genotyping Search Results


99
Transnetyx genotyping
Genotyping, supplied by Transnetyx, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/bio_rxiv__64898__2026__04__08__717296-267-0-11?v=Transnetyx
Average 99 stars, based on 1 article reviews
genotyping - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

96
Fujirebio Inc inno lipa hpv genotyping extra ii
Inno Lipa Hpv Genotyping Extra Ii, supplied by Fujirebio Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/nct04167501-15-5-10?v=Fujirebio+Inc
Average 96 stars, based on 1 article reviews
inno lipa hpv genotyping extra ii - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

86
Eurofins lck cre fw tgcaacgagtgatgaggttc eurofins genotyping
Lck Cre Fw Tgcaacgagtgatgaggttc Eurofins Genotyping, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/pm40460200-785-123-126?v=Eurofins
Average 86 stars, based on 1 article reviews
lck cre fw tgcaacgagtgatgaggttc eurofins genotyping - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

96
Roche kapa mouse genotyping kit
Kapa Mouse Genotyping Kit, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/10__1161_slash_atvbaha__120__314557-136-10-16?v=Roche
Average 96 stars, based on 1 article reviews
kapa mouse genotyping kit - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

92
MACHEREY NAGEL dna nucleotype mouse pcr direct kit for genotyping
Dna Nucleotype Mouse Pcr Direct Kit For Genotyping, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/pmc11083572-32-6-14?v=MACHEREY+NAGEL
Average 92 stars, based on 1 article reviews
dna nucleotype mouse pcr direct kit for genotyping - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

99
tiangen biotech co genotyping
Genotyping, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/pmc11738785-65-1-14?v=tiangen+biotech+co
Average 99 stars, based on 1 article reviews
genotyping - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

94
Thermo Fisher genotyping lpin rs13412852
Genotyping Lpin Rs13412852, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/pm41751781-159-0-12?v=Thermo+Fisher
Average 94 stars, based on 1 article reviews
genotyping lpin rs13412852 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
Thermo Fisher il7 rs16906115 genotyping
Il7 Rs16906115 Genotyping, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/pm41753174-81-0-14?v=Thermo+Fisher
Average 94 stars, based on 1 article reviews
il7 rs16906115 genotyping - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

99
tiangen biotech co tianexact genotyping qpcr premix probe
Tianexact Genotyping Qpcr Premix Probe, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/pmc08232870-83-4-11?v=tiangen+biotech+co
Average 99 stars, based on 1 article reviews
tianexact genotyping qpcr premix probe - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

95
Roche kapa2g fast hotstart pcr kit
Kapa2g Fast Hotstart Pcr Kit, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/pm31331770-75-37-42?v=Roche
Average 95 stars, based on 1 article reviews
kapa2g fast hotstart pcr kit - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

94
fluidigm 96 96 dynamic arraytm ifc
96 96 Dynamic Arraytm Ifc, supplied by fluidigm, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/genotyping/us10227624-224-11-10?v=fluidigm
Average 94 stars, based on 1 article reviews
96 96 dynamic arraytm ifc - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

Image Search Results