hiv 1 rt Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Worthington Biochemical hiv 1 rt
    Hiv 1 Rt, supplied by Worthington Biochemical, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hiv 1 rt/product/Worthington Biochemical
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hiv 1 rt - by Bioz Stars, 2022-08
    94/100 stars
      Buy from Supplier

    86
    Boston Therapeutics hiv 1 rt
    Structural arrangement of RT subdomains. ( A ) Key hydrogen-bonding interactions between connection and palm in PR-RT. ( B ) The PFV RT polymerase active site residues and some conserved structural elements found in retroviral RTs. ( C ) Structure of PFV PR-RT (subdomain coloring as in Figure 3 ) superimposed onto the <t>HIV–1</t> RT–DNA complex (gray) (PDB ID 1N6Q). ( D ) Surface rendering of the fingers-palm-thumb subdomains in PFV PR-RT with the connection and RNase H backbones shown as ribbons.
    Hiv 1 Rt, supplied by Boston Therapeutics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hiv 1 rt/product/Boston Therapeutics
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hiv 1 rt - by Bioz Stars, 2022-08
    86/100 stars
      Buy from Supplier

    86
    Abbott Laboratories abbott hiv 1 rt
    Bland-Altman and Passing and Bablok regression scatter plots. Xpert <t>HIV-1</t> VL versus (A) Taqman v2 (n = 53) and (B) Abbott HIV-1 RT (n = 45); (1) Bland Altman difference plots show the mean bias (solid line) and confidence intervals (dashed line); (2) Passing and Bablok regression analysis show the regression line (solid) with confidence intervals (dashed). Legends highlight the bias and regression equation.
    Abbott Hiv 1 Rt, supplied by Abbott Laboratories, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/abbott hiv 1 rt/product/Abbott Laboratories
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    abbott hiv 1 rt - by Bioz Stars, 2022-08
    86/100 stars
      Buy from Supplier

    86
    Brookhaven Instruments hiv 1 rt
    Binding of hexanucleotides to <t>HIV-1</t> RT. ( A ) Relative binding of DNA and homologous RNA hexamers as well as a RT-directed aptamer to RT (5 μM). The bars indicate mean values and SD of representative experiments. Pairs of DNA and RNA versions of hexamers are indicated by blue color. *The aptamer sequences are: DNA aptamer, d(ATCCGCCTGATTAGCGATACTCAGAAGGATAAACTGTCCAGAACTTGGA), RNA aptamer, GGGAGAUUCCGUUUUCAGUCGGGAAAAACUGAA. ( B ) Titration of HIV-1 RT with radiolabeled Hex-S3 R (1 nM) applying a filter binding assay. The curve shows the best fit of the experimental data to a quadratic equation and yields a K d of 5.3 (±0.5) μM. ( C ) Mutational analysis of the importance of each nucleotide position of Hex-S3 for binding to RT. An adenosine was introduced at each of the positions. ( D ) Site-specific binding of Hex-S3 R modified by a 4-thio-uridine at position 4 to RT as shown by UV cross-linking. Left panel, Coomassie blue-stained gel; middle panel, autoradiograph; right panel, overlay. ( E ) The 3D model of the binding site of RT for Hex-S3 based on docking studies and the constraints explained in the text. Color code: yellow, Hex-S3; green, CNBr fragment (42–183 amino acid); red, CNBr fragment (231–356 amino acid); blue, remaining portions of the large subunit p66; gray, small subunit p51. ( F ) Protein target specificity of Hex-S3.
    Hiv 1 Rt, supplied by Brookhaven Instruments, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hiv 1 rt/product/Brookhaven Instruments
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hiv 1 rt - by Bioz Stars, 2022-08
    86/100 stars
      Buy from Supplier

    Image Search Results


    Structural arrangement of RT subdomains. ( A ) Key hydrogen-bonding interactions between connection and palm in PR-RT. ( B ) The PFV RT polymerase active site residues and some conserved structural elements found in retroviral RTs. ( C ) Structure of PFV PR-RT (subdomain coloring as in Figure 3 ) superimposed onto the HIV–1 RT–DNA complex (gray) (PDB ID 1N6Q). ( D ) Surface rendering of the fingers-palm-thumb subdomains in PFV PR-RT with the connection and RNase H backbones shown as ribbons.

    Journal: Viruses

    Article Title: Crystal Structure of a Retroviral Polyprotein: Prototype Foamy Virus Protease-Reverse Transcriptase (PR-RT)

    doi: 10.3390/v13081495

    Figure Lengend Snippet: Structural arrangement of RT subdomains. ( A ) Key hydrogen-bonding interactions between connection and palm in PR-RT. ( B ) The PFV RT polymerase active site residues and some conserved structural elements found in retroviral RTs. ( C ) Structure of PFV PR-RT (subdomain coloring as in Figure 3 ) superimposed onto the HIV–1 RT–DNA complex (gray) (PDB ID 1N6Q). ( D ) Surface rendering of the fingers-palm-thumb subdomains in PFV PR-RT with the connection and RNase H backbones shown as ribbons.

    Article Snippet: The successful cross-linking suggests that the overall configuration of the catalytically active PFV RT is similar to that of the p66 subunit of HIV-1 RT.

    Techniques:

    Structural arrangements of domains and subdomains of PFV RT and HIV-1 RT. ( A ) Architecture of PFV PR-RT colored by subdomain, oriented from the N-terminus to the C-terminus (top left panel); from C to N-terminus (top right panel). ( B ) HIV-1 RT p66, color-coded by subdomain. ( C ) HIV-1 p51. Equivalent subdomains in each drawing are color-coded as in panel A.

    Journal: Viruses

    Article Title: Crystal Structure of a Retroviral Polyprotein: Prototype Foamy Virus Protease-Reverse Transcriptase (PR-RT)

    doi: 10.3390/v13081495

    Figure Lengend Snippet: Structural arrangements of domains and subdomains of PFV RT and HIV-1 RT. ( A ) Architecture of PFV PR-RT colored by subdomain, oriented from the N-terminus to the C-terminus (top left panel); from C to N-terminus (top right panel). ( B ) HIV-1 RT p66, color-coded by subdomain. ( C ) HIV-1 p51. Equivalent subdomains in each drawing are color-coded as in panel A.

    Article Snippet: The successful cross-linking suggests that the overall configuration of the catalytically active PFV RT is similar to that of the p66 subunit of HIV-1 RT.

    Techniques:

    Annotated diagrams of the sequence and structure of PFV PR-RT. Alpha helices in the RT portion are labeled A-O and beta strands are numbered 1–14; CTE: C-terminal extension and RH: RNase H. A topological map of the secondary structural elements has been provided in Figure S9 . HIV-1 RT secondary structure labeling can be found at: https://hivdb.stanford.edu/pages/3DStructures/rt.html#RT_p66 (accessed on 28 June 2021).

    Journal: Viruses

    Article Title: Crystal Structure of a Retroviral Polyprotein: Prototype Foamy Virus Protease-Reverse Transcriptase (PR-RT)

    doi: 10.3390/v13081495

    Figure Lengend Snippet: Annotated diagrams of the sequence and structure of PFV PR-RT. Alpha helices in the RT portion are labeled A-O and beta strands are numbered 1–14; CTE: C-terminal extension and RH: RNase H. A topological map of the secondary structural elements has been provided in Figure S9 . HIV-1 RT secondary structure labeling can be found at: https://hivdb.stanford.edu/pages/3DStructures/rt.html#RT_p66 (accessed on 28 June 2021).

    Article Snippet: The successful cross-linking suggests that the overall configuration of the catalytically active PFV RT is similar to that of the p66 subunit of HIV-1 RT.

    Techniques: Sequencing, Labeling

    Model of a dimeric PFV PR. ( A ) Dimers of PR-RT generated in silico by a 2-fold rotation. ( B ) The monomeric PFV PR domain in our crystal structure. ( C ) Superposition of dimeric HIV-1 PR (PDB ID 2HB4 (grey) on dimeric PFV PR generated in silico by 2-fold rotation. ( D ) Annotated diagram of HIV-1 PR.

    Journal: Viruses

    Article Title: Crystal Structure of a Retroviral Polyprotein: Prototype Foamy Virus Protease-Reverse Transcriptase (PR-RT)

    doi: 10.3390/v13081495

    Figure Lengend Snippet: Model of a dimeric PFV PR. ( A ) Dimers of PR-RT generated in silico by a 2-fold rotation. ( B ) The monomeric PFV PR domain in our crystal structure. ( C ) Superposition of dimeric HIV-1 PR (PDB ID 2HB4 (grey) on dimeric PFV PR generated in silico by 2-fold rotation. ( D ) Annotated diagram of HIV-1 PR.

    Article Snippet: The successful cross-linking suggests that the overall configuration of the catalytically active PFV RT is similar to that of the p66 subunit of HIV-1 RT.

    Techniques: Generated, In Silico

    RNase H domain of PFV PR-RT. ( A ) Superposition of RNase H subdomains of PFV (orange) and HIV-1 (grey). ( B ) Active site of PFV PR-RT RNase H subdomain residues chelating Ca 2+ (blue sphere). ( C ) Surface rendering of the interface between PR-RT thumb/connection subdomains and potential interactions with RNase H subdomain helix C.

    Journal: Viruses

    Article Title: Crystal Structure of a Retroviral Polyprotein: Prototype Foamy Virus Protease-Reverse Transcriptase (PR-RT)

    doi: 10.3390/v13081495

    Figure Lengend Snippet: RNase H domain of PFV PR-RT. ( A ) Superposition of RNase H subdomains of PFV (orange) and HIV-1 (grey). ( B ) Active site of PFV PR-RT RNase H subdomain residues chelating Ca 2+ (blue sphere). ( C ) Surface rendering of the interface between PR-RT thumb/connection subdomains and potential interactions with RNase H subdomain helix C.

    Article Snippet: The successful cross-linking suggests that the overall configuration of the catalytically active PFV RT is similar to that of the p66 subunit of HIV-1 RT.

    Techniques:

    Bland-Altman and Passing and Bablok regression scatter plots. Xpert HIV-1 VL versus (A) Taqman v2 (n = 53) and (B) Abbott HIV-1 RT (n = 45); (1) Bland Altman difference plots show the mean bias (solid line) and confidence intervals (dashed line); (2) Passing and Bablok regression analysis show the regression line (solid) with confidence intervals (dashed). Legends highlight the bias and regression equation.

    Journal: PLoS ONE

    Article Title: Options to Expand HIV Viral Load Testing in South Africa: Evaluation of the GeneXpert® HIV-1 Viral Load Assay

    doi: 10.1371/journal.pone.0168244

    Figure Lengend Snippet: Bland-Altman and Passing and Bablok regression scatter plots. Xpert HIV-1 VL versus (A) Taqman v2 (n = 53) and (B) Abbott HIV-1 RT (n = 45); (1) Bland Altman difference plots show the mean bias (solid line) and confidence intervals (dashed line); (2) Passing and Bablok regression analysis show the regression line (solid) with confidence intervals (dashed). Legends highlight the bias and regression equation.

    Article Snippet: The sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) (including 95% confidence intervals), as well as possible misclassification of the Xpert VL on plasma at the 1000cp/ml (log 3.0) clinical treatment failure threshold was determined using Taqman v2 and Abbott HIV-1 RT as the reference standards.

    Techniques:

    Scatter plots showing comparison of log VL values for Taqman v2, Abbott HIV-1 RT and Xpert VL assay. (A) Xpert HIV-1 (green) compared to Taqman v2 (blue) and Abbott HIV-1 RT (red) on plasma specimens. The vertical axis represents the log VL and the horizontal axis represents the sample number sorted by the Taqman v2 assay; B) Xpert HIV-1 plasma (blue) compared to Xpert HIV-1 whole blood (red) and Xpert HIV-1 DBS (green). The vertical axis respresents the log VL and the horizontal axis is sample number sorted by Xpert HIV-1 plasma VL values. The red dotted line in both plots highlights the 1000cp/ml clinical threshold.

    Journal: PLoS ONE

    Article Title: Options to Expand HIV Viral Load Testing in South Africa: Evaluation of the GeneXpert® HIV-1 Viral Load Assay

    doi: 10.1371/journal.pone.0168244

    Figure Lengend Snippet: Scatter plots showing comparison of log VL values for Taqman v2, Abbott HIV-1 RT and Xpert VL assay. (A) Xpert HIV-1 (green) compared to Taqman v2 (blue) and Abbott HIV-1 RT (red) on plasma specimens. The vertical axis represents the log VL and the horizontal axis represents the sample number sorted by the Taqman v2 assay; B) Xpert HIV-1 plasma (blue) compared to Xpert HIV-1 whole blood (red) and Xpert HIV-1 DBS (green). The vertical axis respresents the log VL and the horizontal axis is sample number sorted by Xpert HIV-1 plasma VL values. The red dotted line in both plots highlights the 1000cp/ml clinical threshold.

    Article Snippet: The sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) (including 95% confidence intervals), as well as possible misclassification of the Xpert VL on plasma at the 1000cp/ml (log 3.0) clinical treatment failure threshold was determined using Taqman v2 and Abbott HIV-1 RT as the reference standards.

    Techniques:

    A line plot showing the stability of dried viral spots (DVS) for instrument and assay verification. The log VL reported on Xpert HIV-1 was measured on DVS stored at room temperature and -20C over 42 days.

    Journal: PLoS ONE

    Article Title: Options to Expand HIV Viral Load Testing in South Africa: Evaluation of the GeneXpert® HIV-1 Viral Load Assay

    doi: 10.1371/journal.pone.0168244

    Figure Lengend Snippet: A line plot showing the stability of dried viral spots (DVS) for instrument and assay verification. The log VL reported on Xpert HIV-1 was measured on DVS stored at room temperature and -20C over 42 days.

    Article Snippet: The sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) (including 95% confidence intervals), as well as possible misclassification of the Xpert VL on plasma at the 1000cp/ml (log 3.0) clinical treatment failure threshold was determined using Taqman v2 and Abbott HIV-1 RT as the reference standards.

    Techniques:

    Protocol for testing of the DPS and DBS on the Xpert VL assay. Schematic of the use of dried viral spots (DVS) for quality management of the GeneXpert instrument with the Xpert HIV-1 VL assay.

    Journal: PLoS ONE

    Article Title: Options to Expand HIV Viral Load Testing in South Africa: Evaluation of the GeneXpert® HIV-1 Viral Load Assay

    doi: 10.1371/journal.pone.0168244

    Figure Lengend Snippet: Protocol for testing of the DPS and DBS on the Xpert VL assay. Schematic of the use of dried viral spots (DVS) for quality management of the GeneXpert instrument with the Xpert HIV-1 VL assay.

    Article Snippet: The sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) (including 95% confidence intervals), as well as possible misclassification of the Xpert VL on plasma at the 1000cp/ml (log 3.0) clinical treatment failure threshold was determined using Taqman v2 and Abbott HIV-1 RT as the reference standards.

    Techniques:

    Binding of hexanucleotides to HIV-1 RT. ( A ) Relative binding of DNA and homologous RNA hexamers as well as a RT-directed aptamer to RT (5 μM). The bars indicate mean values and SD of representative experiments. Pairs of DNA and RNA versions of hexamers are indicated by blue color. *The aptamer sequences are: DNA aptamer, d(ATCCGCCTGATTAGCGATACTCAGAAGGATAAACTGTCCAGAACTTGGA), RNA aptamer, GGGAGAUUCCGUUUUCAGUCGGGAAAAACUGAA. ( B ) Titration of HIV-1 RT with radiolabeled Hex-S3 R (1 nM) applying a filter binding assay. The curve shows the best fit of the experimental data to a quadratic equation and yields a K d of 5.3 (±0.5) μM. ( C ) Mutational analysis of the importance of each nucleotide position of Hex-S3 for binding to RT. An adenosine was introduced at each of the positions. ( D ) Site-specific binding of Hex-S3 R modified by a 4-thio-uridine at position 4 to RT as shown by UV cross-linking. Left panel, Coomassie blue-stained gel; middle panel, autoradiograph; right panel, overlay. ( E ) The 3D model of the binding site of RT for Hex-S3 based on docking studies and the constraints explained in the text. Color code: yellow, Hex-S3; green, CNBr fragment (42–183 amino acid); red, CNBr fragment (231–356 amino acid); blue, remaining portions of the large subunit p66; gray, small subunit p51. ( F ) Protein target specificity of Hex-S3.

    Journal: Nucleic Acids Research

    Article Title: Specific binding of a hexanucleotide to HIV-1 reverse transcriptase: a novel class of bioactive molecules

    doi: 10.1093/nar/gkl533

    Figure Lengend Snippet: Binding of hexanucleotides to HIV-1 RT. ( A ) Relative binding of DNA and homologous RNA hexamers as well as a RT-directed aptamer to RT (5 μM). The bars indicate mean values and SD of representative experiments. Pairs of DNA and RNA versions of hexamers are indicated by blue color. *The aptamer sequences are: DNA aptamer, d(ATCCGCCTGATTAGCGATACTCAGAAGGATAAACTGTCCAGAACTTGGA), RNA aptamer, GGGAGAUUCCGUUUUCAGUCGGGAAAAACUGAA. ( B ) Titration of HIV-1 RT with radiolabeled Hex-S3 R (1 nM) applying a filter binding assay. The curve shows the best fit of the experimental data to a quadratic equation and yields a K d of 5.3 (±0.5) μM. ( C ) Mutational analysis of the importance of each nucleotide position of Hex-S3 for binding to RT. An adenosine was introduced at each of the positions. ( D ) Site-specific binding of Hex-S3 R modified by a 4-thio-uridine at position 4 to RT as shown by UV cross-linking. Left panel, Coomassie blue-stained gel; middle panel, autoradiograph; right panel, overlay. ( E ) The 3D model of the binding site of RT for Hex-S3 based on docking studies and the constraints explained in the text. Color code: yellow, Hex-S3; green, CNBr fragment (42–183 amino acid); red, CNBr fragment (231–356 amino acid); blue, remaining portions of the large subunit p66; gray, small subunit p51. ( F ) Protein target specificity of Hex-S3.

    Article Snippet: For this matter, filter binding assays were performed with (i) the small subunit p51 of HIV-1 RT, (ii) HIV-2 RT, which is highly homologous to the HIV-1 RT (60% amino acid identity plus 13% amino acid homology), (iii) EIAV RT, (iv) T7 RNA polymerase and (v) BSA ( ).

    Techniques: Binding Assay, Titration, Filter-binding Assay, Modification, Staining, Autoradiography

    Biological activity of Hex-S3 R in a cell culture model for HIV-1 replication. Briefly, in a first step, packaging 293T cells are co-transfected with a luciferase-harboring defective HIV-1 genome and plasmid-encoded packaging functions (see Materials and Methods section). Released infectious recombinant particles were used in a consecutive step to infect recipient cells. Hexanucleotides were co-transfected in the first step at concentrations given in the figure and luciferase activity was measured after infection of 293T cells. The data were normalized for viable cells.

    Journal: Nucleic Acids Research

    Article Title: Specific binding of a hexanucleotide to HIV-1 reverse transcriptase: a novel class of bioactive molecules

    doi: 10.1093/nar/gkl533

    Figure Lengend Snippet: Biological activity of Hex-S3 R in a cell culture model for HIV-1 replication. Briefly, in a first step, packaging 293T cells are co-transfected with a luciferase-harboring defective HIV-1 genome and plasmid-encoded packaging functions (see Materials and Methods section). Released infectious recombinant particles were used in a consecutive step to infect recipient cells. Hexanucleotides were co-transfected in the first step at concentrations given in the figure and luciferase activity was measured after infection of 293T cells. The data were normalized for viable cells.

    Article Snippet: For this matter, filter binding assays were performed with (i) the small subunit p51 of HIV-1 RT, (ii) HIV-2 RT, which is highly homologous to the HIV-1 RT (60% amino acid identity plus 13% amino acid homology), (iii) EIAV RT, (iv) T7 RNA polymerase and (v) BSA ( ).

    Techniques: Activity Assay, Cell Culture, Transfection, Luciferase, Plasmid Preparation, Recombinant, Infection