gfp-cftrδf508 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    OriGene control vector based shrna encoding tgaccaccctgacctacggcgtgcagtgc
    Control Vector Based Shrna Encoding Tgaccaccctgacctacggcgtgcagtgc, supplied by OriGene, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control vector based shrna encoding tgaccaccctgacctacggcgtgcagtgc/product/OriGene
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    control vector based shrna encoding tgaccaccctgacctacggcgtgcagtgc - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    93
    Thermo Fisher protein vcp antibodies
    Protein Vcp Antibodies, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/protein vcp antibodies/product/Thermo Fisher
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    protein vcp antibodies - by Bioz Stars, 2020-11
    93/100 stars
      Buy from Supplier

    90
    Abcam hrp labeled goat anti rabbit igg
    Hrp Labeled Goat Anti Rabbit Igg, supplied by Abcam, used in various techniques. Bioz Stars score: 90/100, based on 41 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hrp labeled goat anti rabbit igg/product/Abcam
    Average 90 stars, based on 41 article reviews
    Price from $9.99 to $1999.99
    hrp labeled goat anti rabbit igg - by Bioz Stars, 2020-11
    90/100 stars
      Buy from Supplier

    92
    Abcam hrp labeled goat anti mouse igg
    Hrp Labeled Goat Anti Mouse Igg, supplied by Abcam, used in various techniques. Bioz Stars score: 92/100, based on 41 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hrp labeled goat anti mouse igg/product/Abcam
    Average 92 stars, based on 41 article reviews
    Price from $9.99 to $1999.99
    hrp labeled goat anti mouse igg - by Bioz Stars, 2020-11
    92/100 stars
      Buy from Supplier

    92
    Abcam normal rabbit igg
    Normal Rabbit Igg, supplied by Abcam, used in various techniques. Bioz Stars score: 92/100, based on 488 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/normal rabbit igg/product/Abcam
    Average 92 stars, based on 488 article reviews
    Price from $9.99 to $1999.99
    normal rabbit igg - by Bioz Stars, 2020-11
    92/100 stars
      Buy from Supplier

    95
    Addgene inc gfp vcp construct
    USP25 reduces levels of ubiquitinated endogenous proteins associated with HRD1 or <t>VCP/p97.</t> A–C) HEK-293 cells were transfected as indicated. 48 hours later cells were harvested and constructs were immunopurified with bead-bound anti-V5 antibody to isolate V5-HRD1-associated protein (panels A and B), or with bead-bound <t>anti-GFP</t> antibody to isolate GFP-VCP-associated proteins (panel C). We did not detect ubiquitin species in western blots from stringent, denature/renature immunoprecipitations of HRD1 or VCP/p97 using RIPA buffer (data not shown), indicating that the ubiquitin signal we observe in this figure is due to species associated with HRD1 or VCP/p97. Shown are western blots of inputs from whole cells lysates and from immunopurified protein. Histograms are semi-quantifications of results from the left and other similar, independent experiments. Shown are means +/− standard deviations. P values for panels A and C are from Student-T tests.
    Gfp Vcp Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gfp vcp construct/product/Addgene inc
    Average 95 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    gfp vcp construct - by Bioz Stars, 2020-11
    95/100 stars
      Buy from Supplier

    92
    Becton Dickinson facs cantoii flow cytometer
    USP25 reduces levels of ubiquitinated endogenous proteins associated with HRD1 or <t>VCP/p97.</t> A–C) HEK-293 cells were transfected as indicated. 48 hours later cells were harvested and constructs were immunopurified with bead-bound anti-V5 antibody to isolate V5-HRD1-associated protein (panels A and B), or with bead-bound <t>anti-GFP</t> antibody to isolate GFP-VCP-associated proteins (panel C). We did not detect ubiquitin species in western blots from stringent, denature/renature immunoprecipitations of HRD1 or VCP/p97 using RIPA buffer (data not shown), indicating that the ubiquitin signal we observe in this figure is due to species associated with HRD1 or VCP/p97. Shown are western blots of inputs from whole cells lysates and from immunopurified protein. Histograms are semi-quantifications of results from the left and other similar, independent experiments. Shown are means +/− standard deviations. P values for panels A and C are from Student-T tests.
    Facs Cantoii Flow Cytometer, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 92/100, based on 735 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/facs cantoii flow cytometer/product/Becton Dickinson
    Average 92 stars, based on 735 article reviews
    Price from $9.99 to $1999.99
    facs cantoii flow cytometer - by Bioz Stars, 2020-11
    92/100 stars
      Buy from Supplier

    95
    Becton Dickinson facs diva software
    USP25 reduces levels of ubiquitinated endogenous proteins associated with HRD1 or <t>VCP/p97.</t> A–C) HEK-293 cells were transfected as indicated. 48 hours later cells were harvested and constructs were immunopurified with bead-bound anti-V5 antibody to isolate V5-HRD1-associated protein (panels A and B), or with bead-bound <t>anti-GFP</t> antibody to isolate GFP-VCP-associated proteins (panel C). We did not detect ubiquitin species in western blots from stringent, denature/renature immunoprecipitations of HRD1 or VCP/p97 using RIPA buffer (data not shown), indicating that the ubiquitin signal we observe in this figure is due to species associated with HRD1 or VCP/p97. Shown are western blots of inputs from whole cells lysates and from immunopurified protein. Histograms are semi-quantifications of results from the left and other similar, independent experiments. Shown are means +/− standard deviations. P values for panels A and C are from Student-T tests.
    Facs Diva Software, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 95/100, based on 16368 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/facs diva software/product/Becton Dickinson
    Average 95 stars, based on 16368 article reviews
    Price from $9.99 to $1999.99
    facs diva software - by Bioz Stars, 2020-11
    95/100 stars
      Buy from Supplier

    93
    Stratagene stop codon
    USP25 reduces levels of ubiquitinated endogenous proteins associated with HRD1 or <t>VCP/p97.</t> A–C) HEK-293 cells were transfected as indicated. 48 hours later cells were harvested and constructs were immunopurified with bead-bound anti-V5 antibody to isolate V5-HRD1-associated protein (panels A and B), or with bead-bound <t>anti-GFP</t> antibody to isolate GFP-VCP-associated proteins (panel C). We did not detect ubiquitin species in western blots from stringent, denature/renature immunoprecipitations of HRD1 or VCP/p97 using RIPA buffer (data not shown), indicating that the ubiquitin signal we observe in this figure is due to species associated with HRD1 or VCP/p97. Shown are western blots of inputs from whole cells lysates and from immunopurified protein. Histograms are semi-quantifications of results from the left and other similar, independent experiments. Shown are means +/− standard deviations. P values for panels A and C are from Student-T tests.
    Stop Codon, supplied by Stratagene, used in various techniques. Bioz Stars score: 93/100, based on 2680 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stop codon/product/Stratagene
    Average 93 stars, based on 2680 article reviews
    Price from $9.99 to $1999.99
    stop codon - by Bioz Stars, 2020-11
    93/100 stars
      Buy from Supplier

    85
    Addgene inc gp78 amfr construct
    USP25 reduces levels of ubiquitinated endogenous proteins associated with HRD1 or <t>VCP/p97.</t> A–C) HEK-293 cells were transfected as indicated. 48 hours later cells were harvested and constructs were immunopurified with bead-bound anti-V5 antibody to isolate V5-HRD1-associated protein (panels A and B), or with bead-bound <t>anti-GFP</t> antibody to isolate GFP-VCP-associated proteins (panel C). We did not detect ubiquitin species in western blots from stringent, denature/renature immunoprecipitations of HRD1 or VCP/p97 using RIPA buffer (data not shown), indicating that the ubiquitin signal we observe in this figure is due to species associated with HRD1 or VCP/p97. Shown are western blots of inputs from whole cells lysates and from immunopurified protein. Histograms are semi-quantifications of results from the left and other similar, independent experiments. Shown are means +/− standard deviations. P values for panels A and C are from Student-T tests.
    Gp78 Amfr Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gp78 amfr construct/product/Addgene inc
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    gp78 amfr construct - by Bioz Stars, 2020-11
    85/100 stars
      Buy from Supplier

    88
    Mirus Bio lipid based transfection reagent
    Downregulation of torsinA inhibits retro-translocation of the cholera toxin A1-chain (a) Immunoblot showing > 95% suppression of torsinA expression in COS cells treated with siRNA 1958 or 1963 for torsinA, with scr. siRNA as control. (b c): (b) After siRNA <t>transfection</t> cells were intoxicated with wild-type CT for 45 min at 37°C and then fractionated into cytosolic and membrane components which were resolved by SDS-PAGE. Immunoblotting was carried out with antibodies to CTA1, CTB, BiP, β-actin and Hsp90. (c) Bar graph showing relative band densities of CTA1 in the cytosol normalized to Hsp90 in the cytosol, and CTA1 in the membrane fraction normalized to BiP. Results are shown as the mean of 3 experiments ± S.D.; * represents p
    Lipid Based Transfection Reagent, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 88/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lipid based transfection reagent/product/Mirus Bio
    Average 88 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    lipid based transfection reagent - by Bioz Stars, 2020-11
    88/100 stars
      Buy from Supplier

    99
    Qiagen qiagen maxi prep kit
    Downregulation of torsinA inhibits retro-translocation of the cholera toxin A1-chain (a) Immunoblot showing > 95% suppression of torsinA expression in COS cells treated with siRNA 1958 or 1963 for torsinA, with scr. siRNA as control. (b c): (b) After siRNA <t>transfection</t> cells were intoxicated with wild-type CT for 45 min at 37°C and then fractionated into cytosolic and membrane components which were resolved by SDS-PAGE. Immunoblotting was carried out with antibodies to CTA1, CTB, BiP, β-actin and Hsp90. (c) Bar graph showing relative band densities of CTA1 in the cytosol normalized to Hsp90 in the cytosol, and CTA1 in the membrane fraction normalized to BiP. Results are shown as the mean of 3 experiments ± S.D.; * represents p
    Qiagen Maxi Prep Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 617 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qiagen maxi prep kit/product/Qiagen
    Average 99 stars, based on 617 article reviews
    Price from $9.99 to $1999.99
    qiagen maxi prep kit - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    88
    Stratagene quickchange strategy
    Downregulation of torsinA inhibits retro-translocation of the cholera toxin A1-chain (a) Immunoblot showing > 95% suppression of torsinA expression in COS cells treated with siRNA 1958 or 1963 for torsinA, with scr. siRNA as control. (b c): (b) After siRNA <t>transfection</t> cells were intoxicated with wild-type CT for 45 min at 37°C and then fractionated into cytosolic and membrane components which were resolved by SDS-PAGE. Immunoblotting was carried out with antibodies to CTA1, CTB, BiP, β-actin and Hsp90. (c) Bar graph showing relative band densities of CTA1 in the cytosol normalized to Hsp90 in the cytosol, and CTA1 in the membrane fraction normalized to BiP. Results are shown as the mean of 3 experiments ± S.D.; * represents p
    Quickchange Strategy, supplied by Stratagene, used in various techniques. Bioz Stars score: 88/100, based on 141 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quickchange strategy/product/Stratagene
    Average 88 stars, based on 141 article reviews
    Price from $9.99 to $1999.99
    quickchange strategy - by Bioz Stars, 2020-11
    88/100 stars
      Buy from Supplier

    99
    Millipore sds polyacrylamide gels
    Downregulation of torsinA inhibits retro-translocation of the cholera toxin A1-chain (a) Immunoblot showing > 95% suppression of torsinA expression in COS cells treated with siRNA 1958 or 1963 for torsinA, with scr. siRNA as control. (b c): (b) After siRNA <t>transfection</t> cells were intoxicated with wild-type CT for 45 min at 37°C and then fractionated into cytosolic and membrane components which were resolved by SDS-PAGE. Immunoblotting was carried out with antibodies to CTA1, CTB, BiP, β-actin and Hsp90. (c) Bar graph showing relative band densities of CTA1 in the cytosol normalized to Hsp90 in the cytosol, and CTA1 in the membrane fraction normalized to BiP. Results are shown as the mean of 3 experiments ± S.D.; * represents p
    Sds Polyacrylamide Gels, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 10108 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sds polyacrylamide gels/product/Millipore
    Average 99 stars, based on 10108 article reviews
    Price from $9.99 to $1999.99
    sds polyacrylamide gels - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    93
    Mirus Bio transit 2020
    Downregulation of torsinA inhibits retro-translocation of the cholera toxin A1-chain (a) Immunoblot showing > 95% suppression of torsinA expression in COS cells treated with siRNA 1958 or 1963 for torsinA, with scr. siRNA as control. (b c): (b) After siRNA <t>transfection</t> cells were intoxicated with wild-type CT for 45 min at 37°C and then fractionated into cytosolic and membrane components which were resolved by SDS-PAGE. Immunoblotting was carried out with antibodies to CTA1, CTB, BiP, β-actin and Hsp90. (c) Bar graph showing relative band densities of CTA1 in the cytosol normalized to Hsp90 in the cytosol, and CTA1 in the membrane fraction normalized to BiP. Results are shown as the mean of 3 experiments ± S.D.; * represents p
    Transit 2020, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 93/100, based on 1142 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transit 2020/product/Mirus Bio
    Average 93 stars, based on 1142 article reviews
    Price from $9.99 to $1999.99
    transit 2020 - by Bioz Stars, 2020-11
    93/100 stars
      Buy from Supplier

    Image Search Results


    USP25 reduces levels of ubiquitinated endogenous proteins associated with HRD1 or VCP/p97. A–C) HEK-293 cells were transfected as indicated. 48 hours later cells were harvested and constructs were immunopurified with bead-bound anti-V5 antibody to isolate V5-HRD1-associated protein (panels A and B), or with bead-bound anti-GFP antibody to isolate GFP-VCP-associated proteins (panel C). We did not detect ubiquitin species in western blots from stringent, denature/renature immunoprecipitations of HRD1 or VCP/p97 using RIPA buffer (data not shown), indicating that the ubiquitin signal we observe in this figure is due to species associated with HRD1 or VCP/p97. Shown are western blots of inputs from whole cells lysates and from immunopurified protein. Histograms are semi-quantifications of results from the left and other similar, independent experiments. Shown are means +/− standard deviations. P values for panels A and C are from Student-T tests.

    Journal: PLoS ONE

    Article Title: Ubiquitin-Specific Protease 25 Functions in Endoplasmic Reticulum-Associated Degradation

    doi: 10.1371/journal.pone.0036542

    Figure Lengend Snippet: USP25 reduces levels of ubiquitinated endogenous proteins associated with HRD1 or VCP/p97. A–C) HEK-293 cells were transfected as indicated. 48 hours later cells were harvested and constructs were immunopurified with bead-bound anti-V5 antibody to isolate V5-HRD1-associated protein (panels A and B), or with bead-bound anti-GFP antibody to isolate GFP-VCP-associated proteins (panel C). We did not detect ubiquitin species in western blots from stringent, denature/renature immunoprecipitations of HRD1 or VCP/p97 using RIPA buffer (data not shown), indicating that the ubiquitin signal we observe in this figure is due to species associated with HRD1 or VCP/p97. Shown are western blots of inputs from whole cells lysates and from immunopurified protein. Histograms are semi-quantifications of results from the left and other similar, independent experiments. Shown are means +/− standard deviations. P values for panels A and C are from Student-T tests.

    Article Snippet: We thank Dr. Randy Pittman for HA-CD3δ and GFP-CFTRΔF508 constructs, Dr. Emmanuel Wiertz for HRD1 constructs, Dr. Fei Sun for the GP78/AMFR construct and Dr. Nico Dantuma for the GFP-VCP construct (Addgene ID: 23971).

    Techniques: Transfection, Construct, Western Blot

    Downregulation of torsinA inhibits retro-translocation of the cholera toxin A1-chain (a) Immunoblot showing > 95% suppression of torsinA expression in COS cells treated with siRNA 1958 or 1963 for torsinA, with scr. siRNA as control. (b c): (b) After siRNA transfection cells were intoxicated with wild-type CT for 45 min at 37°C and then fractionated into cytosolic and membrane components which were resolved by SDS-PAGE. Immunoblotting was carried out with antibodies to CTA1, CTB, BiP, β-actin and Hsp90. (c) Bar graph showing relative band densities of CTA1 in the cytosol normalized to Hsp90 in the cytosol, and CTA1 in the membrane fraction normalized to BiP. Results are shown as the mean of 3 experiments ± S.D.; * represents p

    Journal: Nature communications

    Article Title: TorsinA participates in endoplasmic reticulum-associated degradation

    doi: 10.1038/ncomms1383

    Figure Lengend Snippet: Downregulation of torsinA inhibits retro-translocation of the cholera toxin A1-chain (a) Immunoblot showing > 95% suppression of torsinA expression in COS cells treated with siRNA 1958 or 1963 for torsinA, with scr. siRNA as control. (b c): (b) After siRNA transfection cells were intoxicated with wild-type CT for 45 min at 37°C and then fractionated into cytosolic and membrane components which were resolved by SDS-PAGE. Immunoblotting was carried out with antibodies to CTA1, CTB, BiP, β-actin and Hsp90. (c) Bar graph showing relative band densities of CTA1 in the cytosol normalized to Hsp90 in the cytosol, and CTA1 in the membrane fraction normalized to BiP. Results are shown as the mean of 3 experiments ± S.D.; * represents p

    Article Snippet: After 24 h the cells were transfected with expression cassettes for GFP-CFTRΔF508 or pcDNA (negative control) and pcDNA-torsinAwt using a lipid-based transfection reagent: TransIT-2020, following the protocol of the manufacturer (Mirus Bio, WI).

    Techniques: Translocation Assay, Expressing, Transfection, SDS Page, CtB Assay

    Involvement of torsinA in degradation of GFP-CFTRΔF508 (a) 293T cells transfected with an expression cassette for GFP-CFTRΔF508 and 48 h later cell lysates were immunoprecipitated with IgG or antibodies to CFTR or torsinA, followed by SDS-PAGE and immunoblotting for GFP and torsinA. (b c): (b) 293T cells were co-transfected with expression cassettes for GFP-CFTRΔF508 or torsinA or torsinAΔE or torsinAΔC or with the control cassette, pcDNA 3.1. Twenty-four h later samples were treated or not with MG132 for 16 h. Seventy-two h post-transfection, cell lysates were processed by SDS-PAGE and gels immunoblotted with antibodies to GFP, torsinA and β-actin. Representative immunoblots are shown with short (1 min) and long (3 min) exposures for GFP, and with 3 min exposure for torsinA and β-actin. (c) GFP-CFTRΔF508 band densities were normalized to those of torsinA and β-actin and represented as the mean of 3 experiments ± S.D. For statistical comparisons, * denotes the comparisons of control to torsinA or torsinAΔE or torsinAΔC transfections (p,

    Journal: Nature communications

    Article Title: TorsinA participates in endoplasmic reticulum-associated degradation

    doi: 10.1038/ncomms1383

    Figure Lengend Snippet: Involvement of torsinA in degradation of GFP-CFTRΔF508 (a) 293T cells transfected with an expression cassette for GFP-CFTRΔF508 and 48 h later cell lysates were immunoprecipitated with IgG or antibodies to CFTR or torsinA, followed by SDS-PAGE and immunoblotting for GFP and torsinA. (b c): (b) 293T cells were co-transfected with expression cassettes for GFP-CFTRΔF508 or torsinA or torsinAΔE or torsinAΔC or with the control cassette, pcDNA 3.1. Twenty-four h later samples were treated or not with MG132 for 16 h. Seventy-two h post-transfection, cell lysates were processed by SDS-PAGE and gels immunoblotted with antibodies to GFP, torsinA and β-actin. Representative immunoblots are shown with short (1 min) and long (3 min) exposures for GFP, and with 3 min exposure for torsinA and β-actin. (c) GFP-CFTRΔF508 band densities were normalized to those of torsinA and β-actin and represented as the mean of 3 experiments ± S.D. For statistical comparisons, * denotes the comparisons of control to torsinA or torsinAΔE or torsinAΔC transfections (p,

    Article Snippet: After 24 h the cells were transfected with expression cassettes for GFP-CFTRΔF508 or pcDNA (negative control) and pcDNA-torsinAwt using a lipid-based transfection reagent: TransIT-2020, following the protocol of the manufacturer (Mirus Bio, WI).

    Techniques: Transfection, Expressing, Immunoprecipitation, SDS Page, Western Blot