|
Transnetyx
routine genotyping Routine Genotyping, supplied by Transnetyx, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/routine genotyping/product/Transnetyx Average 99 stars, based on 1 article reviews
routine genotyping - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
|
Vazyme Biotech Co
one step mouse genotyping kit ![]() One Step Mouse Genotyping Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/one step mouse genotyping kit/product/Vazyme Biotech Co Average 96 stars, based on 1 article reviews
one step mouse genotyping kit - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Eurofins
lck cre fw tgcaacgagtgatgaggttc eurofins genotyping ![]() Lck Cre Fw Tgcaacgagtgatgaggttc Eurofins Genotyping, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lck cre fw tgcaacgagtgatgaggttc eurofins genotyping/product/Eurofins Average 86 stars, based on 1 article reviews
lck cre fw tgcaacgagtgatgaggttc eurofins genotyping - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
tiangen biotech co
tianexact genotyping qpcr premix probe ![]() Tianexact Genotyping Qpcr Premix Probe, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tianexact genotyping qpcr premix probe/product/tiangen biotech co Average 99 stars, based on 1 article reviews
tianexact genotyping qpcr premix probe - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
|
MACHEREY NAGEL
dna nucleotype mouse pcr direct kit for genotyping ![]() Dna Nucleotype Mouse Pcr Direct Kit For Genotyping, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dna nucleotype mouse pcr direct kit for genotyping/product/MACHEREY NAGEL Average 92 stars, based on 1 article reviews
dna nucleotype mouse pcr direct kit for genotyping - by Bioz Stars,
2026-06
92/100 stars
|
Buy from Supplier |
|
Roche
kapa mouse genotyping kit ![]() Kapa Mouse Genotyping Kit, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/kapa mouse genotyping kit/product/Roche Average 96 stars, based on 1 article reviews
kapa mouse genotyping kit - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Roche
kapa hotstart 388 mouse genotyping kit ![]() Kapa Hotstart 388 Mouse Genotyping Kit, supplied by Roche, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/kapa hotstart 388 mouse genotyping kit/product/Roche Average 96 stars, based on 1 article reviews
kapa hotstart 388 mouse genotyping kit - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
myPOLS Biotec
directblood genotyping pcr kit ![]() Directblood Genotyping Pcr Kit, supplied by myPOLS Biotec, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/directblood genotyping pcr kit/product/myPOLS Biotec Average 92 stars, based on 1 article reviews
directblood genotyping pcr kit - by Bioz Stars,
2026-06
92/100 stars
|
Buy from Supplier |
|
MACHEREY NAGEL
nucleotype plant pcr kit ![]() Nucleotype Plant Pcr Kit, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nucleotype plant pcr kit/product/MACHEREY NAGEL Average 93 stars, based on 1 article reviews
nucleotype plant pcr kit - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
fluidigm
96 96 dynamic arraytm ifc ![]() 96 96 Dynamic Arraytm Ifc, supplied by fluidigm, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/96 96 dynamic arraytm ifc/product/fluidigm Average 94 stars, based on 1 article reviews
96 96 dynamic arraytm ifc - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
|
Fujirebio Inc
innolipa hla typing kit ![]() Innolipa Hla Typing Kit, supplied by Fujirebio Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/innolipa hla typing kit/product/Fujirebio Inc Average 96 stars, based on 1 article reviews
innolipa hla typing kit - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Roche
kapa2g fast hotstart pcr kit ![]() Kapa2g Fast Hotstart Pcr Kit, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/kapa2g fast hotstart pcr kit/product/Roche Average 95 stars, based on 1 article reviews
kapa2g fast hotstart pcr kit - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
Image Search Results
Journal: The FASEB Journal
Article Title: ChREBP ‐β Exacerbates Renal Tubular Disorders Caused by Fructose via ATF4
doi: 10.1096/fj.202600490R
Figure Lengend Snippet: Effects of ChREBP‐β renal tubular‐specific overexpression on the kidney of mice. (A) Schematic demonstration. (B) Representative demonstration for PCR‐based genotyping. (C) Real time PCR analysis for ChREBP‐β overexpression efficiency in the kidney. (D,E) GTT of mice and the area under the curve statistics. (F) Representative images of HE and Tunel‐stained kidney sections. Scale bars = 100 μm. (G) Representative TEM images showing the brush border area in the kidneys of mice. Scale bars = 1 μm. n = 6; all data are expressed as mean ± SD. * p < 0.05.
Article Snippet: DNA extraction was performed using the
Techniques: Over Expression, Real-time Polymerase Chain Reaction, TUNEL Assay, Staining