99
|
Transnetyx
genotyping Genotyping, supplied by Transnetyx, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/bio_rxiv__64898__2026__04__08__717296-267-0-11?v=Transnetyx Average 99 stars, based on 1 article reviews
genotyping - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
96
|
Fujirebio Inc
inno lipa hpv genotyping extra ii Inno Lipa Hpv Genotyping Extra Ii, supplied by Fujirebio Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/nct04167501-15-5-10?v=Fujirebio+Inc Average 96 stars, based on 1 article reviews
inno lipa hpv genotyping extra ii - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
86
|
Eurofins
lck cre fw tgcaacgagtgatgaggttc eurofins genotyping Lck Cre Fw Tgcaacgagtgatgaggttc Eurofins Genotyping, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/pm40460200-785-123-126?v=Eurofins Average 86 stars, based on 1 article reviews
lck cre fw tgcaacgagtgatgaggttc eurofins genotyping - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
96
|
Roche
kapa mouse genotyping kit Kapa Mouse Genotyping Kit, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/10__1161_slash_atvbaha__120__314557-136-10-16?v=Roche Average 96 stars, based on 1 article reviews
kapa mouse genotyping kit - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
92
|
MACHEREY NAGEL
dna nucleotype mouse pcr direct kit for genotyping Dna Nucleotype Mouse Pcr Direct Kit For Genotyping, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/pmc11083572-32-6-14?v=MACHEREY+NAGEL Average 92 stars, based on 1 article reviews
dna nucleotype mouse pcr direct kit for genotyping - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
99
|
tiangen biotech co
genotyping Genotyping, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/pmc11738785-65-1-14?v=tiangen+biotech+co Average 99 stars, based on 1 article reviews
genotyping - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
94
|
Thermo Fisher
genotyping lpin rs13412852 Genotyping Lpin Rs13412852, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/pm41751781-159-0-12?v=Thermo+Fisher Average 94 stars, based on 1 article reviews
genotyping lpin rs13412852 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
94
|
Thermo Fisher
il7 rs16906115 genotyping Il7 Rs16906115 Genotyping, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/pm41753174-81-0-14?v=Thermo+Fisher Average 94 stars, based on 1 article reviews
il7 rs16906115 genotyping - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
99
|
tiangen biotech co
tianexact genotyping qpcr premix probe Tianexact Genotyping Qpcr Premix Probe, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/pmc08232870-83-4-11?v=tiangen+biotech+co Average 99 stars, based on 1 article reviews
tianexact genotyping qpcr premix probe - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
95
|
Roche
kapa2g fast hotstart pcr kit Kapa2g Fast Hotstart Pcr Kit, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/pm31331770-75-37-42?v=Roche Average 95 stars, based on 1 article reviews
kapa2g fast hotstart pcr kit - by Bioz Stars,
2026-08
95/100 stars
|
Buy from Supplier |
94
|
fluidigm
96 96 dynamic arraytm ifc 96 96 Dynamic Arraytm Ifc, supplied by fluidigm, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/genotyping/us10227624-224-11-10?v=fluidigm Average 94 stars, based on 1 article reviews
96 96 dynamic arraytm ifc - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |