/2 phosphorylation (designated pMAPK) than did E2-treated or IGF-1-treated cells (Figure ; compare lane 5 with lane 1, and data not shown).

    Techniques: De-Phosphorylation Assay

    IGF-1 attenuates 4-OHT and/or MIF-induced cell death by reducing ROS levels . (a, b) ROS levels in cells undergoing hormonal treatments in the presence or absence of IGF-1 (a) or vitamin E (b) . (c) The percentage of mitochondrial membrane permeabilization in cells undergoing hormonal treatments in the presence or absence of vitamin E. (d) The levels of cleaved PARP and lamin A in cells treated with 4-OHT and/or MIF in the presence and absence of vitamin E. fold diff ., the levels of cleaved PARP or lamin A relative to levels in E2-treated cells, which were arbitrarily assigned a value of 1.0; β-actin served as a loading control. (a-d) MCF-7 cells treated with E2, E2 + 4-OHT, E2 + MIF, E2 + 4-OHT + MIF in the presence or absence of IGF-1 (20 ng/ml) or vitamin E (500 μ; M ) for the indicated times were harvested for determination of ROS levels, percentage mitochondrial membrane permeabilization, or levels of cleaved PARP and laminA, as described in Materials and Methods. Values are expressed as mean ± SD ( n = 3). Statistically significant differences are identified between comparisons of the following treatment groups: (a) E2 versus E2 + vitamin E; (b) E2 + 4-OHT versus E2 + 4-OHT + IGF-1 or E2 + 4-OHT + vitamin E; (c) E2 +MIF versus E2 + MIF + IGF-1 or E2 + MIF + vitamin E; and (d) E2 + 4-OHT + MIF versus E2+ 4-OHT + MIF + IGF-1 or E2 + 4-OHT + MIF + vitamin E. * P

    Journal: Breast Cancer Research : BCR

    Article Title: Insulin-like growth factor 1 attenuates antiestrogen- and antiprogestin-induced apoptosis in ER+ breast cancer cells by MEK1 regulation of the BH3-only pro-apoptotic protein Bim

    doi: 10.1186/bcr3153

    Figure Lengend Snippet: IGF-1 attenuates 4-OHT and/or MIF-induced cell death by reducing ROS levels . (a, b) ROS levels in cells undergoing hormonal treatments in the presence or absence of IGF-1 (a) or vitamin E (b) . (c) The percentage of mitochondrial membrane permeabilization in cells undergoing hormonal treatments in the presence or absence of vitamin E. (d) The levels of cleaved PARP and lamin A in cells treated with 4-OHT and/or MIF in the presence and absence of vitamin E. fold diff ., the levels of cleaved PARP or lamin A relative to levels in E2-treated cells, which were arbitrarily assigned a value of 1.0; β-actin served as a loading control. (a-d) MCF-7 cells treated with E2, E2 + 4-OHT, E2 + MIF, E2 + 4-OHT + MIF in the presence or absence of IGF-1 (20 ng/ml) or vitamin E (500 μ; M ) for the indicated times were harvested for determination of ROS levels, percentage mitochondrial membrane permeabilization, or levels of cleaved PARP and laminA, as described in Materials and Methods. Values are expressed as mean ± SD ( n = 3). Statistically significant differences are identified between comparisons of the following treatment groups: (a) E2 versus E2 + vitamin E; (b) E2 + 4-OHT versus E2 + 4-OHT + IGF-1 or E2 + 4-OHT + vitamin E; (c) E2 +MIF versus E2 + MIF + IGF-1 or E2 + MIF + vitamin E; and (d) E2 + 4-OHT + MIF versus E2+ 4-OHT + MIF + IGF-1 or E2 + 4-OHT + MIF + vitamin E. * P

    Article Snippet: Under our treatment conditions and at multiple time points analyzed, cells treated with IGF-1 and E2 showed higher levels of MAPK1/2 phosphorylation (designated pMAPK) than did E2-treated or IGF-1-treated cells (Figure ; compare lane 5 with lane 1, and data not shown).

    Techniques:

    The IGF-1/MEK signaling axis blocks the cytotoxic action of 4-OHT and/or MIF-treatments of ER + breast cancer cells . (a) Graphic representation of Western blot data showing pMAPK1/2 levels in cells treated with hormones in the absence and presence of IGF-1. The pMAPK1/2 level in E2-treated cells were arbitrarily set to a value of 100%; total MAPK levels served as the loading control. (b) Effective and selective blockade of MAPK1/2 phosphorylation by the MEK1 inhibitor PD 98059. Total MAPK1/2 and AKT levels served as loading controls. (c, d) PD 98059 blocked the proliferative effects of IGF-1 and restored the ability of 4-OHT and/or MIF therapy to induce cell detachment and cleavage of PARP (apoptosis) in the MCF-7 cell populations treated with 4-OHT and/or MIF. fold diff ., levels of cleaved PARP after correction for differences in protein loading; β- actin levels served as loading controls. (a-d) Cells were treated for the indicated time periods with hormones, as indicated in the absence or presence of IGF-1 at 20 ng/ml and/or PD 98059 at 25 μ;g/ml and harvested for immunoblotting or cell counts, as described in Materials and Methods. Values are expressed as mean ± SD ( n = 3). Treatment effects on total cell number were determined to be significant when compared with (a) E2; (b) E2 + IGF-1; (c) E2 + 4-OHT + IGF-1; (d) E2 + MIF + IGF-1; (e) E2 + IGF-1 + PD 98059. * P

    Journal: Breast Cancer Research : BCR

    Article Title: Insulin-like growth factor 1 attenuates antiestrogen- and antiprogestin-induced apoptosis in ER+ breast cancer cells by MEK1 regulation of the BH3-only pro-apoptotic protein Bim

    doi: 10.1186/bcr3153

    Figure Lengend Snippet: The IGF-1/MEK signaling axis blocks the cytotoxic action of 4-OHT and/or MIF-treatments of ER + breast cancer cells . (a) Graphic representation of Western blot data showing pMAPK1/2 levels in cells treated with hormones in the absence and presence of IGF-1. The pMAPK1/2 level in E2-treated cells were arbitrarily set to a value of 100%; total MAPK levels served as the loading control. (b) Effective and selective blockade of MAPK1/2 phosphorylation by the MEK1 inhibitor PD 98059. Total MAPK1/2 and AKT levels served as loading controls. (c, d) PD 98059 blocked the proliferative effects of IGF-1 and restored the ability of 4-OHT and/or MIF therapy to induce cell detachment and cleavage of PARP (apoptosis) in the MCF-7 cell populations treated with 4-OHT and/or MIF. fold diff ., levels of cleaved PARP after correction for differences in protein loading; β- actin levels served as loading controls. (a-d) Cells were treated for the indicated time periods with hormones, as indicated in the absence or presence of IGF-1 at 20 ng/ml and/or PD 98059 at 25 μ;g/ml and harvested for immunoblotting or cell counts, as described in Materials and Methods. Values are expressed as mean ± SD ( n = 3). Treatment effects on total cell number were determined to be significant when compared with (a) E2; (b) E2 + IGF-1; (c) E2 + 4-OHT + IGF-1; (d) E2 + MIF + IGF-1; (e) E2 + IGF-1 + PD 98059. * P

    Article Snippet: Under our treatment conditions and at multiple time points analyzed, cells treated with IGF-1 and E2 showed higher levels of MAPK1/2 phosphorylation (designated pMAPK) than did E2-treated or IGF-1-treated cells (Figure ; compare lane 5 with lane 1, and data not shown).

    Techniques: Western Blot

    SX13 cells expressing low-levels of IGF-1R are sensitive to the death-inducing effects of PD 98059 . (a) Western blot showing low levels of IGF-1R, but comparable levels of ERα and cleaved PARP in SX13 and NEO cells undergoing the indicated hormonal treatments for 120 hours. (b, c) Cell counts showing that IGF-1 does not enhance E2-stimulated SX13 cell proliferation, but that PD 98059 can restore the growth-inhibitory effects of 4-OHT treatment. Cells (2 × 10 5 ) were seeded and, after 24 hours, treated with either 1% or 5% FBS-DCC serum in the absence (E2 ablation) or presence of E2 and/or IGF-1 for 168 hours (b) or 144 hours (c) . Cell counts were performed with a Coulter counter (c) . (d) Trypan blue exclusion assay shows that IGF-1 attenuates the death-inducing effects of 4-OHT and/or MIF treatments in an MEK1-dependent manner. At 144 hours after treatments, adherent and detached cells were collected and counted by using a hemacytometer. (e) Representative images show that PD 98059 effectively reduces cell number in the E2-treated cell population (compare a with b ), and induces cell shrinkage and detachment, indicative of apoptosis, in the 4-OHT plus MIF-treated cell population (compare c with d ). Data in ( b through d ) are expressed as mean ± SD ( n = 3). The following show significant differences in the induction of apoptosis (number of detached cells) and cell proliferation for the hormonal therapies compared with: (a) E2; (b) 4-OHT + MIF; (c) E2+IGF-1; (d) E2+IGF-1+PD 98059. * P

    Journal: Breast Cancer Research : BCR

    Article Title: Insulin-like growth factor 1 attenuates antiestrogen- and antiprogestin-induced apoptosis in ER+ breast cancer cells by MEK1 regulation of the BH3-only pro-apoptotic protein Bim

    doi: 10.1186/bcr3153

    Figure Lengend Snippet: SX13 cells expressing low-levels of IGF-1R are sensitive to the death-inducing effects of PD 98059 . (a) Western blot showing low levels of IGF-1R, but comparable levels of ERα and cleaved PARP in SX13 and NEO cells undergoing the indicated hormonal treatments for 120 hours. (b, c) Cell counts showing that IGF-1 does not enhance E2-stimulated SX13 cell proliferation, but that PD 98059 can restore the growth-inhibitory effects of 4-OHT treatment. Cells (2 × 10 5 ) were seeded and, after 24 hours, treated with either 1% or 5% FBS-DCC serum in the absence (E2 ablation) or presence of E2 and/or IGF-1 for 168 hours (b) or 144 hours (c) . Cell counts were performed with a Coulter counter (c) . (d) Trypan blue exclusion assay shows that IGF-1 attenuates the death-inducing effects of 4-OHT and/or MIF treatments in an MEK1-dependent manner. At 144 hours after treatments, adherent and detached cells were collected and counted by using a hemacytometer. (e) Representative images show that PD 98059 effectively reduces cell number in the E2-treated cell population (compare a with b ), and induces cell shrinkage and detachment, indicative of apoptosis, in the 4-OHT plus MIF-treated cell population (compare c with d ). Data in ( b through d ) are expressed as mean ± SD ( n = 3). The following show significant differences in the induction of apoptosis (number of detached cells) and cell proliferation for the hormonal therapies compared with: (a) E2; (b) 4-OHT + MIF; (c) E2+IGF-1; (d) E2+IGF-1+PD 98059. * P

    Article Snippet: Under our treatment conditions and at multiple time points analyzed, cells treated with IGF-1 and E2 showed higher levels of MAPK1/2 phosphorylation (designated pMAPK) than did E2-treated or IGF-1-treated cells (Figure ; compare lane 5 with lane 1, and data not shown).

    Techniques: Expressing, Western Blot, Droplet Countercurrent Chromatography, Trypan Blue Exclusion Assay

    Blockade of MEK1 increases the levels of dephosphorylated BimEL in MCF-7 . (a through c) Western blot shows the expression level of the Bim isoforms (EL, extra long; L, long, and/or S, short) in cells treated with hormones plus and minus IGF-1 (a) , with two apparent size variants of BimEL, a high-molecular-weight BimEL (top band, denoted by the dash) and a low-molecular-weight BimEL (bottom band, denoted by the arrow) (b, c) . fold diff ., fold difference in signal intensity of the lower-molecular-weight BimEL band divided by the signal intensity of the high-molecular-weight BimEL band by using the total MAPK signal intensity per lane as the loading control. (d, e) Western blot shows the accumulation of the upper Bim EL band when cells with active MEK1 are treated with the proteasome inhibitor MG132, and preferential loss of the upper BimEL band, concomitant with accumulation of the lower-molecular-weight Bim EL form after λ protein phosphatase treatment of the protein lysates. The λ protein phosphatase digestion (described in Materials and Methods) was carried out for 20 minutes (lanes 2 and 5) or 1 hour (lane 3) on protein lysates isolated from breast cancer cells undergoing E2 treatment for 24 hours. Immunoblotting determined the levels of BimEL and pMAPK1/2; total MAPK served as loading control. (f) Western blot shows that TAM- and/or U0126- treated cells show significantly higher levels of BimEL protein than do E2-treated cells, with the highest levels of dephosphorylated Bim EL, correlating directly to the cleavage of PARP detectable by 72 hours.

    Journal: Breast Cancer Research : BCR

    Article Title: Insulin-like growth factor 1 attenuates antiestrogen- and antiprogestin-induced apoptosis in ER+ breast cancer cells by MEK1 regulation of the BH3-only pro-apoptotic protein Bim

    doi: 10.1186/bcr3153

    Figure Lengend Snippet: Blockade of MEK1 increases the levels of dephosphorylated BimEL in MCF-7 . (a through c) Western blot shows the expression level of the Bim isoforms (EL, extra long; L, long, and/or S, short) in cells treated with hormones plus and minus IGF-1 (a) , with two apparent size variants of BimEL, a high-molecular-weight BimEL (top band, denoted by the dash) and a low-molecular-weight BimEL (bottom band, denoted by the arrow) (b, c) . fold diff ., fold difference in signal intensity of the lower-molecular-weight BimEL band divided by the signal intensity of the high-molecular-weight BimEL band by using the total MAPK signal intensity per lane as the loading control. (d, e) Western blot shows the accumulation of the upper Bim EL band when cells with active MEK1 are treated with the proteasome inhibitor MG132, and preferential loss of the upper BimEL band, concomitant with accumulation of the lower-molecular-weight Bim EL form after λ protein phosphatase treatment of the protein lysates. The λ protein phosphatase digestion (described in Materials and Methods) was carried out for 20 minutes (lanes 2 and 5) or 1 hour (lane 3) on protein lysates isolated from breast cancer cells undergoing E2 treatment for 24 hours. Immunoblotting determined the levels of BimEL and pMAPK1/2; total MAPK served as loading control. (f) Western blot shows that TAM- and/or U0126- treated cells show significantly higher levels of BimEL protein than do E2-treated cells, with the highest levels of dephosphorylated Bim EL, correlating directly to the cleavage of PARP detectable by 72 hours.

    Article Snippet: Under our treatment conditions and at multiple time points analyzed, cells treated with IGF-1 and E2 showed higher levels of MAPK1/2 phosphorylation (designated pMAPK) than did E2-treated or IGF-1-treated cells (Figure ; compare lane 5 with lane 1, and data not shown).

    Techniques: Western Blot, Expressing, Molecular Weight, Isolation

    IGF-1 attenuates the cytotoxicity of hormonal treatments in ER + breast cancer cells . (a) Cell number for the adherent versus detached cell population treated with hormones in the presence or absence of various concentrations of IGF-1. (b) Relative levels of active, dephosphorylated Rb110 protein, designated Rb, relative to levels of the inactive, phosphorylated Rb110, designated pRb (top panel), cleaved PARP (middle panel), and cleaved lamin A (bottom panel) in cells undergoing hormonal treatments in the presence and absence of IGF-1. Protein was isolated from cells undergoing the designated treatments at 48, 72, and 120 hours, and immunoblot analysis determined the levels of Rb, pRb, cleaved PARP, and cleaved lamin A; β-actin served as a loading control. (c) Relative levels of cleaved cytokeratin 18 after 72 hours of the hormonal treatments in the presence and absence of IGF-1. (d) The percentage of mitochondrial membrane depolarization in cells undergoing hormonal treatments in the presence or absence of IGF-1. Adherent and detached cells were combined, stained with JC-1 mitochondrial membrane dye, and examined by using flow cytometry. (a, c, d) Data are expressed as mean ± SD ( n = 3). Comparisons were made between treatment groups, and a statistically significant difference was identified in cell number when compared with groups treated with a E2; b E2 + IGF-1; c E2 + 4-OHT + IGF-1; d E2 + MIF + IGF-1; e E2 + 4-OHT; and f E2 + MIF. *Significance at P

    Journal: Breast Cancer Research : BCR

    Article Title: Insulin-like growth factor 1 attenuates antiestrogen- and antiprogestin-induced apoptosis in ER+ breast cancer cells by MEK1 regulation of the BH3-only pro-apoptotic protein Bim

    doi: 10.1186/bcr3153

    Figure Lengend Snippet: IGF-1 attenuates the cytotoxicity of hormonal treatments in ER + breast cancer cells . (a) Cell number for the adherent versus detached cell population treated with hormones in the presence or absence of various concentrations of IGF-1. (b) Relative levels of active, dephosphorylated Rb110 protein, designated Rb, relative to levels of the inactive, phosphorylated Rb110, designated pRb (top panel), cleaved PARP (middle panel), and cleaved lamin A (bottom panel) in cells undergoing hormonal treatments in the presence and absence of IGF-1. Protein was isolated from cells undergoing the designated treatments at 48, 72, and 120 hours, and immunoblot analysis determined the levels of Rb, pRb, cleaved PARP, and cleaved lamin A; β-actin served as a loading control. (c) Relative levels of cleaved cytokeratin 18 after 72 hours of the hormonal treatments in the presence and absence of IGF-1. (d) The percentage of mitochondrial membrane depolarization in cells undergoing hormonal treatments in the presence or absence of IGF-1. Adherent and detached cells were combined, stained with JC-1 mitochondrial membrane dye, and examined by using flow cytometry. (a, c, d) Data are expressed as mean ± SD ( n = 3). Comparisons were made between treatment groups, and a statistically significant difference was identified in cell number when compared with groups treated with a E2; b E2 + IGF-1; c E2 + 4-OHT + IGF-1; d E2 + MIF + IGF-1; e E2 + 4-OHT; and f E2 + MIF. *Significance at P

    Article Snippet: Under our treatment conditions and at multiple time points analyzed, cells treated with IGF-1 and E2 showed higher levels of MAPK1/2 phosphorylation (designated pMAPK) than did E2-treated or IGF-1-treated cells (Figure ; compare lane 5 with lane 1, and data not shown).

    Techniques: Isolation, Staining, Flow Cytometry, Cytometry

    Provision of human IGF1 in an infected blood meal reduces Plasmodium falciparum development in A. stephensi . Mosquitoes were fed blood meals containing malaria parasites and diluent buffer (0.1% BSA/PBS) as a control treatment, or an identical blood meal

    Journal: The Journal of Experimental Biology

    Article Title: Human IGF1 extends lifespan and enhances resistance to Plasmodium falciparum infection in the malaria vector Anopheles stephensi

    doi: 10.1242/jeb.078873

    Figure Lengend Snippet: Provision of human IGF1 in an infected blood meal reduces Plasmodium falciparum development in A. stephensi . Mosquitoes were fed blood meals containing malaria parasites and diluent buffer (0.1% BSA/PBS) as a control treatment, or an identical blood meal

    Article Snippet: Thus, IGF1 in the parasite culture medium only minimally increased the total levels of IGF1 in the experiments (see below) and the absolute concentrations of IGF1 used still bracketed the low and high ends of the normal physiological range in humans.

    Techniques: Infection

    Provision of IGF1 in the blood meal can extend A. stephensi lifespan

    Journal: The Journal of Experimental Biology

    Article Title: Human IGF1 extends lifespan and enhances resistance to Plasmodium falciparum infection in the malaria vector Anopheles stephensi

    doi: 10.1242/jeb.078873

    Figure Lengend Snippet: Provision of IGF1 in the blood meal can extend A. stephensi lifespan

    Article Snippet: Thus, IGF1 in the parasite culture medium only minimally increased the total levels of IGF1 in the experiments (see below) and the absolute concentrations of IGF1 used still bracketed the low and high ends of the normal physiological range in humans.

    Techniques:

    Human insulin and IGF1 persist intact in the midgut during blood digestion and disperse into the body of A. stephensi . (A,C) Representative autoradiographs of abdomen (A, 4 day exposure; C, 0.75 day exposure) and head/thorax extract samples (A, 28 day

    Journal: The Journal of Experimental Biology

    Article Title: Human IGF1 extends lifespan and enhances resistance to Plasmodium falciparum infection in the malaria vector Anopheles stephensi

    doi: 10.1242/jeb.078873

    Figure Lengend Snippet: Human insulin and IGF1 persist intact in the midgut during blood digestion and disperse into the body of A. stephensi . (A,C) Representative autoradiographs of abdomen (A, 4 day exposure; C, 0.75 day exposure) and head/thorax extract samples (A, 28 day

    Article Snippet: Thus, IGF1 in the parasite culture medium only minimally increased the total levels of IGF1 in the experiments (see below) and the absolute concentrations of IGF1 used still bracketed the low and high ends of the normal physiological range in humans.

    Techniques:

    Survivorship curves from Experiment 3 showing the effects of IGF1 on A. stephensi lifespan. Low levels of human IGF1 (0.013 μmol l −1 IGF1) extend A. stephensi lifespan, while survivorship of mosquitoes treated with higher levels of IGF1

    Journal: The Journal of Experimental Biology

    Article Title: Human IGF1 extends lifespan and enhances resistance to Plasmodium falciparum infection in the malaria vector Anopheles stephensi

    doi: 10.1242/jeb.078873

    Figure Lengend Snippet: Survivorship curves from Experiment 3 showing the effects of IGF1 on A. stephensi lifespan. Low levels of human IGF1 (0.013 μmol l −1 IGF1) extend A. stephensi lifespan, while survivorship of mosquitoes treated with higher levels of IGF1

    Article Snippet: Thus, IGF1 in the parasite culture medium only minimally increased the total levels of IGF1 in the experiments (see below) and the absolute concentrations of IGF1 used still bracketed the low and high ends of the normal physiological range in humans.

    Techniques:

    Provision of IGF1 in the infected blood meal reduces P. falciparum development in A. stephensi

    Journal: The Journal of Experimental Biology

    Article Title: Human IGF1 extends lifespan and enhances resistance to Plasmodium falciparum infection in the malaria vector Anopheles stephensi

    doi: 10.1242/jeb.078873

    Figure Lengend Snippet: Provision of IGF1 in the infected blood meal reduces P. falciparum development in A. stephensi

    Article Snippet: Thus, IGF1 in the parasite culture medium only minimally increased the total levels of IGF1 in the experiments (see below) and the absolute concentrations of IGF1 used still bracketed the low and high ends of the normal physiological range in humans.

    Techniques: Infection

    Blood ingestion induces rapid phosphorylation of the insulin receptor in the A. stephensi midgut. Mosquitoes were fed washed red blood cells (RBCs) alone or supplemented with 1.7×10 −4 μmol l −1 insulin or IGF1 at 0.013 or

    Journal: The Journal of Experimental Biology

    Article Title: Human IGF1 extends lifespan and enhances resistance to Plasmodium falciparum infection in the malaria vector Anopheles stephensi

    doi: 10.1242/jeb.078873

    Figure Lengend Snippet: Blood ingestion induces rapid phosphorylation of the insulin receptor in the A. stephensi midgut. Mosquitoes were fed washed red blood cells (RBCs) alone or supplemented with 1.7×10 −4 μmol l −1 insulin or IGF1 at 0.013 or

    Article Snippet: Thus, IGF1 in the parasite culture medium only minimally increased the total levels of IGF1 in the experiments (see below) and the absolute concentrations of IGF1 used still bracketed the low and high ends of the normal physiological range in humans.

    Techniques:

    Provision of human IGF1 in the blood meal induces phosphorylation of FOXO and p70S6K and inhibits phosphorylation of ERK in the A. stephensi midgut. Mosquitoes were fed blood meals containing 0.013 or 0.133 mol l −1 IGF1 or an equivalent volume

    Journal: The Journal of Experimental Biology

    Article Title: Human IGF1 extends lifespan and enhances resistance to Plasmodium falciparum infection in the malaria vector Anopheles stephensi

    doi: 10.1242/jeb.078873

    Figure Lengend Snippet: Provision of human IGF1 in the blood meal induces phosphorylation of FOXO and p70S6K and inhibits phosphorylation of ERK in the A. stephensi midgut. Mosquitoes were fed blood meals containing 0.013 or 0.133 mol l −1 IGF1 or an equivalent volume

    Article Snippet: Thus, IGF1 in the parasite culture medium only minimally increased the total levels of IGF1 in the experiments (see below) and the absolute concentrations of IGF1 used still bracketed the low and high ends of the normal physiological range in humans.

    Techniques:

    A: Gel mobility assay illustrating p53 binding to its consensus sequence in the bax promoter. Nuclear extracts were obtained from nonstretched myocytes (NS) at 16 hours and stretched myocytes (S) at 6 and 16 hours (h) in the absence and presence of IGF-1. IGF-1 decreased p53 DNA binding activity at both time points. The arrow indicates the position of p53 shifted band. The p53-specific band, corresponding to nuclear extract obtained at 16 hours after stretch, was subject to competition with an excess of unlabeled self oligonucleotide (C) and with a monoclonal p53 antibody (Ab). The addition of an irrelevant antibody (Irr) or preincubation with an unlabeled mutated form of bax (Bax mut) did not interfere with p53 binding. Bax, bax probe in the absence of nuclear extracts. Optical density data were as follows: NS = 0.46 ± 0.22 ( n = 5), S-6 hours = 1.83 ± 0.37 ( n = 5), P

    Journal: The American Journal of Pathology

    Article Title: Insulin-Like Growth Factor-1 Induces Mdm2 and Down-Regulates p53, Attenuating the Myocyte Renin-Angiotensin System and Stretch-Mediated Apoptosis

    doi:

    Figure Lengend Snippet: A: Gel mobility assay illustrating p53 binding to its consensus sequence in the bax promoter. Nuclear extracts were obtained from nonstretched myocytes (NS) at 16 hours and stretched myocytes (S) at 6 and 16 hours (h) in the absence and presence of IGF-1. IGF-1 decreased p53 DNA binding activity at both time points. The arrow indicates the position of p53 shifted band. The p53-specific band, corresponding to nuclear extract obtained at 16 hours after stretch, was subject to competition with an excess of unlabeled self oligonucleotide (C) and with a monoclonal p53 antibody (Ab). The addition of an irrelevant antibody (Irr) or preincubation with an unlabeled mutated form of bax (Bax mut) did not interfere with p53 binding. Bax, bax probe in the absence of nuclear extracts. Optical density data were as follows: NS = 0.46 ± 0.22 ( n = 5), S-6 hours = 1.83 ± 0.37 ( n = 5), P

    Article Snippet: Similarly, myocyte necrosis was low in stretched myocytes without IGF-1 (6 hours = 0.70 ± 0.20%, n = 5; 20 hours = 0.81 ± 0.25%, n = 5) and after the addition of the growth factor (6 hours = 0.77 ± 0.29%, n = 5; 20 hours = 0.79 ± 0.21%, n = 5).

    Techniques: Binding Assay, Sequencing, Activity Assay

    Effects of different doses of IGF-1 on stretch-mediated apoptosis at 20 hours. Results are presented as means ± SD. * P

    Journal: The American Journal of Pathology

    Article Title: Insulin-Like Growth Factor-1 Induces Mdm2 and Down-Regulates p53, Attenuating the Myocyte Renin-Angiotensin System and Stretch-Mediated Apoptosis

    doi:

    Figure Lengend Snippet: Effects of different doses of IGF-1 on stretch-mediated apoptosis at 20 hours. Results are presented as means ± SD. * P

    Article Snippet: Similarly, myocyte necrosis was low in stretched myocytes without IGF-1 (6 hours = 0.70 ± 0.20%, n = 5; 20 hours = 0.81 ± 0.25%, n = 5) and after the addition of the growth factor (6 hours = 0.77 ± 0.29%, n = 5; 20 hours = 0.79 ± 0.21%, n = 5).

    Techniques:

    DNA gel electrophoresis of myocytes exposed to stretch for 20 hours in the presence of 200 ng/ml IGF-1 (S+IGF-1) or in the absence of the growth factor (S). DNA laddering is noted in stretched cells but is more apparent in the absence of IGF-1. MW, molecular weight markers; arrowhead s indicate multiples of 200 bp.

    Journal: The American Journal of Pathology

    Article Title: Insulin-Like Growth Factor-1 Induces Mdm2 and Down-Regulates p53, Attenuating the Myocyte Renin-Angiotensin System and Stretch-Mediated Apoptosis

    doi:

    Figure Lengend Snippet: DNA gel electrophoresis of myocytes exposed to stretch for 20 hours in the presence of 200 ng/ml IGF-1 (S+IGF-1) or in the absence of the growth factor (S). DNA laddering is noted in stretched cells but is more apparent in the absence of IGF-1. MW, molecular weight markers; arrowhead s indicate multiples of 200 bp.

    Article Snippet: Similarly, myocyte necrosis was low in stretched myocytes without IGF-1 (6 hours = 0.70 ± 0.20%, n = 5; 20 hours = 0.81 ± 0.25%, n = 5) and after the addition of the growth factor (6 hours = 0.77 ± 0.29%, n = 5; 20 hours = 0.79 ± 0.21%, n = 5).

    Techniques: DNA Gel Electrophoresis, DNA Laddering, Molecular Weight

    Effects of stretch and IGF-1 on the quantity of the various forms of Mdm2 and p53 measured by Western blot analysis of myocyte lysates immunoprecipitated with p53 antibody. Nonstretched: 90 kd; no IGF-1: OD = 1.0 ± 0.4, n = 5; IGF-1: OD = 2.8 ± 0.4, n = 5, P

    Journal: The American Journal of Pathology

    Article Title: Insulin-Like Growth Factor-1 Induces Mdm2 and Down-Regulates p53, Attenuating the Myocyte Renin-Angiotensin System and Stretch-Mediated Apoptosis

    doi:

    Figure Lengend Snippet: Effects of stretch and IGF-1 on the quantity of the various forms of Mdm2 and p53 measured by Western blot analysis of myocyte lysates immunoprecipitated with p53 antibody. Nonstretched: 90 kd; no IGF-1: OD = 1.0 ± 0.4, n = 5; IGF-1: OD = 2.8 ± 0.4, n = 5, P

    Article Snippet: Similarly, myocyte necrosis was low in stretched myocytes without IGF-1 (6 hours = 0.70 ± 0.20%, n = 5; 20 hours = 0.81 ± 0.25%, n = 5) and after the addition of the growth factor (6 hours = 0.77 ± 0.29%, n = 5; 20 hours = 0.79 ± 0.21%, n = 5).

    Techniques: Western Blot, Immunoprecipitation

    A: Effects of IGF-1 on the quantity of p53 protein measured by Western blot ( top ) in nonstretched myocytes at 20 hours (NS) and stretched myocytes (S) at 5, 10, and 20 hours (h). IGF-1 markedly attenuated the amount of p53 in stretched cells at all time points. SV-T2 was used as positive control. Loading of proteins is illustrated by Coomassie blue staining ( bottom ). B: Densitometric analysis of p53 protein in myocytes. Data are presented as means ± SD. * P

    Journal: The American Journal of Pathology

    Article Title: Insulin-Like Growth Factor-1 Induces Mdm2 and Down-Regulates p53, Attenuating the Myocyte Renin-Angiotensin System and Stretch-Mediated Apoptosis

    doi:

    Figure Lengend Snippet: A: Effects of IGF-1 on the quantity of p53 protein measured by Western blot ( top ) in nonstretched myocytes at 20 hours (NS) and stretched myocytes (S) at 5, 10, and 20 hours (h). IGF-1 markedly attenuated the amount of p53 in stretched cells at all time points. SV-T2 was used as positive control. Loading of proteins is illustrated by Coomassie blue staining ( bottom ). B: Densitometric analysis of p53 protein in myocytes. Data are presented as means ± SD. * P

    Article Snippet: Similarly, myocyte necrosis was low in stretched myocytes without IGF-1 (6 hours = 0.70 ± 0.20%, n = 5; 20 hours = 0.81 ± 0.25%, n = 5) and after the addition of the growth factor (6 hours = 0.77 ± 0.29%, n = 5; 20 hours = 0.79 ± 0.21%, n = 5).

    Techniques: Western Blot, Positive Control, Staining

    Effects of 200 ng/ml IGF-1 on stretch-mediated apoptosis at 6 and 20 hours after the imposition of the mechanical stimulus. * P

    Journal: The American Journal of Pathology

    Article Title: Insulin-Like Growth Factor-1 Induces Mdm2 and Down-Regulates p53, Attenuating the Myocyte Renin-Angiotensin System and Stretch-Mediated Apoptosis

    doi:

    Figure Lengend Snippet: Effects of 200 ng/ml IGF-1 on stretch-mediated apoptosis at 6 and 20 hours after the imposition of the mechanical stimulus. * P

    Article Snippet: Similarly, myocyte necrosis was low in stretched myocytes without IGF-1 (6 hours = 0.70 ± 0.20%, n = 5; 20 hours = 0.81 ± 0.25%, n = 5) and after the addition of the growth factor (6 hours = 0.77 ± 0.29%, n = 5; 20 hours = 0.79 ± 0.21%, n = 5).

    Techniques:

    A: Effects of IGF-1 on the quantity of Aogen protein measured by Western blot ( top ) in nonstretched myocytes at 20 hours (NS) and stretched myocytes (S) at 5, 10, and 20 hours (h). IGF-1 markedly attenuated the amount of Aogen in stretched cells at all time points. Serum was used as positive control. Loading of proteins is illustrated by Coomassie blue staining ( bottom ). B: Densitometric analysis of Aogen protein in myocytes. Data are presented as means ± SD. * P

    Journal: The American Journal of Pathology

    Article Title: Insulin-Like Growth Factor-1 Induces Mdm2 and Down-Regulates p53, Attenuating the Myocyte Renin-Angiotensin System and Stretch-Mediated Apoptosis

    doi:

    Figure Lengend Snippet: A: Effects of IGF-1 on the quantity of Aogen protein measured by Western blot ( top ) in nonstretched myocytes at 20 hours (NS) and stretched myocytes (S) at 5, 10, and 20 hours (h). IGF-1 markedly attenuated the amount of Aogen in stretched cells at all time points. Serum was used as positive control. Loading of proteins is illustrated by Coomassie blue staining ( bottom ). B: Densitometric analysis of Aogen protein in myocytes. Data are presented as means ± SD. * P

    Article Snippet: Similarly, myocyte necrosis was low in stretched myocytes without IGF-1 (6 hours = 0.70 ± 0.20%, n = 5; 20 hours = 0.81 ± 0.25%, n = 5) and after the addition of the growth factor (6 hours = 0.77 ± 0.29%, n = 5; 20 hours = 0.79 ± 0.21%, n = 5).

    Techniques: Western Blot, Positive Control, Staining

    Effects of IGF-1 on the quantity of Ang II in the medium of stretched myocytes. Data are presented as means ± SD. * P

    Journal: The American Journal of Pathology

    Article Title: Insulin-Like Growth Factor-1 Induces Mdm2 and Down-Regulates p53, Attenuating the Myocyte Renin-Angiotensin System and Stretch-Mediated Apoptosis

    doi:

    Figure Lengend Snippet: Effects of IGF-1 on the quantity of Ang II in the medium of stretched myocytes. Data are presented as means ± SD. * P

    Article Snippet: Similarly, myocyte necrosis was low in stretched myocytes without IGF-1 (6 hours = 0.70 ± 0.20%, n = 5; 20 hours = 0.81 ± 0.25%, n = 5) and after the addition of the growth factor (6 hours = 0.77 ± 0.29%, n = 5; 20 hours = 0.79 ± 0.21%, n = 5).

    Techniques:

    A: Effects of IGF-1 on the quantity of Bax protein measured by Western blot ( top ) in nonstretched (NS) and stretched (S) myocytes at 1, 5, 10, and 20 hours (h). IGF-1 markedly attenuated the amount of Bax in stretched cells at all time points. Loading of proteins is illustrated by Coomassie blue staining ( bottom ). B: Densitometric analysis of Bax protein in myocytes. Data are presented as means ± SD. * P

    Journal: The American Journal of Pathology

    Article Title: Insulin-Like Growth Factor-1 Induces Mdm2 and Down-Regulates p53, Attenuating the Myocyte Renin-Angiotensin System and Stretch-Mediated Apoptosis

    doi:

    Figure Lengend Snippet: A: Effects of IGF-1 on the quantity of Bax protein measured by Western blot ( top ) in nonstretched (NS) and stretched (S) myocytes at 1, 5, 10, and 20 hours (h). IGF-1 markedly attenuated the amount of Bax in stretched cells at all time points. Loading of proteins is illustrated by Coomassie blue staining ( bottom ). B: Densitometric analysis of Bax protein in myocytes. Data are presented as means ± SD. * P

    Article Snippet: Similarly, myocyte necrosis was low in stretched myocytes without IGF-1 (6 hours = 0.70 ± 0.20%, n = 5; 20 hours = 0.81 ± 0.25%, n = 5) and after the addition of the growth factor (6 hours = 0.77 ± 0.29%, n = 5; 20 hours = 0.79 ± 0.21%, n = 5).

    Techniques: Western Blot, Staining

    Effects of stretch and IGF-1 on the quantity of the various forms of Mdm2 and p53 measured by Western blot analysis of myocyte lysates immunoprecipitated with Mdm2 antibody. Nonstretched: 90 kd; no IGF-1: not detectable, n = 5; IGF-1: not detectable, n = 5; 85 kd; no IGF-1: not detectable, n = 5; IGF-1: not detectable, n = 5; 76 kd; no IGF-1: OD = 0.04 ± 0.05, n = 5; IGF-1: OD = 2.9 ± 0.9, n = 5, P

    Journal: The American Journal of Pathology

    Article Title: Insulin-Like Growth Factor-1 Induces Mdm2 and Down-Regulates p53, Attenuating the Myocyte Renin-Angiotensin System and Stretch-Mediated Apoptosis

    doi:

    Figure Lengend Snippet: Effects of stretch and IGF-1 on the quantity of the various forms of Mdm2 and p53 measured by Western blot analysis of myocyte lysates immunoprecipitated with Mdm2 antibody. Nonstretched: 90 kd; no IGF-1: not detectable, n = 5; IGF-1: not detectable, n = 5; 85 kd; no IGF-1: not detectable, n = 5; IGF-1: not detectable, n = 5; 76 kd; no IGF-1: OD = 0.04 ± 0.05, n = 5; IGF-1: OD = 2.9 ± 0.9, n = 5, P

    Article Snippet: Similarly, myocyte necrosis was low in stretched myocytes without IGF-1 (6 hours = 0.70 ± 0.20%, n = 5; 20 hours = 0.81 ± 0.25%, n = 5) and after the addition of the growth factor (6 hours = 0.77 ± 0.29%, n = 5; 20 hours = 0.79 ± 0.21%, n = 5).

    Techniques: Western Blot, Immunoprecipitation

    Kaplan–Meier curves of event-free survival (left column) and overall survival (right column) for IGF-1, IGF-BP3, and molar IGF-1 (nm/L):IGF-BP3 (nm/L) ratio levels under or above the cutoff point. Note: P -values are given for the univariate analyses of the Cox regression analyses. Abbreviations: IGF-1, insulin-like growth factor 1; IGF-BP3, insulin-like growth factor-binding protein 3; EFS, event-free survival; OS, overall survival.

    Journal: OncoTargets and therapy

    Article Title: Serum levels of IGF-1 and IGF-BP3 are associated with event-free survival in adult Ewing sarcoma patients treated with chemotherapy

    doi: 10.2147/OTT.S123726

    Figure Lengend Snippet: Kaplan–Meier curves of event-free survival (left column) and overall survival (right column) for IGF-1, IGF-BP3, and molar IGF-1 (nm/L):IGF-BP3 (nm/L) ratio levels under or above the cutoff point. Note: P -values are given for the univariate analyses of the Cox regression analyses. Abbreviations: IGF-1, insulin-like growth factor 1; IGF-BP3, insulin-like growth factor-binding protein 3; EFS, event-free survival; OS, overall survival.

    Article Snippet: Mean values of IGF-1, IGF-2, and IGF-BP3 at baseline and presixth cycle are shown in .

    Techniques: Binding Assay

    Serum levels of IGF-1, IGF-BP3, and IGF-2 at baseline and after five cycles of VIDE chemotherapy (N=13). Abbreviations: IGF-1, insulin-like growth factor 1; IGF-BP3, insulin-like growth factor binding protein 3; IGF-2, insulin-like growth factor 2; VIDE, vincristine/ifosfamide/doxorubicin/etoposide; CI, confidence interval.

    Journal: OncoTargets and therapy

    Article Title: Serum levels of IGF-1 and IGF-BP3 are associated with event-free survival in adult Ewing sarcoma patients treated with chemotherapy

    doi: 10.2147/OTT.S123726

    Figure Lengend Snippet: Serum levels of IGF-1, IGF-BP3, and IGF-2 at baseline and after five cycles of VIDE chemotherapy (N=13). Abbreviations: IGF-1, insulin-like growth factor 1; IGF-BP3, insulin-like growth factor binding protein 3; IGF-2, insulin-like growth factor 2; VIDE, vincristine/ifosfamide/doxorubicin/etoposide; CI, confidence interval.

    Article Snippet: Mean values of IGF-1, IGF-2, and IGF-BP3 at baseline and presixth cycle are shown in .

    Techniques: Binding Assay

    Schematic overview of the effect of EWSR1-FLI1oncoprotein on IGF-1 pathway in Ewing sarcoma cells. Note: EWSR1-FLI1 binds the promoter region of IGF-BP3, which inhibits transcription. Abbreviations: EWSR1-FLI1, Ewing sarcoma breakpoint region 1-Friend leukemia virus integration 1; IGF-1, insulin-like growth factor 1; IGF-BP3, insulin-like growth factor-binding protein 3; IGF-2, insulin-like growth factor 2; IGF-1R, insulin-like growth factor 1 receptor; IR-A, insulin receptor isoform A; PI3K, phosphatidylinositol- 3-kinase; AKT, protein kinase B; MAPK, mitogen-activated protein kinase.

    Journal: OncoTargets and therapy

    Article Title: Serum levels of IGF-1 and IGF-BP3 are associated with event-free survival in adult Ewing sarcoma patients treated with chemotherapy

    doi: 10.2147/OTT.S123726

    Figure Lengend Snippet: Schematic overview of the effect of EWSR1-FLI1oncoprotein on IGF-1 pathway in Ewing sarcoma cells. Note: EWSR1-FLI1 binds the promoter region of IGF-BP3, which inhibits transcription. Abbreviations: EWSR1-FLI1, Ewing sarcoma breakpoint region 1-Friend leukemia virus integration 1; IGF-1, insulin-like growth factor 1; IGF-BP3, insulin-like growth factor-binding protein 3; IGF-2, insulin-like growth factor 2; IGF-1R, insulin-like growth factor 1 receptor; IR-A, insulin receptor isoform A; PI3K, phosphatidylinositol- 3-kinase; AKT, protein kinase B; MAPK, mitogen-activated protein kinase.

    Article Snippet: Mean values of IGF-1, IGF-2, and IGF-BP3 at baseline and presixth cycle are shown in .

    Techniques: Binding Assay

    Akt is necessary and sufficient for IGF-1–mediated myocyte survival. A, Representative image of TUNEL (TNL)-positive cardiac myocytes in culture. Cardiac myocytes were cultured in absence of serum for 48 hours. Cells were stained with Hoechst, TUNEL, and anti– α -sarcomeric actin antibody. B, Effects of Akt-expressing adenovirus vectors on cardiac myocyte survival. Cultured cells were infected with mock (no virus) or adenovirus vectors expressing β -galactosidase, wild-type, dominant-negative, or constitutively active Akt ( β -gal, wtAkt, dnAkt, and myrAkt, respectively). After infection, cells were cultured in presence of indicated concentrations of IGF-1 for 48 hours. Myocyte viability was assessed by staining with Hoechst and TUNEL. Cultured cells were identified as cardiomyocytes by staining with anti– α -sarcomeric actin antibody. Data are shown as mean±SEM (n=4).

    Journal: Circulation

    Article Title: Akt Promotes Survival of Cardiomyocytes In Vitro and Protects Against Ischemia-Reperfusion Injury in Mouse Heart

    doi:

    Figure Lengend Snippet: Akt is necessary and sufficient for IGF-1–mediated myocyte survival. A, Representative image of TUNEL (TNL)-positive cardiac myocytes in culture. Cardiac myocytes were cultured in absence of serum for 48 hours. Cells were stained with Hoechst, TUNEL, and anti– α -sarcomeric actin antibody. B, Effects of Akt-expressing adenovirus vectors on cardiac myocyte survival. Cultured cells were infected with mock (no virus) or adenovirus vectors expressing β -galactosidase, wild-type, dominant-negative, or constitutively active Akt ( β -gal, wtAkt, dnAkt, and myrAkt, respectively). After infection, cells were cultured in presence of indicated concentrations of IGF-1 for 48 hours. Myocyte viability was assessed by staining with Hoechst and TUNEL. Cultured cells were identified as cardiomyocytes by staining with anti– α -sarcomeric actin antibody. Data are shown as mean±SEM (n=4).

    Article Snippet: IGF-1 was purchased from Gibco BRL.

    Techniques: TUNEL Assay, Cell Culture, Staining, Expressing, Infection, Dominant Negative Mutation

    IGF-1 activates Akt in a wortmannin-sensitive manner. A, IGF-1 activates Akt kinase activity. After serum starvation, cardiomyocytes were stimulated with IGF-1 (50 ng/mL) for 15 minutes. Cell lysates were prepared and immunoprecipitated with an antibody specific for Akt in absence or presence of competitor peptides (Comp). Immunoprecipitated kinase activity was measured with histone H2B as a substrate. B, Activation of Akt by IGF-1 is blocked by wortmannin. Cells were pretreated with wortmannin (Wort, 200 nmol/L) and stimulated with IGF-1 (50 ng/mL) for 15 minutes. Akt kinase activity was measured as described in A.

    Journal: Circulation

    Article Title: Akt Promotes Survival of Cardiomyocytes In Vitro and Protects Against Ischemia-Reperfusion Injury in Mouse Heart

    doi:

    Figure Lengend Snippet: IGF-1 activates Akt in a wortmannin-sensitive manner. A, IGF-1 activates Akt kinase activity. After serum starvation, cardiomyocytes were stimulated with IGF-1 (50 ng/mL) for 15 minutes. Cell lysates were prepared and immunoprecipitated with an antibody specific for Akt in absence or presence of competitor peptides (Comp). Immunoprecipitated kinase activity was measured with histone H2B as a substrate. B, Activation of Akt by IGF-1 is blocked by wortmannin. Cells were pretreated with wortmannin (Wort, 200 nmol/L) and stimulated with IGF-1 (50 ng/mL) for 15 minutes. Akt kinase activity was measured as described in A.

    Article Snippet: IGF-1 was purchased from Gibco BRL.

    Techniques: Activity Assay, Immunoprecipitation, Activation Assay

    Adenovirus constructs expressing Akt molecules. A, Structures of replication-defective adenovirus vectors expressing wild-type (wtAkt), dominant-negative (dnAkt), or constitutively active (myrAkt) Akt fused to HA. B, Adenoviral constructs express comparable levels of transgene proteins. Cardiomyocytes were transfected with adenovirus vector at MOI 25. Cell lysates were prepared and protein concentrations determined. Proteins (10 μ g) were immunoblotted with anti-HA antibody. Adenoviral vector encoding β -galactosidase ( β -gal) was used as a negative control. C, Kinase activities of adenovirally encoded Akt proteins. Cardiac myocytes were infected with adenovirus vectors and stimulated with IGF-1 (50 ng/mL) for 15 minutes. Cell lysates were immunoprecipitated with anti-HA antibody and assayed for kinase activities.

    Journal: Circulation

    Article Title: Akt Promotes Survival of Cardiomyocytes In Vitro and Protects Against Ischemia-Reperfusion Injury in Mouse Heart

    doi:

    Figure Lengend Snippet: Adenovirus constructs expressing Akt molecules. A, Structures of replication-defective adenovirus vectors expressing wild-type (wtAkt), dominant-negative (dnAkt), or constitutively active (myrAkt) Akt fused to HA. B, Adenoviral constructs express comparable levels of transgene proteins. Cardiomyocytes were transfected with adenovirus vector at MOI 25. Cell lysates were prepared and protein concentrations determined. Proteins (10 μ g) were immunoblotted with anti-HA antibody. Adenoviral vector encoding β -galactosidase ( β -gal) was used as a negative control. C, Kinase activities of adenovirally encoded Akt proteins. Cardiac myocytes were infected with adenovirus vectors and stimulated with IGF-1 (50 ng/mL) for 15 minutes. Cell lysates were immunoprecipitated with anti-HA antibody and assayed for kinase activities.

    Article Snippet: IGF-1 was purchased from Gibco BRL.

    Techniques: Construct, Expressing, Dominant Negative Mutation, Transfection, Plasmid Preparation, Negative Control, Infection, Immunoprecipitation

    Akt is necessary and sufficient for IGF-1–mediated myocyte survival. A, Dominant-negative Akt abrogates IGF-1–mediated cell survival. Cells were mock-infected (△) or infected with adenovirus vector expressing dnAkt (●) or β -gal (▲). Cells were cultured in indicated concentrations of IGF-1 for 72 hours, and cell viability was analyzed by trypan blue exclusion assay. Assays were performed in quadruplicate, and data are demonstrated as mean±SEM (* P

    Journal: Circulation

    Article Title: Akt Promotes Survival of Cardiomyocytes In Vitro and Protects Against Ischemia-Reperfusion Injury in Mouse Heart

    doi:

    Figure Lengend Snippet: Akt is necessary and sufficient for IGF-1–mediated myocyte survival. A, Dominant-negative Akt abrogates IGF-1–mediated cell survival. Cells were mock-infected (△) or infected with adenovirus vector expressing dnAkt (●) or β -gal (▲). Cells were cultured in indicated concentrations of IGF-1 for 72 hours, and cell viability was analyzed by trypan blue exclusion assay. Assays were performed in quadruplicate, and data are demonstrated as mean±SEM (* P

    Article Snippet: IGF-1 was purchased from Gibco BRL.

    Techniques: Dominant Negative Mutation, Infection, Plasmid Preparation, Expressing, Cell Culture, Trypan Blue Exclusion Assay

    IGF-1 mediates cardiomyocyte survival in a wortmannin-sensitive manner. A, Time course of cell survival effects of IGF-1 on cardiac myocytes. Cardiac myocytes were incubated with (●) or without (○) 50 ng/mL of IGF-1 under serum-deprivation conditions for the indicated times, and surviving cells were counted by the trypan blue exclusion assay. B, IGF-1 has no effects on the viability of nonmyocyte cells under serum-depleted conditions. Serum-deprived non–cardiac myocyte culture was incubated in the presence (+) or absence (−) of IGF-1 (50 ng/mL) for 72 hours, and viable cells were counted by trypan blue exclusion assay. C, IGF-1 promotes myocyte survival in a dose-dependent manner. Cardiac myocytes were cultured with the indicated concentrations of IGF-1 in the serum-deprivation medium for 72 hours, and cell viability was determined by trypan blue exclusion assay. D, IGF-1–mediated myocyte survival is inhibited by wortmannin. Cardiac myocytes were cultured in presence of indicated concentrations of wortmannin (Wort) with or without IGF-1 (50 ng/mL) for 72 hours, and surviving cell number was analyzed by trypan blue methods. All assays were performed in quadruplicate, and data are shown as mean±SEM.

    Journal: Circulation

    Article Title: Akt Promotes Survival of Cardiomyocytes In Vitro and Protects Against Ischemia-Reperfusion Injury in Mouse Heart

    doi:

    Figure Lengend Snippet: IGF-1 mediates cardiomyocyte survival in a wortmannin-sensitive manner. A, Time course of cell survival effects of IGF-1 on cardiac myocytes. Cardiac myocytes were incubated with (●) or without (○) 50 ng/mL of IGF-1 under serum-deprivation conditions for the indicated times, and surviving cells were counted by the trypan blue exclusion assay. B, IGF-1 has no effects on the viability of nonmyocyte cells under serum-depleted conditions. Serum-deprived non–cardiac myocyte culture was incubated in the presence (+) or absence (−) of IGF-1 (50 ng/mL) for 72 hours, and viable cells were counted by trypan blue exclusion assay. C, IGF-1 promotes myocyte survival in a dose-dependent manner. Cardiac myocytes were cultured with the indicated concentrations of IGF-1 in the serum-deprivation medium for 72 hours, and cell viability was determined by trypan blue exclusion assay. D, IGF-1–mediated myocyte survival is inhibited by wortmannin. Cardiac myocytes were cultured in presence of indicated concentrations of wortmannin (Wort) with or without IGF-1 (50 ng/mL) for 72 hours, and surviving cell number was analyzed by trypan blue methods. All assays were performed in quadruplicate, and data are shown as mean±SEM.

    Article Snippet: IGF-1 was purchased from Gibco BRL.

    Techniques: Incubation, Trypan Blue Exclusion Assay, Cell Culture

    Hepatic Igf-1 transgene does not resolve hepatic lipid metabolism in Li-GHRKO mice. A and B : Liver gene expression of key players in lipid metabolism was determined by real-time PCR ( n = 8/genotype). C : SCD-1 index determined by the ratio of hepatic stearic and oleic acid concentrations determined by GC/MS. D : Hepatic gene expression of key players in glycolysis (GLUT2, glucokinase [GCK], and liver pyruvate kinase [PKLr]) and gluconeogenesis (PC, PCK1, and glucose 6 phosphatase [G6PC]). Liver RNA extracted from 16- to 24-week-old male mice and processed for real-time PCR assay. E : Hepatic glycogen content assayed in livers of 16-week-old male mice. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Journal: Diabetes

    Article Title: Growth Hormone Control of Hepatic Lipid Metabolism

    doi: 10.2337/db16-0649

    Figure Lengend Snippet: Hepatic Igf-1 transgene does not resolve hepatic lipid metabolism in Li-GHRKO mice. A and B : Liver gene expression of key players in lipid metabolism was determined by real-time PCR ( n = 8/genotype). C : SCD-1 index determined by the ratio of hepatic stearic and oleic acid concentrations determined by GC/MS. D : Hepatic gene expression of key players in glycolysis (GLUT2, glucokinase [GCK], and liver pyruvate kinase [PKLr]) and gluconeogenesis (PC, PCK1, and glucose 6 phosphatase [G6PC]). Liver RNA extracted from 16- to 24-week-old male mice and processed for real-time PCR assay. E : Hepatic glycogen content assayed in livers of 16-week-old male mice. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Article Snippet: IGF-1 Is Insufficient to Restore Lipid Metabolism in the Livers of GH-Resistant Mice Relative liver weight in the Li-GHRKO mice increased at all ages and was reduced in the Li-GHRKO-HIT mice ( ).

    Techniques: Mouse Assay, Expressing, Real-time Polymerase Chain Reaction, Gas Chromatography-Mass Spectrometry

    IGF-1–independent effects of GHR in liver involve mainly DNL. A : In control animals, GH, secreted from the pituitary, promotes liver production and secretion of IGF-1 that is delivered to tissues via circulation. IGF-1 feeds back negatively on GH secretion. B : Ablation of GHR in liver (Li-GHRKO) results in significant reductions in liver IGF-1 production and elevations in GH secretion. Increased GH levels contribute to overall increased insulin resistance (reflected by high levels of serum insulin and elevated blood glucose) and increased body adiposity (evident by increased circulating leptin levels). Li-GHRKO mice show severe hepatic steatosis, resulting from increased DNL and increased lipid uptake. The impaired lipid metabolism in the Li-GHRKO mice associates with protein and lipid oxidation in liver, as well as inflammation in the liver. C : Restoration of hepatic IGF-1 in the Li-GHRKO-HIT mice normalizes serum IGF-1 and GH secretion. This associates with reduction in body adiposity and serum leptin and normalization of serum lipids, blood glucose, and serum insulin levels. Hepatic steatosis in Li-GHRKO-HIT mice reduced as compared with Li-GHRKO mice but was not resolved. Expression levels of genes involved in DNL and lipid uptake were increased to levels comparable to those in Li-GHRKO mice. Liver inflammation was high and did not resolve with hepatic IGF-1. D : Lastly, the HIT mice express the IGF-1 transgene in liver and exhibit twofold increase in serum IGF-1. HIT mice show normal levels of serum GH and insulin during young adulthood.

    Journal: Diabetes

    Article Title: Growth Hormone Control of Hepatic Lipid Metabolism

    doi: 10.2337/db16-0649

    Figure Lengend Snippet: IGF-1–independent effects of GHR in liver involve mainly DNL. A : In control animals, GH, secreted from the pituitary, promotes liver production and secretion of IGF-1 that is delivered to tissues via circulation. IGF-1 feeds back negatively on GH secretion. B : Ablation of GHR in liver (Li-GHRKO) results in significant reductions in liver IGF-1 production and elevations in GH secretion. Increased GH levels contribute to overall increased insulin resistance (reflected by high levels of serum insulin and elevated blood glucose) and increased body adiposity (evident by increased circulating leptin levels). Li-GHRKO mice show severe hepatic steatosis, resulting from increased DNL and increased lipid uptake. The impaired lipid metabolism in the Li-GHRKO mice associates with protein and lipid oxidation in liver, as well as inflammation in the liver. C : Restoration of hepatic IGF-1 in the Li-GHRKO-HIT mice normalizes serum IGF-1 and GH secretion. This associates with reduction in body adiposity and serum leptin and normalization of serum lipids, blood glucose, and serum insulin levels. Hepatic steatosis in Li-GHRKO-HIT mice reduced as compared with Li-GHRKO mice but was not resolved. Expression levels of genes involved in DNL and lipid uptake were increased to levels comparable to those in Li-GHRKO mice. Liver inflammation was high and did not resolve with hepatic IGF-1. D : Lastly, the HIT mice express the IGF-1 transgene in liver and exhibit twofold increase in serum IGF-1. HIT mice show normal levels of serum GH and insulin during young adulthood.

    Article Snippet: IGF-1 Is Insufficient to Restore Lipid Metabolism in the Livers of GH-Resistant Mice Relative liver weight in the Li-GHRKO mice increased at all ages and was reduced in the Li-GHRKO-HIT mice ( ).

    Techniques: Mouse Assay, Expressing

    Hepatic IGF-1 modulates oxidative stress in liver and serum but is insufficient to resolve liver inflammation in the Li-GHRKO mice. A : Liver sections from 16-week-old mice immunostained with anti-F4/80 antibody; arrows indicate F4/80-positive cells. B : F4/80 protein levels assessed by Western immunoblotting in 16-week-old mice. C : Liver gene expression of inflammatory markers ( n = 6/genotype). D : Serum levels of IL-6 and TNF-α at 16–24 weeks of age. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Journal: Diabetes

    Article Title: Growth Hormone Control of Hepatic Lipid Metabolism

    doi: 10.2337/db16-0649

    Figure Lengend Snippet: Hepatic IGF-1 modulates oxidative stress in liver and serum but is insufficient to resolve liver inflammation in the Li-GHRKO mice. A : Liver sections from 16-week-old mice immunostained with anti-F4/80 antibody; arrows indicate F4/80-positive cells. B : F4/80 protein levels assessed by Western immunoblotting in 16-week-old mice. C : Liver gene expression of inflammatory markers ( n = 6/genotype). D : Serum levels of IL-6 and TNF-α at 16–24 weeks of age. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Article Snippet: IGF-1 Is Insufficient to Restore Lipid Metabolism in the Livers of GH-Resistant Mice Relative liver weight in the Li-GHRKO mice increased at all ages and was reduced in the Li-GHRKO-HIT mice ( ).

    Techniques: Mouse Assay, Western Blot, Expressing

    Hepatic-derived IGF-1 improves systemic glucose homeostasis in the Li-GHRKO mice. Blood glucose levels ( A ) and serum insulin levels ( B ) were determined in male mice at 16 weeks of age. Intraperitoneal glucose tolerance test ( C ) and intraperitoneal insulin tolerance test ( D ) performed in 16- to 20-week-old male mice in the fed state. E : Serum IGFBP-1 levels determined in male mice at 16–24 weeks of age. F : iPTT performed in 16- to 20-week-old male mice. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Journal: Diabetes

    Article Title: Growth Hormone Control of Hepatic Lipid Metabolism

    doi: 10.2337/db16-0649

    Figure Lengend Snippet: Hepatic-derived IGF-1 improves systemic glucose homeostasis in the Li-GHRKO mice. Blood glucose levels ( A ) and serum insulin levels ( B ) were determined in male mice at 16 weeks of age. Intraperitoneal glucose tolerance test ( C ) and intraperitoneal insulin tolerance test ( D ) performed in 16- to 20-week-old male mice in the fed state. E : Serum IGFBP-1 levels determined in male mice at 16–24 weeks of age. F : iPTT performed in 16- to 20-week-old male mice. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Article Snippet: IGF-1 Is Insufficient to Restore Lipid Metabolism in the Livers of GH-Resistant Mice Relative liver weight in the Li-GHRKO mice increased at all ages and was reduced in the Li-GHRKO-HIT mice ( ).

    Techniques: Derivative Assay, Mouse Assay

    Hepatic-derived IGF-1 improves systemic lipid homeostasis and body composition in the Li-GHRKO mice. A : Serum TG and cholesterol in males at 16 weeks of age. B : Serum FFAs in the fed state in males at 16 weeks of age. C : Relative gonadal fat pad wet-weight to body weight at the indicated ages. D : Serum leptin levels in males at 16 weeks of age. E : Serum IGFBP-2 levels in males at 16–24 weeks of age. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Journal: Diabetes

    Article Title: Growth Hormone Control of Hepatic Lipid Metabolism

    doi: 10.2337/db16-0649

    Figure Lengend Snippet: Hepatic-derived IGF-1 improves systemic lipid homeostasis and body composition in the Li-GHRKO mice. A : Serum TG and cholesterol in males at 16 weeks of age. B : Serum FFAs in the fed state in males at 16 weeks of age. C : Relative gonadal fat pad wet-weight to body weight at the indicated ages. D : Serum leptin levels in males at 16 weeks of age. E : Serum IGFBP-2 levels in males at 16–24 weeks of age. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Article Snippet: IGF-1 Is Insufficient to Restore Lipid Metabolism in the Livers of GH-Resistant Mice Relative liver weight in the Li-GHRKO mice increased at all ages and was reduced in the Li-GHRKO-HIT mice ( ).

    Techniques: Derivative Assay, Mouse Assay

    Hepatic Igf-1 transgene does not resolve hepatic steatosis in the Li-GHRKO mice. A : Relative liver wet-weight to body weight was followed in several age groups as indicated. B : Hematoxylin/eosin staining of liver sections from 16-week-old control, Li-GHRKO, HIT, and Li-GHRKO-HIT mice. Scale bars = 100 μm. C : Hepatic TG content. D : Hepatic FA content in 16-week-old male mice measured by GC/MS. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Journal: Diabetes

    Article Title: Growth Hormone Control of Hepatic Lipid Metabolism

    doi: 10.2337/db16-0649

    Figure Lengend Snippet: Hepatic Igf-1 transgene does not resolve hepatic steatosis in the Li-GHRKO mice. A : Relative liver wet-weight to body weight was followed in several age groups as indicated. B : Hematoxylin/eosin staining of liver sections from 16-week-old control, Li-GHRKO, HIT, and Li-GHRKO-HIT mice. Scale bars = 100 μm. C : Hepatic TG content. D : Hepatic FA content in 16-week-old male mice measured by GC/MS. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Article Snippet: IGF-1 Is Insufficient to Restore Lipid Metabolism in the Livers of GH-Resistant Mice Relative liver weight in the Li-GHRKO mice increased at all ages and was reduced in the Li-GHRKO-HIT mice ( ).

    Techniques: Mouse Assay, Staining, Gas Chromatography-Mass Spectrometry

    Hepatic IGF-1 modulates oxidative stress in liver and serum. A : Liver gene expression of enzymes involved in oxidative stress response in males at 16 weeks measured by real-time PCR. B : Protein carbonylation was determined using a spectrophotometric assay of liver protein extracts from male mice at 24 weeks of age. Lipid peroxidation measured using thiobarbituric acid–reactive substances assay in liver ( C ) and serum ( D ) from male mice at 24 weeks of age. E : Serum levels of AST, ALT, and alkaline phosphatase (Alk Phos) in males at 16 weeks of age. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Journal: Diabetes

    Article Title: Growth Hormone Control of Hepatic Lipid Metabolism

    doi: 10.2337/db16-0649

    Figure Lengend Snippet: Hepatic IGF-1 modulates oxidative stress in liver and serum. A : Liver gene expression of enzymes involved in oxidative stress response in males at 16 weeks measured by real-time PCR. B : Protein carbonylation was determined using a spectrophotometric assay of liver protein extracts from male mice at 24 weeks of age. Lipid peroxidation measured using thiobarbituric acid–reactive substances assay in liver ( C ) and serum ( D ) from male mice at 24 weeks of age. E : Serum levels of AST, ALT, and alkaline phosphatase (Alk Phos) in males at 16 weeks of age. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Article Snippet: IGF-1 Is Insufficient to Restore Lipid Metabolism in the Livers of GH-Resistant Mice Relative liver weight in the Li-GHRKO mice increased at all ages and was reduced in the Li-GHRKO-HIT mice ( ).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Spectrophotometric Assay, Mouse Assay, AST Assay

    Restoration of hepatic IGF-1 gene expression in Li-GHRKO mice. A : HIT were crossed with Li-GHRKO mice to yield the following groups: control mice harbored the floxed ghr gene, HIT mice harbored the rat IGF-1 transgene and floxed ghr gene, Li-GHRKO harbored the floxed ghr gene and albumin (Alb) promoter–derived Cre transgene, and the Li-GHRKO-HIT mice harbored the floxed ghr gene, albumin promoter–derived Cre transgene, and HIT. B : Serum IGF-1 levels in male mice at 16 weeks of age. C : Serum GH levels in male mice at 8–16 weeks of age. D : Serum ALS levels of 16-week-old male mice. E : Serum IGFBP-3 in male mice at 16 weeks of age. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Journal: Diabetes

    Article Title: Growth Hormone Control of Hepatic Lipid Metabolism

    doi: 10.2337/db16-0649

    Figure Lengend Snippet: Restoration of hepatic IGF-1 gene expression in Li-GHRKO mice. A : HIT were crossed with Li-GHRKO mice to yield the following groups: control mice harbored the floxed ghr gene, HIT mice harbored the rat IGF-1 transgene and floxed ghr gene, Li-GHRKO harbored the floxed ghr gene and albumin (Alb) promoter–derived Cre transgene, and the Li-GHRKO-HIT mice harbored the floxed ghr gene, albumin promoter–derived Cre transgene, and HIT. B : Serum IGF-1 levels in male mice at 16 weeks of age. C : Serum GH levels in male mice at 8–16 weeks of age. D : Serum ALS levels of 16-week-old male mice. E : Serum IGFBP-3 in male mice at 16 weeks of age. Data presented as mean ± SEM. N indicates sample size. Significance accepted at P

    Article Snippet: IGF-1 Is Insufficient to Restore Lipid Metabolism in the Livers of GH-Resistant Mice Relative liver weight in the Li-GHRKO mice increased at all ages and was reduced in the Li-GHRKO-HIT mice ( ).

    Techniques: Expressing, Mouse Assay, Derivative Assay

    IGF1 increases the proportion of pH3-positive Sox9-EGFP Low cells only during crypt regeneration. A ) Immunofluorescence demonstrates increased number of pH3-positive cells per crypt section in IGF1-treated mice vs. vehicle-treated controls at 5 days after

    Journal: The FASEB Journal

    Article Title: IGF1 stimulates crypt expansion via differential activation of 2 intestinal stem cell populations

    doi: 10.1096/fj.14-264010

    Figure Lengend Snippet: IGF1 increases the proportion of pH3-positive Sox9-EGFP Low cells only during crypt regeneration. A ) Immunofluorescence demonstrates increased number of pH3-positive cells per crypt section in IGF1-treated mice vs. vehicle-treated controls at 5 days after

    Article Snippet: Then, using Venn diagrams, genes significantly regulated by IGF1 exclusively in one particular Sox9-EGFP cell type were identified.

    Techniques: Immunofluorescence, Mouse Assay

    IGF1 increases proportions of EdU-positive Sox9-EGFP High cells but not Sox9-EGFP Low cells. A ) Immunofluorescence illustrates that IGF1 increased the numbers of EdU-positive cells per crypt section at 5 days after irradiation (Irr), but not in nonirradiated

    Journal: The FASEB Journal

    Article Title: IGF1 stimulates crypt expansion via differential activation of 2 intestinal stem cell populations

    doi: 10.1096/fj.14-264010

    Figure Lengend Snippet: IGF1 increases proportions of EdU-positive Sox9-EGFP High cells but not Sox9-EGFP Low cells. A ) Immunofluorescence illustrates that IGF1 increased the numbers of EdU-positive cells per crypt section at 5 days after irradiation (Irr), but not in nonirradiated

    Article Snippet: Then, using Venn diagrams, genes significantly regulated by IGF1 exclusively in one particular Sox9-EGFP cell type were identified.

    Techniques: Immunofluorescence, Irradiation

    IGF1 treatment preferentially expands Sox9-EGFP Low cells. A ) Immunofluorescence illustrates that 5-day IGF1 therapy increased the number of Sox9-EGFP Low ISCs per crypt section in both normal (Non-Irr) and regenerating crypts (Irr) compared with vehicle

    Journal: The FASEB Journal

    Article Title: IGF1 stimulates crypt expansion via differential activation of 2 intestinal stem cell populations

    doi: 10.1096/fj.14-264010

    Figure Lengend Snippet: IGF1 treatment preferentially expands Sox9-EGFP Low cells. A ) Immunofluorescence illustrates that 5-day IGF1 therapy increased the number of Sox9-EGFP Low ISCs per crypt section in both normal (Non-Irr) and regenerating crypts (Irr) compared with vehicle

    Article Snippet: Then, using Venn diagrams, genes significantly regulated by IGF1 exclusively in one particular Sox9-EGFP cell type were identified.

    Techniques: Immunofluorescence

    Five day IGF1 treatment has trophic effects in normal and regenerating intestinal epithelium. A ) Hematoxylin and eosin staining in nonirradiated mice demonstrates that IGF1 induced significant changes in intestinal morphology including increased crypt

    Journal: The FASEB Journal

    Article Title: IGF1 stimulates crypt expansion via differential activation of 2 intestinal stem cell populations

    doi: 10.1096/fj.14-264010

    Figure Lengend Snippet: Five day IGF1 treatment has trophic effects in normal and regenerating intestinal epithelium. A ) Hematoxylin and eosin staining in nonirradiated mice demonstrates that IGF1 induced significant changes in intestinal morphology including increased crypt

    Article Snippet: Then, using Venn diagrams, genes significantly regulated by IGF1 exclusively in one particular Sox9-EGFP cell type were identified.

    Techniques: Staining, Mouse Assay

    Exogenous IGF1 directly stimulates enteroid formation ability in Sox9-EGFP High cells but not in Sox9-EGFP Low cells. A ) (Upper) Representative photographs of enteroids grown from Sox9-EGFP Low cells in absence or presence of IGF1 at 100 and 200 ng/ml at

    Journal: The FASEB Journal

    Article Title: IGF1 stimulates crypt expansion via differential activation of 2 intestinal stem cell populations

    doi: 10.1096/fj.14-264010

    Figure Lengend Snippet: Exogenous IGF1 directly stimulates enteroid formation ability in Sox9-EGFP High cells but not in Sox9-EGFP Low cells. A ) (Upper) Representative photographs of enteroids grown from Sox9-EGFP Low cells in absence or presence of IGF1 at 100 and 200 ng/ml at

    Article Snippet: Then, using Venn diagrams, genes significantly regulated by IGF1 exclusively in one particular Sox9-EGFP cell type were identified.

    Techniques:

    Cellular and molecular mechanisms involved in IGF1-induced crypt expansion. The schematic summarizes the cellular and molecular changes associated with crypt expansion induced by IGF1 therapy in uninjured intestine or during radiation-induced crypt regeneration.

    Journal: The FASEB Journal

    Article Title: IGF1 stimulates crypt expansion via differential activation of 2 intestinal stem cell populations

    doi: 10.1096/fj.14-264010

    Figure Lengend Snippet: Cellular and molecular mechanisms involved in IGF1-induced crypt expansion. The schematic summarizes the cellular and molecular changes associated with crypt expansion induced by IGF1 therapy in uninjured intestine or during radiation-induced crypt regeneration.

    Article Snippet: Then, using Venn diagrams, genes significantly regulated by IGF1 exclusively in one particular Sox9-EGFP cell type were identified.

    Techniques:

    IGF1 exerts differential impact on the gene expression profiles of the 2 Sox9-EGFP ISC populations. A and B illustrate selected mRNAs significantly regulated by IGF1 selectively/exclusively in each Sox9-EGFP ISC population isolated from uninjured small

    Journal: The FASEB Journal

    Article Title: IGF1 stimulates crypt expansion via differential activation of 2 intestinal stem cell populations

    doi: 10.1096/fj.14-264010

    Figure Lengend Snippet: IGF1 exerts differential impact on the gene expression profiles of the 2 Sox9-EGFP ISC populations. A and B illustrate selected mRNAs significantly regulated by IGF1 selectively/exclusively in each Sox9-EGFP ISC population isolated from uninjured small

    Article Snippet: Then, using Venn diagrams, genes significantly regulated by IGF1 exclusively in one particular Sox9-EGFP cell type were identified.

    Techniques: Expressing, Isolation

    Subgroup analyses of the association between circulating insulin-like growth factor-1 (IGF-1) concentrations and breast cancer risk in the UK Biobank (per 5 nmol/L increment) HR=hazard ratio; CI=confidence interval. Multivariable Cox regression model using age as the underlying time variable and stratified by Townsend deprivation index (fifths), region of the recruitment assessment center, and age at recruitment (5-year categories). Models adjusted for total physical activity (

    Journal: bioRxiv

    Article Title: Insulin-like growth factor-1 (IGF-1), insulin-like growth factor-binding protein-3 (IGFBP-3) and breast cancer risk: observational and Mendelian randomization analyses

    doi: 10.1101/809046

    Figure Lengend Snippet: Subgroup analyses of the association between circulating insulin-like growth factor-1 (IGF-1) concentrations and breast cancer risk in the UK Biobank (per 5 nmol/L increment) HR=hazard ratio; CI=confidence interval. Multivariable Cox regression model using age as the underlying time variable and stratified by Townsend deprivation index (fifths), region of the recruitment assessment center, and age at recruitment (5-year categories). Models adjusted for total physical activity (

    Article Snippet: Our use of summary-level data for our MR analyses meant that we were unable to examine possible non-linear effects or whether the associations between IGF-1 and breast cancer differed according to subgroups of other risk factors (e.g. BMI, alcohol consumption); however, in our observational analyses, which yielded a similar association to our MR result, we found a linear association between IGF-1 and breast cancer and detected no heterogeneity by subgroups of other risk factors.

    Techniques: Activity Assay

    Levels of GH and IGF-1 hormones in WT and En2 −/− mice . (A,B) ELISA quantification of GH (A) and IGF-1 (B) levels in serum and hippocampal (hippo) and liver protein extracts, as indicated. Values are plotted as mean ± SEM (five animals per genotype, in duplicate; * p

    Journal: Frontiers in Pediatrics

    Article Title: GH Dysfunction in Engrailed-2 Knockout Mice, a Model for Autism Spectrum Disorders

    doi: 10.3389/fped.2014.00092

    Figure Lengend Snippet: Levels of GH and IGF-1 hormones in WT and En2 −/− mice . (A,B) ELISA quantification of GH (A) and IGF-1 (B) levels in serum and hippocampal (hippo) and liver protein extracts, as indicated. Values are plotted as mean ± SEM (five animals per genotype, in duplicate; * p

    Article Snippet: Deregulation of hypothalamic hormones controlling GH synthesis might result in increased levels of circulating GH and IGF-1 in mutant mice.

    Techniques: Mouse Assay, Enzyme-linked Immunosorbent Assay

    Expression of IGF-1 and IGF-1R mRNAs in the neuroendocrine axis of WT and En2 −/− mice . (A,B) Quantitative RT-PCR for IGF-1 class 1 (A) and class 2 (B) transcripts. (C) IGF-1R quantitative RT-PCR. Values are plotted as each gene/L41 comparative quantitation ratios normalized on the expression of WT (mean ± SEM of three replicates from pools of six animals per genotype; * p

    Journal: Frontiers in Pediatrics

    Article Title: GH Dysfunction in Engrailed-2 Knockout Mice, a Model for Autism Spectrum Disorders

    doi: 10.3389/fped.2014.00092

    Figure Lengend Snippet: Expression of IGF-1 and IGF-1R mRNAs in the neuroendocrine axis of WT and En2 −/− mice . (A,B) Quantitative RT-PCR for IGF-1 class 1 (A) and class 2 (B) transcripts. (C) IGF-1R quantitative RT-PCR. Values are plotted as each gene/L41 comparative quantitation ratios normalized on the expression of WT (mean ± SEM of three replicates from pools of six animals per genotype; * p

    Article Snippet: Deregulation of hypothalamic hormones controlling GH synthesis might result in increased levels of circulating GH and IGF-1 in mutant mice.

    Techniques: Expressing, Mouse Assay, Quantitative RT-PCR, Quantitation Assay

    Schematic summary of SST, mGRF, GH, and IGF-1 expression in the En2 −/− neuroendocrine axis . Red and blue arrows, respectively, indicate up- and down-regulations observed in En2 −/− mice as compared to WT controls. Double-arrowed gray lines indicate comparable levels between WT and En2 −/− mice. Increased levels of GH and IGF-1 mRNA, respectively observed in En2 −/− pituitary and liver, are not paralleled by higher levels of circulating hormones, suggesting that a complex post-translational control of GH and IGF-1 synthesis takes place in mutant mice. GH mRNA and protein levels are instead significantly down-regulated in En2 −/− hippocampus. Arrowed red lines connecting different organs indicate the action of circulating hormones onto their target tissues. The mouse brain sagittal section is a Nissl stain taken from the Allen Mouse Brain Atlas (see text footnote 2). Abbreviations are as in the text.

    Journal: Frontiers in Pediatrics

    Article Title: GH Dysfunction in Engrailed-2 Knockout Mice, a Model for Autism Spectrum Disorders

    doi: 10.3389/fped.2014.00092

    Figure Lengend Snippet: Schematic summary of SST, mGRF, GH, and IGF-1 expression in the En2 −/− neuroendocrine axis . Red and blue arrows, respectively, indicate up- and down-regulations observed in En2 −/− mice as compared to WT controls. Double-arrowed gray lines indicate comparable levels between WT and En2 −/− mice. Increased levels of GH and IGF-1 mRNA, respectively observed in En2 −/− pituitary and liver, are not paralleled by higher levels of circulating hormones, suggesting that a complex post-translational control of GH and IGF-1 synthesis takes place in mutant mice. GH mRNA and protein levels are instead significantly down-regulated in En2 −/− hippocampus. Arrowed red lines connecting different organs indicate the action of circulating hormones onto their target tissues. The mouse brain sagittal section is a Nissl stain taken from the Allen Mouse Brain Atlas (see text footnote 2). Abbreviations are as in the text.

    Article Snippet: Deregulation of hypothalamic hormones controlling GH synthesis might result in increased levels of circulating GH and IGF-1 in mutant mice.

    Techniques: Expressing, Mouse Assay, Mutagenesis, Staining

    mRNA expression of En2 and genes involved in the GH/IGF-1 pathway in the neuroendocrine axis of WT mice . En2 (A) , GH (B) , GHR (C) , mGRF (D) , SST (E) , IGF-1 (F,G) , and IGF-1R (H) mRNA expression levels in the hippocampus, hypothalamus, pituitary gland, liver, and blood, obtained by quantitative RT-PCR. For each mRNA, relative expression levels (normalized to L41) are reported on a log scale. Two different transcripts (class 1 and class 2) were analyzed for IGF-1. Values are plotted as mean ± SEM of three independent experiments. Abbreviations: hi, hippocampus; hy, hypothalamus; pit, pituitary gland; liv, liver; bld, blood (cell fraction). Other abbreviations are as in the text.

    Journal: Frontiers in Pediatrics

    Article Title: GH Dysfunction in Engrailed-2 Knockout Mice, a Model for Autism Spectrum Disorders

    doi: 10.3389/fped.2014.00092

    Figure Lengend Snippet: mRNA expression of En2 and genes involved in the GH/IGF-1 pathway in the neuroendocrine axis of WT mice . En2 (A) , GH (B) , GHR (C) , mGRF (D) , SST (E) , IGF-1 (F,G) , and IGF-1R (H) mRNA expression levels in the hippocampus, hypothalamus, pituitary gland, liver, and blood, obtained by quantitative RT-PCR. For each mRNA, relative expression levels (normalized to L41) are reported on a log scale. Two different transcripts (class 1 and class 2) were analyzed for IGF-1. Values are plotted as mean ± SEM of three independent experiments. Abbreviations: hi, hippocampus; hy, hypothalamus; pit, pituitary gland; liv, liver; bld, blood (cell fraction). Other abbreviations are as in the text.

    Article Snippet: Deregulation of hypothalamic hormones controlling GH synthesis might result in increased levels of circulating GH and IGF-1 in mutant mice.

    Techniques: Expressing, Mouse Assay, Quantitative RT-PCR

    Dose-dependent effects of IGF1 and insulin on signalling, proliferation, and apoptosis in A549 cells. Cells were exposed to IGF1 or insulin as described for Figs. 2 and 4 , and data are shown as in Fig. 8 for Saos-2/B10 cells. Top panel Western blot showing p-Akt/PKB, p-ERK1/2, bottom panel stimulation of DNA synthesis ( n = 7 in triplicate) and inhibition of apoptosis ( n = 2 in triplicate), expressed relative to control ( log scale ). c denotes control, *** p

    Journal: Molecular and Cellular Biochemistry

    Article Title: Prevention of tumour cell apoptosis associated with sustained protein kinase B phosphorylation is more sensitive to regulation by insulin signalling than stimulation of proliferation and extracellular signal-regulated kinase

    doi: 10.1007/s11010-017-2996-y

    Figure Lengend Snippet: Dose-dependent effects of IGF1 and insulin on signalling, proliferation, and apoptosis in A549 cells. Cells were exposed to IGF1 or insulin as described for Figs. 2 and 4 , and data are shown as in Fig. 8 for Saos-2/B10 cells. Top panel Western blot showing p-Akt/PKB, p-ERK1/2, bottom panel stimulation of DNA synthesis ( n = 7 in triplicate) and inhibition of apoptosis ( n = 2 in triplicate), expressed relative to control ( log scale ). c denotes control, *** p

    Article Snippet: IGF1 was more potent and half-maximal stimulation was reached at lower concentrations of IGF1 (0.4 nmol/l) compared to insulin (20 nmol/l).

    Techniques: Western Blot, DNA Synthesis, Inhibition

    Time-dependent activation of Akt/PKB and ERK1/2 by IGF1 and insulin in A549 cells. Representative Western blots are shown on top; quantification of signals from two independent experiments (with duplicates) below. Abundance of p-Akt/PKB and p-ERK1/2 is shown relative to control (4 h). Cells were exposed to vehicle ( empty symbols ), to 1 nmol/l IGF1 ( filled squares ) or to 100 nmol/l insulin ( filled triangles ) as outlined in Fig. 1 b, and incubations were stopped after 10, 30, 120, and 240 min (as in Fig. 3 ). M denotes markers

    Journal: Molecular and Cellular Biochemistry

    Article Title: Prevention of tumour cell apoptosis associated with sustained protein kinase B phosphorylation is more sensitive to regulation by insulin signalling than stimulation of proliferation and extracellular signal-regulated kinase

    doi: 10.1007/s11010-017-2996-y

    Figure Lengend Snippet: Time-dependent activation of Akt/PKB and ERK1/2 by IGF1 and insulin in A549 cells. Representative Western blots are shown on top; quantification of signals from two independent experiments (with duplicates) below. Abundance of p-Akt/PKB and p-ERK1/2 is shown relative to control (4 h). Cells were exposed to vehicle ( empty symbols ), to 1 nmol/l IGF1 ( filled squares ) or to 100 nmol/l insulin ( filled triangles ) as outlined in Fig. 1 b, and incubations were stopped after 10, 30, 120, and 240 min (as in Fig. 3 ). M denotes markers

    Article Snippet: IGF1 was more potent and half-maximal stimulation was reached at lower concentrations of IGF1 (0.4 nmol/l) compared to insulin (20 nmol/l).

    Techniques: Activation Assay, Western Blot

    Time-dependent inhibition of apoptosis and activation of signalling by IGF1 and insulin in Saos-2/B10 cells. Cells were cultured in serum-free media for the last 4 h as shown in Fig. 1 a (common stop). IGF1 ( a , 1 nmol/l) or insulin ( b , 100 nmol/l) was added to the media 30 min, 1 h, 2 h, or 4 h prior to stop. Apoptosis is shown at the top (expressed relative to 4 h control; n = 5), representative Western blots in lower panels

    Journal: Molecular and Cellular Biochemistry

    Article Title: Prevention of tumour cell apoptosis associated with sustained protein kinase B phosphorylation is more sensitive to regulation by insulin signalling than stimulation of proliferation and extracellular signal-regulated kinase

    doi: 10.1007/s11010-017-2996-y

    Figure Lengend Snippet: Time-dependent inhibition of apoptosis and activation of signalling by IGF1 and insulin in Saos-2/B10 cells. Cells were cultured in serum-free media for the last 4 h as shown in Fig. 1 a (common stop). IGF1 ( a , 1 nmol/l) or insulin ( b , 100 nmol/l) was added to the media 30 min, 1 h, 2 h, or 4 h prior to stop. Apoptosis is shown at the top (expressed relative to 4 h control; n = 5), representative Western blots in lower panels

    Article Snippet: IGF1 was more potent and half-maximal stimulation was reached at lower concentrations of IGF1 (0.4 nmol/l) compared to insulin (20 nmol/l).

    Techniques: Inhibition, Activation Assay, Cell Culture, Western Blot

    Effects of IGF1, insulin, glargine, and FCS compared in Saos-2/B10 cells. Cells were exposed to IGF1, insulin, glargine, or FCS as described for Figs. 2 and 4 . Top panel Western blot showing p-Akt/PKB, p-ERK1/2, bottom panel stimulation of DNA synthesis and inhibition of apoptosis, expressed relative to control ( log scale ), n = 7. c denotes control, *** p

    Journal: Molecular and Cellular Biochemistry

    Article Title: Prevention of tumour cell apoptosis associated with sustained protein kinase B phosphorylation is more sensitive to regulation by insulin signalling than stimulation of proliferation and extracellular signal-regulated kinase

    doi: 10.1007/s11010-017-2996-y

    Figure Lengend Snippet: Effects of IGF1, insulin, glargine, and FCS compared in Saos-2/B10 cells. Cells were exposed to IGF1, insulin, glargine, or FCS as described for Figs. 2 and 4 . Top panel Western blot showing p-Akt/PKB, p-ERK1/2, bottom panel stimulation of DNA synthesis and inhibition of apoptosis, expressed relative to control ( log scale ), n = 7. c denotes control, *** p

    Article Snippet: IGF1 was more potent and half-maximal stimulation was reached at lower concentrations of IGF1 (0.4 nmol/l) compared to insulin (20 nmol/l).

    Techniques: Western Blot, DNA Synthesis, Inhibition

    Time-dependent interference of IGFBP3 with apoptosis inhibition by IGF1 and glargine in Saos-2/B10 cells. Cells were cultured in serum-free media for 4 h in the absence or presence of 1 nmol/l IGF1 ( a , n = 5) or 1 nmol/l glargine ( b , n = 3) as shown in Fig. 1 a (common stop). IGFBP3 (10 nmol/l) was added 30 min, 1 h, 2 h, and 4 h prior to stop ( n = 5)

    Journal: Molecular and Cellular Biochemistry

    Article Title: Prevention of tumour cell apoptosis associated with sustained protein kinase B phosphorylation is more sensitive to regulation by insulin signalling than stimulation of proliferation and extracellular signal-regulated kinase

    doi: 10.1007/s11010-017-2996-y

    Figure Lengend Snippet: Time-dependent interference of IGFBP3 with apoptosis inhibition by IGF1 and glargine in Saos-2/B10 cells. Cells were cultured in serum-free media for 4 h in the absence or presence of 1 nmol/l IGF1 ( a , n = 5) or 1 nmol/l glargine ( b , n = 3) as shown in Fig. 1 a (common stop). IGFBP3 (10 nmol/l) was added 30 min, 1 h, 2 h, and 4 h prior to stop ( n = 5)

    Article Snippet: IGF1 was more potent and half-maximal stimulation was reached at lower concentrations of IGF1 (0.4 nmol/l) compared to insulin (20 nmol/l).

    Techniques: Inhibition, Cell Culture

    Time-dependent interference of wortmannin with apoptosis inhibition by IGF1 and insulin in Saos-2/B10 cells. Cells were cultured in serum-free media containing 1 nmol/l IGF1 ( a , n = 5) or 100 nmol/l insulin ( b , n = 3), as shown in Fig. 1 a (common stop). WT (100 nmol/l) was added 1, 2, 3, and 4 h prior to stop

    Journal: Molecular and Cellular Biochemistry

    Article Title: Prevention of tumour cell apoptosis associated with sustained protein kinase B phosphorylation is more sensitive to regulation by insulin signalling than stimulation of proliferation and extracellular signal-regulated kinase

    doi: 10.1007/s11010-017-2996-y

    Figure Lengend Snippet: Time-dependent interference of wortmannin with apoptosis inhibition by IGF1 and insulin in Saos-2/B10 cells. Cells were cultured in serum-free media containing 1 nmol/l IGF1 ( a , n = 5) or 100 nmol/l insulin ( b , n = 3), as shown in Fig. 1 a (common stop). WT (100 nmol/l) was added 1, 2, 3, and 4 h prior to stop

    Article Snippet: IGF1 was more potent and half-maximal stimulation was reached at lower concentrations of IGF1 (0.4 nmol/l) compared to insulin (20 nmol/l).

    Techniques: Inhibition, Cell Culture

    Flow diagram of experimental protocols. Cells were grown in FCS-containing media for 3 days and exposed to serum-free, albumin-containing test media as shown. Apoptosis was assessed after 4 h ( a , “common stop”) by an ELISA detecting cytosolic oligonucleosomes. Insulin/IGF1 signalling was analysed by Western blotting using antibodies against the unphosphorylated and phosphorylated forms of IR-IGF1R-IRS1 (not shown), Akt/PKB and ERK1/2, and actin, with “common stop” ( a ) and with “common start” ( b ) protocols as indicated

    Journal: Molecular and Cellular Biochemistry

    Article Title: Prevention of tumour cell apoptosis associated with sustained protein kinase B phosphorylation is more sensitive to regulation by insulin signalling than stimulation of proliferation and extracellular signal-regulated kinase

    doi: 10.1007/s11010-017-2996-y

    Figure Lengend Snippet: Flow diagram of experimental protocols. Cells were grown in FCS-containing media for 3 days and exposed to serum-free, albumin-containing test media as shown. Apoptosis was assessed after 4 h ( a , “common stop”) by an ELISA detecting cytosolic oligonucleosomes. Insulin/IGF1 signalling was analysed by Western blotting using antibodies against the unphosphorylated and phosphorylated forms of IR-IGF1R-IRS1 (not shown), Akt/PKB and ERK1/2, and actin, with “common stop” ( a ) and with “common start” ( b ) protocols as indicated

    Article Snippet: IGF1 was more potent and half-maximal stimulation was reached at lower concentrations of IGF1 (0.4 nmol/l) compared to insulin (20 nmol/l).

    Techniques: Flow Cytometry, Enzyme-linked Immunosorbent Assay, Western Blot

    Insulin and IGF1 regulate proliferation and apoptosis of Saos-2/B10 cells. a Stimulation of [ 3 H]-thymidine incorporation into DNA by IGF1 and insulin. Cells were grown in 5% FCS-containing media for 3 days and exposed to serum-free, albumin-containing test media, containing IGF1 or insulin. DNA synthesis was measured by a [ 3 H]-thymidine pulse 18–21 h following exposure to test media ( n = 6). b Inhibition of apoptosis by IGF1 and insulin. Cells were exposed to test media containing IGF1 or insulin as shown in Fig. 1 a. Apoptosis was assessed after 4 h. Results are expressed relative to control ( n = 5)

    Journal: Molecular and Cellular Biochemistry

    Article Title: Prevention of tumour cell apoptosis associated with sustained protein kinase B phosphorylation is more sensitive to regulation by insulin signalling than stimulation of proliferation and extracellular signal-regulated kinase

    doi: 10.1007/s11010-017-2996-y

    Figure Lengend Snippet: Insulin and IGF1 regulate proliferation and apoptosis of Saos-2/B10 cells. a Stimulation of [ 3 H]-thymidine incorporation into DNA by IGF1 and insulin. Cells were grown in 5% FCS-containing media for 3 days and exposed to serum-free, albumin-containing test media, containing IGF1 or insulin. DNA synthesis was measured by a [ 3 H]-thymidine pulse 18–21 h following exposure to test media ( n = 6). b Inhibition of apoptosis by IGF1 and insulin. Cells were exposed to test media containing IGF1 or insulin as shown in Fig. 1 a. Apoptosis was assessed after 4 h. Results are expressed relative to control ( n = 5)

    Article Snippet: IGF1 was more potent and half-maximal stimulation was reached at lower concentrations of IGF1 (0.4 nmol/l) compared to insulin (20 nmol/l).

    Techniques: DNA Synthesis, Inhibition

    Dose-dependent activation of Akt/PKB and ERK1/2 by IGF1 and insulin in Saos-2/B10 cells. Cells were exposed to IGF1 ( a ) and insulin ( b ) for 30 min as described in Fig. 1 b (common start). Representative Western blots are shown on top , below quantification of at least four independent experiments. Abundance of p-Akt/PKB and p-ERK1/2 is expressed relative to control

    Journal: Molecular and Cellular Biochemistry

    Article Title: Prevention of tumour cell apoptosis associated with sustained protein kinase B phosphorylation is more sensitive to regulation by insulin signalling than stimulation of proliferation and extracellular signal-regulated kinase

    doi: 10.1007/s11010-017-2996-y

    Figure Lengend Snippet: Dose-dependent activation of Akt/PKB and ERK1/2 by IGF1 and insulin in Saos-2/B10 cells. Cells were exposed to IGF1 ( a ) and insulin ( b ) for 30 min as described in Fig. 1 b (common start). Representative Western blots are shown on top , below quantification of at least four independent experiments. Abundance of p-Akt/PKB and p-ERK1/2 is expressed relative to control

    Article Snippet: IGF1 was more potent and half-maximal stimulation was reached at lower concentrations of IGF1 (0.4 nmol/l) compared to insulin (20 nmol/l).

    Techniques: Activation Assay, Western Blot

    Time-dependent activation of Akt/PKB and ERK1/2 by IGF1 and insulin in Saos-2/B10 cells. Representative Western blots are shown on top ; quantification of signals from at least four independent experiments below. Abundance of p-Akt/PKB and p-ERK1/2 is shown relative to control (4 h). Cells were exposed to vehicle ( empty symbols ), to 1 nmol/l IGF1 ( filled squares ) or to 100 nmol/l insulin ( filled triangles ) as outlined in Fig. 1 b, and incubations were stopped after 10, 30, 120, and 240 min

    Journal: Molecular and Cellular Biochemistry

    Article Title: Prevention of tumour cell apoptosis associated with sustained protein kinase B phosphorylation is more sensitive to regulation by insulin signalling than stimulation of proliferation and extracellular signal-regulated kinase

    doi: 10.1007/s11010-017-2996-y

    Figure Lengend Snippet: Time-dependent activation of Akt/PKB and ERK1/2 by IGF1 and insulin in Saos-2/B10 cells. Representative Western blots are shown on top ; quantification of signals from at least four independent experiments below. Abundance of p-Akt/PKB and p-ERK1/2 is shown relative to control (4 h). Cells were exposed to vehicle ( empty symbols ), to 1 nmol/l IGF1 ( filled squares ) or to 100 nmol/l insulin ( filled triangles ) as outlined in Fig. 1 b, and incubations were stopped after 10, 30, 120, and 240 min

    Article Snippet: IGF1 was more potent and half-maximal stimulation was reached at lower concentrations of IGF1 (0.4 nmol/l) compared to insulin (20 nmol/l).

    Techniques: Activation Assay, Western Blot

    Adherence: Significant increase in serum IGF-1 levels during the therapy period when compared with baseline.

    Journal: Cerebellum & Ataxias

    Article Title: IGF-1 in Friedreich’s Ataxia – proof-of-concept trial

    doi: 10.1186/2053-8871-1-10

    Figure Lengend Snippet: Adherence: Significant increase in serum IGF-1 levels during the therapy period when compared with baseline.

    Article Snippet: However, this tumour could have already been subclinically present at the beginning of the IGF-1 treatment, because his baseline level of IGF-1 was 3.279 ng/ml (N = < 2.5).

    Techniques:

    Predicted biomass production rate is increased in tumors of chronically X10/IGF1-treated mice and could possible explain the decreased tumor latency time in these treatments. a Bar plot of the mean tumor latency time in weeks per chronic treatment. b Bar plot of the normalized biomass production rate per treatment

    Journal: Breast Cancer Research : BCR

    Article Title: Insulin-like growth factor 1 receptor activation promotes mammary gland tumor development by increasing glycolysis and promoting biomass production

    doi: 10.1186/s13058-017-0802-0

    Figure Lengend Snippet: Predicted biomass production rate is increased in tumors of chronically X10/IGF1-treated mice and could possible explain the decreased tumor latency time in these treatments. a Bar plot of the mean tumor latency time in weeks per chronic treatment. b Bar plot of the normalized biomass production rate per treatment

    Article Snippet: IGF1 treatments were not present at all in cluster 1 and 2, while IGF1 and X10 treatment groups were over-represented in cluster 3.

    Techniques: Mouse Assay

    Genetic instability in mammary gland tumor tissue of chronically insulin analogue-exposed mice. a The bar plot shows the average number of mutations per MG tumor for all chronic treatments; the dot plot indicates that there is no correlation between the number of mutations of a specific tumor and tumor latency time. b The same as in a , but here we focus on clinically relevant human tumor driver mutations. c Some specific tumor driver mutations are featured in these bar plots. The first bar plot represents the mutations that are enriched in the X10/IGF1 treatment groups; in the second bar plot, the mutations are highlighted that are under-represented in the vehicle treatment group. N shows the number of tumors in which this specific mutation was present

    Journal: Breast Cancer Research : BCR

    Article Title: Insulin-like growth factor 1 receptor activation promotes mammary gland tumor development by increasing glycolysis and promoting biomass production

    doi: 10.1186/s13058-017-0802-0

    Figure Lengend Snippet: Genetic instability in mammary gland tumor tissue of chronically insulin analogue-exposed mice. a The bar plot shows the average number of mutations per MG tumor for all chronic treatments; the dot plot indicates that there is no correlation between the number of mutations of a specific tumor and tumor latency time. b The same as in a , but here we focus on clinically relevant human tumor driver mutations. c Some specific tumor driver mutations are featured in these bar plots. The first bar plot represents the mutations that are enriched in the X10/IGF1 treatment groups; in the second bar plot, the mutations are highlighted that are under-represented in the vehicle treatment group. N shows the number of tumors in which this specific mutation was present

    Article Snippet: IGF1 treatments were not present at all in cluster 1 and 2, while IGF1 and X10 treatment groups were over-represented in cluster 3.

    Techniques: Mouse Assay, Mutagenesis

    Warburg effect in mammary gland tumor tissue of chronically insulin analogue treated mice. a Hierarchical clustering (Pearson correlation) of genes involved in glycolysis or oxidative phosphorylation per MG tumor. The pie diagrams show the distribution of the different clusters per treatment group. b Table with the metabolic pathways that were significantly down- or upregulated in the X10/IGF1 treatment groups compared to the vehicle, insulin, and glargine treatment groups. c Table with the metabolic pathways that were significantly down- or upregulated after X10/IGF1 exposure compared to vehicle, insulin, and glargine treatment in the MCF7 IGF1R model

    Journal: Breast Cancer Research : BCR

    Article Title: Insulin-like growth factor 1 receptor activation promotes mammary gland tumor development by increasing glycolysis and promoting biomass production

    doi: 10.1186/s13058-017-0802-0

    Figure Lengend Snippet: Warburg effect in mammary gland tumor tissue of chronically insulin analogue treated mice. a Hierarchical clustering (Pearson correlation) of genes involved in glycolysis or oxidative phosphorylation per MG tumor. The pie diagrams show the distribution of the different clusters per treatment group. b Table with the metabolic pathways that were significantly down- or upregulated in the X10/IGF1 treatment groups compared to the vehicle, insulin, and glargine treatment groups. c Table with the metabolic pathways that were significantly down- or upregulated after X10/IGF1 exposure compared to vehicle, insulin, and glargine treatment in the MCF7 IGF1R model

    Article Snippet: IGF1 treatments were not present at all in cluster 1 and 2, while IGF1 and X10 treatment groups were over-represented in cluster 3.

    Techniques: Mouse Assay

    ACL is an mTOR regulated phosphoprotein A. MS/MS spectra of ACL phosphopeptide identified by SILAC. The sequence of a tryptic peptide matched to human ACL and the SILAC ratio (heavy-labeled/light-labeled (H/L)) for ACL peptide is shown for the corresponding spectra. B. and C. MDA361 cells were treated with 1 μmol/L WYE-132 for the indicated times (B) or with various inhibitors for 24 h (C) followed by immunoblotting. D. DNA sequence alignment of human, rat, mouse and xenopus ACL gene. E. HEK293 cells were serum-depleted overnight, treated with inhibitors for 30 min, stimulated with 100 ng/mL IGF-1 followed by immunoblotting. F. HEK293 cells were grown in medium with 1% FBS overnight, treated with DMSO, 1 μmol/L WYE-132 or 1 μmol/L rapamycin for 2 h. The cells were then stimulated for 2 h with 100 ng/mL IGF-1 and 14 C-glucose, and analyzed for de novo lipid synthesis as described in Methods. Statistical analysis: **, p

    Journal: Oncotarget

    Article Title: mTOR complex-2 stimulates acetyl-CoA and de novo lipogenesis through ATP citrate lyase in HER2/PIK3CA-hyperactive breast cancer

    doi: 10.18632/oncotarget.8279

    Figure Lengend Snippet: ACL is an mTOR regulated phosphoprotein A. MS/MS spectra of ACL phosphopeptide identified by SILAC. The sequence of a tryptic peptide matched to human ACL and the SILAC ratio (heavy-labeled/light-labeled (H/L)) for ACL peptide is shown for the corresponding spectra. B. and C. MDA361 cells were treated with 1 μmol/L WYE-132 for the indicated times (B) or with various inhibitors for 24 h (C) followed by immunoblotting. D. DNA sequence alignment of human, rat, mouse and xenopus ACL gene. E. HEK293 cells were serum-depleted overnight, treated with inhibitors for 30 min, stimulated with 100 ng/mL IGF-1 followed by immunoblotting. F. HEK293 cells were grown in medium with 1% FBS overnight, treated with DMSO, 1 μmol/L WYE-132 or 1 μmol/L rapamycin for 2 h. The cells were then stimulated for 2 h with 100 ng/mL IGF-1 and 14 C-glucose, and analyzed for de novo lipid synthesis as described in Methods. Statistical analysis: **, p

    Article Snippet: Recombinant human IGF-1 was purchased from R & D system.

    Techniques: Mass Spectrometry, Sequencing, Labeling

    GCS-100 treatment is associated with modulation of cell-signaling proteins and inhibits IGF-1 and TNF-α pathway stimulation . (A-B) RPMI 8226 cells were exposed to 500 μg/mL GCS-100 for up to 48 hours and after preparation of whole-cell lysates examined by Western blot. A total of 50 μg of protein was separated using 12% SDS-PAGE, transferred to PVDF membrane, and probed using the indicated antibodies. (C-E) RPMI 8226 cells were incubated in serum-free media for 1 hour and then cultured with 500 μg/mL GCS-100 or control media for 2 hours. Cells were then stimulated with TNF-α (5 ng/mL), IGF-1 (100 ng/mL), or IL-6 (10 ng/mL) for 30 minutes. Whole-cell lysates were prepared and 50 μg of protein resolved using 12% gel, transferred to PVDF, and probed with the indicated antibodies. β-Actin was used as a loading control.

    Journal: Blood

    Article Title: GCS-100, a novel galectin-3 antagonist, modulates MCL-1, NOXA, and cell cycle to induce myeloma cell death

    doi: 10.1182/blood-2009-10-251660

    Figure Lengend Snippet: GCS-100 treatment is associated with modulation of cell-signaling proteins and inhibits IGF-1 and TNF-α pathway stimulation . (A-B) RPMI 8226 cells were exposed to 500 μg/mL GCS-100 for up to 48 hours and after preparation of whole-cell lysates examined by Western blot. A total of 50 μg of protein was separated using 12% SDS-PAGE, transferred to PVDF membrane, and probed using the indicated antibodies. (C-E) RPMI 8226 cells were incubated in serum-free media for 1 hour and then cultured with 500 μg/mL GCS-100 or control media for 2 hours. Cells were then stimulated with TNF-α (5 ng/mL), IGF-1 (100 ng/mL), or IL-6 (10 ng/mL) for 30 minutes. Whole-cell lysates were prepared and 50 μg of protein resolved using 12% gel, transferred to PVDF, and probed with the indicated antibodies. β-Actin was used as a loading control.

    Article Snippet: Recombinant human IGF-1, recombinant human IL-6, and recombinant human TNF-α were purchased from PeproTech EC.

    Techniques: Western Blot, SDS Page, Incubation, Cell Culture

    Group differences in changes in IGF-1 levels over 12 mo adjusted for age. The PILL group had significant reductions in IGF-1 levels over 12 mo compared with the PATCH and NONE groups.

    Journal: The Journal of Clinical Endocrinology and Metabolism

    Article Title: Impact of Route of Estrogen Administration on Bone Turnover Markers in Oligoamenorrheic Athletes and Its Mediators

    doi: 10.1210/jc.2018-02143

    Figure Lengend Snippet: Group differences in changes in IGF-1 levels over 12 mo adjusted for age. The PILL group had significant reductions in IGF-1 levels over 12 mo compared with the PATCH and NONE groups.

    Article Snippet: In the group, as a whole, 12-month changes in P1NP were associated positively with changes in NTX ( r = 0.48, P ≤ 0.0001), and with 12-month changes in IGF-1 ( r = 0.37, P = 0.003) , IGF-1 z scores ( r = 0.27, P = 0.03), and the IGF-1/IGFBP-3 ratio ( r = 0.33, P = 0.05).

    Techniques:

    Association of changes in IGF-1 levels with changes in P1NP levels over 12 mo for the entire group. Changes in IGF-1 levels were associated positively with changes in P1NP levels over 12 mo.

    Journal: The Journal of Clinical Endocrinology and Metabolism

    Article Title: Impact of Route of Estrogen Administration on Bone Turnover Markers in Oligoamenorrheic Athletes and Its Mediators

    doi: 10.1210/jc.2018-02143

    Figure Lengend Snippet: Association of changes in IGF-1 levels with changes in P1NP levels over 12 mo for the entire group. Changes in IGF-1 levels were associated positively with changes in P1NP levels over 12 mo.

    Article Snippet: In the group, as a whole, 12-month changes in P1NP were associated positively with changes in NTX ( r = 0.48, P ≤ 0.0001), and with 12-month changes in IGF-1 ( r = 0.37, P = 0.003) , IGF-1 z scores ( r = 0.27, P = 0.03), and the IGF-1/IGFBP-3 ratio ( r = 0.33, P = 0.05).

    Techniques: