genomic pcr Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore pcr analysis genomic dna
    Tamoxifen induced deletion of FAK. A, Genomic <t>DNA</t> of wild‐type (WT) and Cre‐positive floxed FAK mice were amplified by <t>PCR.</t> The WT band is 1.4 kb, the floxed FAK product is 1.6 kb and the postrecombination product is 550 bp. DNA was extracted from cardiac tissue unless otherwise noted. FAK C, Cre‐positive floxed‐FAK mouse not treated with tamoxifen; Sk M, skeletal muscle. B, Representative Western blot showing FAK protein expression in lysates of isolated adult cardiac ventricular myocytes from wild‐type (WT), experimental control (Exp C), and FAK KO mice. C, Normalized integrated intensity data for myocyte FAK expression in WT, Exp C and FAK KO mice. FAK expression in FAK KO mice was reduced by 66.5% compared to WT mice ( P ≤0.001; n=7 hearts, both groups) and by 73% compared to Exp C mice ( P ≤0.001; n=5 hearts [Exp C], n=7 hearts [FAK KO]). Numbers within bars indicate sample size of each group. Exp C indicates experimental control; FAK, focal adhesion kinase; KO, knock out; PCR, polymerase chain reaction.
    Pcr Analysis Genomic Dna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr analysis genomic dna/product/Millipore
    Average 99 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    pcr analysis genomic dna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    Toyobo genomic polymerase chain reaction pcr
    Tamoxifen induced deletion of FAK. A, Genomic <t>DNA</t> of wild‐type (WT) and Cre‐positive floxed FAK mice were amplified by <t>PCR.</t> The WT band is 1.4 kb, the floxed FAK product is 1.6 kb and the postrecombination product is 550 bp. DNA was extracted from cardiac tissue unless otherwise noted. FAK C, Cre‐positive floxed‐FAK mouse not treated with tamoxifen; Sk M, skeletal muscle. B, Representative Western blot showing FAK protein expression in lysates of isolated adult cardiac ventricular myocytes from wild‐type (WT), experimental control (Exp C), and FAK KO mice. C, Normalized integrated intensity data for myocyte FAK expression in WT, Exp C and FAK KO mice. FAK expression in FAK KO mice was reduced by 66.5% compared to WT mice ( P ≤0.001; n=7 hearts, both groups) and by 73% compared to Exp C mice ( P ≤0.001; n=5 hearts [Exp C], n=7 hearts [FAK KO]). Numbers within bars indicate sample size of each group. Exp C indicates experimental control; FAK, focal adhesion kinase; KO, knock out; PCR, polymerase chain reaction.
    Genomic Polymerase Chain Reaction Pcr, supplied by Toyobo, used in various techniques. Bioz Stars score: 86/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic polymerase chain reaction pcr/product/Toyobo
    Average 86 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    genomic polymerase chain reaction pcr - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    85
    Quest Diagnostics polymerase chain reaction amplified genomic dna
    Tamoxifen induced deletion of FAK. A, Genomic <t>DNA</t> of wild‐type (WT) and Cre‐positive floxed FAK mice were amplified by <t>PCR.</t> The WT band is 1.4 kb, the floxed FAK product is 1.6 kb and the postrecombination product is 550 bp. DNA was extracted from cardiac tissue unless otherwise noted. FAK C, Cre‐positive floxed‐FAK mouse not treated with tamoxifen; Sk M, skeletal muscle. B, Representative Western blot showing FAK protein expression in lysates of isolated adult cardiac ventricular myocytes from wild‐type (WT), experimental control (Exp C), and FAK KO mice. C, Normalized integrated intensity data for myocyte FAK expression in WT, Exp C and FAK KO mice. FAK expression in FAK KO mice was reduced by 66.5% compared to WT mice ( P ≤0.001; n=7 hearts, both groups) and by 73% compared to Exp C mice ( P ≤0.001; n=5 hearts [Exp C], n=7 hearts [FAK KO]). Numbers within bars indicate sample size of each group. Exp C indicates experimental control; FAK, focal adhesion kinase; KO, knock out; PCR, polymerase chain reaction.
    Polymerase Chain Reaction Amplified Genomic Dna, supplied by Quest Diagnostics, used in various techniques. Bioz Stars score: 85/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction amplified genomic dna/product/Quest Diagnostics
    Average 85 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction amplified genomic dna - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    94
    Gentra Systems polymerase chain reaction a genomic dna purification kit
    Tamoxifen induced deletion of FAK. A, Genomic <t>DNA</t> of wild‐type (WT) and Cre‐positive floxed FAK mice were amplified by <t>PCR.</t> The WT band is 1.4 kb, the floxed FAK product is 1.6 kb and the postrecombination product is 550 bp. DNA was extracted from cardiac tissue unless otherwise noted. FAK C, Cre‐positive floxed‐FAK mouse not treated with tamoxifen; Sk M, skeletal muscle. B, Representative Western blot showing FAK protein expression in lysates of isolated adult cardiac ventricular myocytes from wild‐type (WT), experimental control (Exp C), and FAK KO mice. C, Normalized integrated intensity data for myocyte FAK expression in WT, Exp C and FAK KO mice. FAK expression in FAK KO mice was reduced by 66.5% compared to WT mice ( P ≤0.001; n=7 hearts, both groups) and by 73% compared to Exp C mice ( P ≤0.001; n=5 hearts [Exp C], n=7 hearts [FAK KO]). Numbers within bars indicate sample size of each group. Exp C indicates experimental control; FAK, focal adhesion kinase; KO, knock out; PCR, polymerase chain reaction.
    Polymerase Chain Reaction A Genomic Dna Purification Kit, supplied by Gentra Systems, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction a genomic dna purification kit/product/Gentra Systems
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction a genomic dna purification kit - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    95
    Roche polymerase chain reaction pcr genomic dna
    Agarose gel electrophoresis of <t>PCR</t> assay for the identification of Erysipelothrix rhusiopathiae. Lane 1: 100bp <t>DNA</t> marker; Lanes 2–8 and 11: positive samples; Lanes 10: negative control; Lane 12: Erysipelothrix rhusiopathiae ATCC 19414 as positive control.
    Polymerase Chain Reaction Pcr Genomic Dna, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr genomic dna/product/Roche
    Average 95 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr genomic dna - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    92
    Real Biotech Corporation polymerase chain reaction genomic dna
    Agarose gel electrophoresis of <t>PCR</t> assay for the identification of Erysipelothrix rhusiopathiae. Lane 1: 100bp <t>DNA</t> marker; Lanes 2–8 and 11: positive samples; Lanes 10: negative control; Lane 12: Erysipelothrix rhusiopathiae ATCC 19414 as positive control.
    Polymerase Chain Reaction Genomic Dna, supplied by Real Biotech Corporation, used in various techniques. Bioz Stars score: 92/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction genomic dna/product/Real Biotech Corporation
    Average 92 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction genomic dna - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    86
    TaKaRa polymerase chain reaction pcr genomic dna
    Agarose gel electrophoresis of <t>PCR</t> assay for the identification of Erysipelothrix rhusiopathiae. Lane 1: 100bp <t>DNA</t> marker; Lanes 2–8 and 11: positive samples; Lanes 10: negative control; Lane 12: Erysipelothrix rhusiopathiae ATCC 19414 as positive control.
    Polymerase Chain Reaction Pcr Genomic Dna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 86/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr genomic dna/product/TaKaRa
    Average 86 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr genomic dna - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    87
    Agilent technologies polymerase chain reaction genomic dna
    Agarose gel electrophoresis of <t>PCR</t> assay for the identification of Erysipelothrix rhusiopathiae. Lane 1: 100bp <t>DNA</t> marker; Lanes 2–8 and 11: positive samples; Lanes 10: negative control; Lane 12: Erysipelothrix rhusiopathiae ATCC 19414 as positive control.
    Polymerase Chain Reaction Genomic Dna, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 87/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction genomic dna/product/Agilent technologies
    Average 87 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction genomic dna - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    86
    tiangen biotech co polymerase chain reaction genomic dna
    Agarose gel electrophoresis of <t>PCR</t> assay for the identification of Erysipelothrix rhusiopathiae. Lane 1: 100bp <t>DNA</t> marker; Lanes 2–8 and 11: positive samples; Lanes 10: negative control; Lane 12: Erysipelothrix rhusiopathiae ATCC 19414 as positive control.
    Polymerase Chain Reaction Genomic Dna, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 86/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction genomic dna/product/tiangen biotech co
    Average 86 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction genomic dna - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    92
    Bioneer Corporation polymerase chain reaction genomic dna
    Agarose gel electrophoresis of <t>PCR</t> assay for the identification of Erysipelothrix rhusiopathiae. Lane 1: 100bp <t>DNA</t> marker; Lanes 2–8 and 11: positive samples; Lanes 10: negative control; Lane 12: Erysipelothrix rhusiopathiae ATCC 19414 as positive control.
    Polymerase Chain Reaction Genomic Dna, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 92/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction genomic dna/product/Bioneer Corporation
    Average 92 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction genomic dna - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    84
    Molecular Research Center inc polymerase chain reaction genomic dna
    Agarose gel electrophoresis of <t>PCR</t> assay for the identification of Erysipelothrix rhusiopathiae. Lane 1: 100bp <t>DNA</t> marker; Lanes 2–8 and 11: positive samples; Lanes 10: negative control; Lane 12: Erysipelothrix rhusiopathiae ATCC 19414 as positive control.
    Polymerase Chain Reaction Genomic Dna, supplied by Molecular Research Center inc, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction genomic dna/product/Molecular Research Center inc
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction genomic dna - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    94
    tiangen biotech co polymerase chain reaction amplification genomic dna
    Agarose gel electrophoresis of <t>PCR</t> assay for the identification of Erysipelothrix rhusiopathiae. Lane 1: 100bp <t>DNA</t> marker; Lanes 2–8 and 11: positive samples; Lanes 10: negative control; Lane 12: Erysipelothrix rhusiopathiae ATCC 19414 as positive control.
    Polymerase Chain Reaction Amplification Genomic Dna, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 94/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction amplification genomic dna/product/tiangen biotech co
    Average 94 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction amplification genomic dna - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    88
    GE Healthcare polymerase chain reaction genomic dna extraction
    Agarose gel electrophoresis of <t>PCR</t> assay for the identification of Erysipelothrix rhusiopathiae. Lane 1: 100bp <t>DNA</t> marker; Lanes 2–8 and 11: positive samples; Lanes 10: negative control; Lane 12: Erysipelothrix rhusiopathiae ATCC 19414 as positive control.
    Polymerase Chain Reaction Genomic Dna Extraction, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 88/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction genomic dna extraction/product/GE Healthcare
    Average 88 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction genomic dna extraction - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    92
    Gentra Systems genomic polymerase chain reaction pcr genomic dna
    Analysis of HepG2 cells containing the 4CYPs-POR MAC. (A) Flowchart of the MAC transfer from donor CHO cells to recipient HepG2 cells via MMCT method, which comprises the following steps: micronucleation of donor cells by colcemid, enucleation by cytochalasin B, and microcell purification and fusion with recipient HepG2 cells. HepG2 hybrids were selected with 400 μg/mL G418 and picked for clonal expansion. (B) G418-resistant clones are screened by genomic <t>PCR</t> to determine the presence of the 4CYPs-POR transgene. (C) Representative metaphase fluorescence in situ hybridization images of TC-HepG2 cells. Digoxigenin-labeled mouse cot-1 <t>DNA</t> (red) was used to detect the MAC. Biotin-labeled pPAC-4CYPs-POR (green) was used to detect the 4CYPs-POR cassette in the MAC. Chromosomal DNA was counterstained with DAPI. White arrows indicate MAC vectors, and the inset shows an enlarged image of the MAC.
    Genomic Polymerase Chain Reaction Pcr Genomic Dna, supplied by Gentra Systems, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic polymerase chain reaction pcr genomic dna/product/Gentra Systems
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    genomic polymerase chain reaction pcr genomic dna - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    92
    TaKaRa polymerase chain reaction pcr amplification genomic dna
    Agarose gel electrophoresis of Neovison vison DQA gene amplification. M: DL2000 <t>DNA</t> marker; ( 1) <t>PCR</t> product with primer pair F1U/F1L; (2) PCR Product with primer pair F2U/F2L; and (3) PCR product with primer pair F3U/F3L.
    Polymerase Chain Reaction Pcr Amplification Genomic Dna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction pcr amplification genomic dna/product/TaKaRa
    Average 92 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction pcr amplification genomic dna - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    93
    Roche polymerase chain reaction amplification genomic dna
    Agarose gel electrophoresis of Neovison vison DQA gene amplification. M: DL2000 <t>DNA</t> marker; ( 1) <t>PCR</t> product with primer pair F1U/F1L; (2) PCR Product with primer pair F2U/F2L; and (3) PCR product with primer pair F3U/F3L.
    Polymerase Chain Reaction Amplification Genomic Dna, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction amplification genomic dna/product/Roche
    Average 93 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction amplification genomic dna - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    86
    TransGen biotech co polymerase chain reaction amplification genomic dna
    Agarose gel electrophoresis of Neovison vison DQA gene amplification. M: DL2000 <t>DNA</t> marker; ( 1) <t>PCR</t> product with primer pair F1U/F1L; (2) PCR Product with primer pair F2U/F2L; and (3) PCR product with primer pair F3U/F3L.
    Polymerase Chain Reaction Amplification Genomic Dna, supplied by TransGen biotech co, used in various techniques. Bioz Stars score: 86/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction amplification genomic dna/product/TransGen biotech co
    Average 86 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction amplification genomic dna - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    92
    srl inc e polymerase chain reaction direct dna sequencing genomic dna extraction
    Agarose gel electrophoresis of Neovison vison DQA gene amplification. M: DL2000 <t>DNA</t> marker; ( 1) <t>PCR</t> product with primer pair F1U/F1L; (2) PCR Product with primer pair F2U/F2L; and (3) PCR product with primer pair F3U/F3L.
    E Polymerase Chain Reaction Direct Dna Sequencing Genomic Dna Extraction, supplied by srl inc, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e polymerase chain reaction direct dna sequencing genomic dna extraction/product/srl inc
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    e polymerase chain reaction direct dna sequencing genomic dna extraction - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    92
    Transnetyx genomic pcr
    Agarose gel electrophoresis of Neovison vison DQA gene amplification. M: DL2000 <t>DNA</t> marker; ( 1) <t>PCR</t> product with primer pair F1U/F1L; (2) PCR Product with primer pair F2U/F2L; and (3) PCR product with primer pair F3U/F3L.
    Genomic Pcr, supplied by Transnetyx, used in various techniques. Bioz Stars score: 92/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic pcr/product/Transnetyx
    Average 92 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    genomic pcr - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    87
    Illumina Inc genomic pcr primer
    Agarose gel electrophoresis of Neovison vison DQA gene amplification. M: DL2000 <t>DNA</t> marker; ( 1) <t>PCR</t> product with primer pair F1U/F1L; (2) PCR Product with primer pair F2U/F2L; and (3) PCR product with primer pair F3U/F3L.
    Genomic Pcr Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 87/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic pcr primer/product/Illumina Inc
    Average 87 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    genomic pcr primer - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    90
    TaKaRa genomic pcr genomic pcr
    Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the <t>PCR-based</t> methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, <t>Msp</t> I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.
    Genomic Pcr Genomic Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic pcr genomic pcr/product/TaKaRa
    Average 90 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    genomic pcr genomic pcr - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    84
    Roche genomic pcr genomic pcr
    Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the <t>PCR-based</t> methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, <t>Msp</t> I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.
    Genomic Pcr Genomic Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 84/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic pcr genomic pcr/product/Roche
    Average 84 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    genomic pcr genomic pcr - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    86
    Becton Dickinson advantage genomic pcr kit
    Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the <t>PCR-based</t> methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, <t>Msp</t> I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.
    Advantage Genomic Pcr Kit, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 86/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/advantage genomic pcr kit/product/Becton Dickinson
    Average 86 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    advantage genomic pcr kit - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    94
    Thermo Fisher genomic pcr
    Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the <t>PCR-based</t> methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, <t>Msp</t> I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.
    Genomic Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 341 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic pcr/product/Thermo Fisher
    Average 94 stars, based on 341 article reviews
    Price from $9.99 to $1999.99
    genomic pcr - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    95
    Retrogen genomic pcr
    Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the <t>PCR-based</t> methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, <t>Msp</t> I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.
    Genomic Pcr, supplied by Retrogen, used in various techniques. Bioz Stars score: 95/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic pcr/product/Retrogen
    Average 95 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    genomic pcr - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    85
    Millipore red genomic template pcr system
    Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the <t>PCR-based</t> methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, <t>Msp</t> I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.
    Red Genomic Template Pcr System, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/red genomic template pcr system/product/Millipore
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    red genomic template pcr system - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    99
    Millipore long template genomic pcr
    Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the <t>PCR-based</t> methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, <t>Msp</t> I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.
    Long Template Genomic Pcr, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long template genomic pcr/product/Millipore
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    long template genomic pcr - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    90
    TaKaRa genome walker pcr
    RNA-Sequencing analysis of <t>GhABF2</t> -overexpressing cotton leaves transcriptome. ( a ) Changes in gene expression profile between control, OE17, and OE18. DEGs, differently expressed genes. vs, versus. The red bar represents up-regulated gene, and the green bar represents down-regulated gene. ( b ) Venn diagram of DEGs in cotton seedling leaves between OE17 vs OE18 and different abiotic stress conditions. The DEGs data response to ABA, drought, and salt treatment were extracted from GEO at NCBI (accession number GSE50770). ( c ) Heatmap of the part of 68 DEGs. TF, transcription factor. OR, oxidation reduction. CB, chlorophyll biosynthetic. ( d ) Expression of TF genes by <t>qRT-PCR.</t> Values are means ± SD of three replicates. * P ≤ 0.01, ** P ≤ 0.01; Student t test.
    Genome Walker Pcr, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genome walker pcr/product/TaKaRa
    Average 90 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    genome walker pcr - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    99
    TaKaRa pcr select bacterial genomic subtraction kit
    <t>RT-PCR</t> analysis of the TC genes of Y. <t>enterocolitica</t> T83. Expression of tcbA (lanes 2 to 7), tcaC (lanes 8 to 13), and tccC (lanes 14 to 19) was assessed at 30°C (lanes 2, 8, and 14) and at 37°C (lanes 4, 10, and 16). Lanes: 1 and 20,
    Pcr Select Bacterial Genomic Subtraction Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 67 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr select bacterial genomic subtraction kit/product/TaKaRa
    Average 99 stars, based on 67 article reviews
    Price from $9.99 to $1999.99
    pcr select bacterial genomic subtraction kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    84
    Becton Dickinson genomic dna pcr kit
    <t>RT-PCR</t> analysis of the TC genes of Y. <t>enterocolitica</t> T83. Expression of tcbA (lanes 2 to 7), tcaC (lanes 8 to 13), and tccC (lanes 14 to 19) was assessed at 30°C (lanes 2, 8, and 14) and at 37°C (lanes 4, 10, and 16). Lanes: 1 and 20,
    Genomic Dna Pcr Kit, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 84/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna pcr kit/product/Becton Dickinson
    Average 84 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    genomic dna pcr kit - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    86
    Roche genomic pcr amplification genomic long pcr
    Generation of Xb130 −/− mice. A. Schematic strategy of xb130 gene targeting. Structure of Xb130 gene (5′ part), targeting construct, targeted allele and final knockout allele are shown (Empty Boxes: exons; S: SacI; B: BamHI, Filled boxes: Sites for Southern blot probes). Homologous recombination of ES cell genomic DNA with targeting construct inserts Loxp and Frt sites flanking an 879 bp region including Exon 7 and a floxed neomycin cassette. The deletion of Exon 7 causes a frame shift mutation and translation termination in Exon 8. B. Southern blotting with 3′ probe. Mice were derived from Xb130 +/− progeny. C. Western blotting. Protein lysates were extracted from spleen and lung tissues of Xb130 +/+ , Xb130 +/− and Xb130 −/− mice that were genotyped by Southern blotting. D. <t>PCR</t> based genotyping . Arrows indicate the location of primers used for PCR amplification. PCR product amplified from <t>F1</t> and R1 in WT allele was undetectable due to competition from short product F2/R1. E. RT-PCR. The exons of RT-PCR products from WT (a) and knockout (b and c) mice are indicated based on sequencing data. Red stars indicate induced in-frame stop codons. F. Predicted Xb130 knockout allele based on RT-PCR and genomic PCR data. The primers used for long PCR and the amplicon are indicated as arrows and green line respectively.
    Genomic Pcr Amplification Genomic Long Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic pcr amplification genomic long pcr/product/Roche
    Average 86 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    genomic pcr amplification genomic long pcr - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    Tamoxifen induced deletion of FAK. A, Genomic DNA of wild‐type (WT) and Cre‐positive floxed FAK mice were amplified by PCR. The WT band is 1.4 kb, the floxed FAK product is 1.6 kb and the postrecombination product is 550 bp. DNA was extracted from cardiac tissue unless otherwise noted. FAK C, Cre‐positive floxed‐FAK mouse not treated with tamoxifen; Sk M, skeletal muscle. B, Representative Western blot showing FAK protein expression in lysates of isolated adult cardiac ventricular myocytes from wild‐type (WT), experimental control (Exp C), and FAK KO mice. C, Normalized integrated intensity data for myocyte FAK expression in WT, Exp C and FAK KO mice. FAK expression in FAK KO mice was reduced by 66.5% compared to WT mice ( P ≤0.001; n=7 hearts, both groups) and by 73% compared to Exp C mice ( P ≤0.001; n=5 hearts [Exp C], n=7 hearts [FAK KO]). Numbers within bars indicate sample size of each group. Exp C indicates experimental control; FAK, focal adhesion kinase; KO, knock out; PCR, polymerase chain reaction.

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: Conditional Knockout of Myocyte Focal Adhesion Kinase Abrogates Ischemic Preconditioning in Adult Murine Hearts

    doi: 10.1161/JAHA.113.000457

    Figure Lengend Snippet: Tamoxifen induced deletion of FAK. A, Genomic DNA of wild‐type (WT) and Cre‐positive floxed FAK mice were amplified by PCR. The WT band is 1.4 kb, the floxed FAK product is 1.6 kb and the postrecombination product is 550 bp. DNA was extracted from cardiac tissue unless otherwise noted. FAK C, Cre‐positive floxed‐FAK mouse not treated with tamoxifen; Sk M, skeletal muscle. B, Representative Western blot showing FAK protein expression in lysates of isolated adult cardiac ventricular myocytes from wild‐type (WT), experimental control (Exp C), and FAK KO mice. C, Normalized integrated intensity data for myocyte FAK expression in WT, Exp C and FAK KO mice. FAK expression in FAK KO mice was reduced by 66.5% compared to WT mice ( P ≤0.001; n=7 hearts, both groups) and by 73% compared to Exp C mice ( P ≤0.001; n=5 hearts [Exp C], n=7 hearts [FAK KO]). Numbers within bars indicate sample size of each group. Exp C indicates experimental control; FAK, focal adhesion kinase; KO, knock out; PCR, polymerase chain reaction.

    Article Snippet: PCR Analysis Genomic DNA was extracted from cardiac and extra‐cardiac tissues using the REDExtract‐N‐Amp Tissue PCR Kit (Sigma‐Aldrich) and subjected to polymerase chain reaction (PCR) using the forward (GCTGATGTCCCAAGCTATTCC) and reverse (AGGGCTGGTCTGCGCTGACAGG) primers.

    Techniques: Mouse Assay, Amplification, Polymerase Chain Reaction, Western Blot, Expressing, Isolation, Knock-Out

    Southern blot analysis of total genomic DNA undigested and digested with either HindIII and PstI from the S. thermophilus strains resistant to tetracycline (A) and erythromycin (B) , respectively. As a probe, internal segments of tet (S) (in A ) and ermB (in B ) genes obtained by specific PCR and labeled with digoxigenin (Roche) were used. Molecular weight markers: A, digoxigenin-labeled, EcoRI and HindIII-digested lambda DNA; B, digoxigenin-labeled, HindIII-digested lambda DNA. Size of the fragments (in kbp) is indicated. The code numbers of the resistant strains are given above the lane numbers.

    Journal: Frontiers in Microbiology

    Article Title: Antibiotic Resistance-Susceptibility Profiles of Streptococcus thermophilus Isolated from Raw Milk and Genome Analysis of the Genetic Basis of Acquired Resistances

    doi: 10.3389/fmicb.2017.02608

    Figure Lengend Snippet: Southern blot analysis of total genomic DNA undigested and digested with either HindIII and PstI from the S. thermophilus strains resistant to tetracycline (A) and erythromycin (B) , respectively. As a probe, internal segments of tet (S) (in A ) and ermB (in B ) genes obtained by specific PCR and labeled with digoxigenin (Roche) were used. Molecular weight markers: A, digoxigenin-labeled, EcoRI and HindIII-digested lambda DNA; B, digoxigenin-labeled, HindIII-digested lambda DNA. Size of the fragments (in kbp) is indicated. The code numbers of the resistant strains are given above the lane numbers.

    Article Snippet: DNA extraction and search for antibiotic resistance genes by PCR Total genomic DNA was extracted from S. thermophilus isolates using the GenElute Genomic Bacterial DNA Purification kit (Sigma-Aldrich, St. Louis, Mo., USA), following the manufacturer's instructions.

    Techniques: Southern Blot, Polymerase Chain Reaction, Labeling, Molecular Weight, Lambda DNA Preparation

    Screening of T 0 and T 1 Tr cry1Ac transgenic tomato plants. A–C PCR amplification of 995 bp of cry1Ac gene. D–F 678 bp of npt II gene using gene specific primers in thirty T 0 transgenics. G , H RT-PCR analysis of ten randomly selected T 0 transgenic tomato plants of cry1Ac showing 995 bp cry1Ac gene and 678 bp npt II gene transcripts. M – 100 bp DNA ladder (NEB, USA). -C – non-transgenic control plant, +C – plasmid DNA positive control. I Real-time analysis for Bt- cry1Ac transcript levels in six T 0 transgenic tomato plants. TC – Transgenic plant with low expression of Bt-toxin used as control. J–O PCR amplification of 995 bp of cry1Ac gene and 678 bp of npt II gene using gene specific primers inT 1 progeny of promising T 0 parents. M −100 bp DNA ladder (NEB, USA). –C : non-transgenic control plant, +C : plasmid DNA positive control.

    Journal: SpringerPlus

    Article Title: Comparative performance of modified full-length and truncated Bacillus thuringiensis-cry1Ac genes in transgenic tomato

    doi: 10.1186/s40064-015-0991-x

    Figure Lengend Snippet: Screening of T 0 and T 1 Tr cry1Ac transgenic tomato plants. A–C PCR amplification of 995 bp of cry1Ac gene. D–F 678 bp of npt II gene using gene specific primers in thirty T 0 transgenics. G , H RT-PCR analysis of ten randomly selected T 0 transgenic tomato plants of cry1Ac showing 995 bp cry1Ac gene and 678 bp npt II gene transcripts. M – 100 bp DNA ladder (NEB, USA). -C – non-transgenic control plant, +C – plasmid DNA positive control. I Real-time analysis for Bt- cry1Ac transcript levels in six T 0 transgenic tomato plants. TC – Transgenic plant with low expression of Bt-toxin used as control. J–O PCR amplification of 995 bp of cry1Ac gene and 678 bp of npt II gene using gene specific primers inT 1 progeny of promising T 0 parents. M −100 bp DNA ladder (NEB, USA). –C : non-transgenic control plant, +C : plasmid DNA positive control.

    Article Snippet: Screening of transgenic plants by PCR Genomic DNA from leaves of T0 putative transformed plants as well as control plants was isolated using GenElute plant genomic DNA miniprep kit, according to the manufacturer’s instructions (Sigma, USA).

    Techniques: Transgenic Assay, Polymerase Chain Reaction, Amplification, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Positive Control, Expressing

    Molecular characterizations of T 0 and T 1 progeny of FlAc7 and FlAc11 transgenic tomato plants. A Comparative real-time PCR analysis of transcript in T 0 Fl cry1Ac transgenic plants showing fold change in expression with respect to FlAc 9 (low expressing transgenic plant taken as reference). Control : non-transgenic control. B , C RT-PCR and cDNA amplification of 678 bp npt II gene and 768 bp Fl cry1Ac gene of T 1 progeny using specific primers. M : 100 bp DNA ladder (NEB, USA). -C : non-transgenic control plant, +C : Fl cry1Ac gene plasmid DNA as positive control. D Southern blot probed with 3,510 bp Bam HI radiolabelled frament of FlCry1Ac gene. E Western immunoblot assay performed with crude leaf protein extract, lane1 purified Cry1Ac toxin protein, lane 12 : untransformed control, lane 2–11 : leaf protein extracts from progeny of T 0 FlAc7 and FlAc11. A protein band of ~130 kDa in transgenic plants showed hybridization with Cry1Ac antibodies, similar to positive control.

    Journal: SpringerPlus

    Article Title: Comparative performance of modified full-length and truncated Bacillus thuringiensis-cry1Ac genes in transgenic tomato

    doi: 10.1186/s40064-015-0991-x

    Figure Lengend Snippet: Molecular characterizations of T 0 and T 1 progeny of FlAc7 and FlAc11 transgenic tomato plants. A Comparative real-time PCR analysis of transcript in T 0 Fl cry1Ac transgenic plants showing fold change in expression with respect to FlAc 9 (low expressing transgenic plant taken as reference). Control : non-transgenic control. B , C RT-PCR and cDNA amplification of 678 bp npt II gene and 768 bp Fl cry1Ac gene of T 1 progeny using specific primers. M : 100 bp DNA ladder (NEB, USA). -C : non-transgenic control plant, +C : Fl cry1Ac gene plasmid DNA as positive control. D Southern blot probed with 3,510 bp Bam HI radiolabelled frament of FlCry1Ac gene. E Western immunoblot assay performed with crude leaf protein extract, lane1 purified Cry1Ac toxin protein, lane 12 : untransformed control, lane 2–11 : leaf protein extracts from progeny of T 0 FlAc7 and FlAc11. A protein band of ~130 kDa in transgenic plants showed hybridization with Cry1Ac antibodies, similar to positive control.

    Article Snippet: Screening of transgenic plants by PCR Genomic DNA from leaves of T0 putative transformed plants as well as control plants was isolated using GenElute plant genomic DNA miniprep kit, according to the manufacturer’s instructions (Sigma, USA).

    Techniques: Transgenic Assay, Real-time Polymerase Chain Reaction, Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification, Plasmid Preparation, Positive Control, Southern Blot, Western Blot, Purification, Hybridization

    Molecular characterizations of T 0 Fl cry1Ac transgenic tomato plants. Upper Panel A–C PCR amplification of 768 bp of Fl cry1Ac gene using specific primers in thirty T 0 transgenics. D–F RT-PCR analysis of T 0 transgenic tomato plants showing 768 bp amplicon of cry1Ac gene. M : 100 bp DNA ladder (NEB, USA). -C : non-transgenic control plant, +C : plasmid DNA positive control. Lower Panel G–I PCR amplification of 678 bp npt II gene using specific primers in T 0 transgenics. J–L RT-PCR analysis of T 0 transgenic tomato plants of showing 678 bp amplicon of npt II gene. M : 100 bp DNA ladder (NEB, USA). -C : non-transgenic control plant, +C : plasmid DNA positive control.

    Journal: SpringerPlus

    Article Title: Comparative performance of modified full-length and truncated Bacillus thuringiensis-cry1Ac genes in transgenic tomato

    doi: 10.1186/s40064-015-0991-x

    Figure Lengend Snippet: Molecular characterizations of T 0 Fl cry1Ac transgenic tomato plants. Upper Panel A–C PCR amplification of 768 bp of Fl cry1Ac gene using specific primers in thirty T 0 transgenics. D–F RT-PCR analysis of T 0 transgenic tomato plants showing 768 bp amplicon of cry1Ac gene. M : 100 bp DNA ladder (NEB, USA). -C : non-transgenic control plant, +C : plasmid DNA positive control. Lower Panel G–I PCR amplification of 678 bp npt II gene using specific primers in T 0 transgenics. J–L RT-PCR analysis of T 0 transgenic tomato plants of showing 678 bp amplicon of npt II gene. M : 100 bp DNA ladder (NEB, USA). -C : non-transgenic control plant, +C : plasmid DNA positive control.

    Article Snippet: Screening of transgenic plants by PCR Genomic DNA from leaves of T0 putative transformed plants as well as control plants was isolated using GenElute plant genomic DNA miniprep kit, according to the manufacturer’s instructions (Sigma, USA).

    Techniques: Transgenic Assay, Polymerase Chain Reaction, Amplification, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation, Positive Control

    Schematic diagram of T-DNA regions of expression vectors used for tomato transformation. A pRD400. B pNBRI–1. RB and LB-right and left border sequences; npt II-coding region of neomycin phosphotransferase gene; DECaMV35S - CaMV35S promoter with double enhancer; cry1Ac -sequence coding for cry1Ac gene; P nos -promoter sequence of nopaline synthase; T nos -terminator sequence of nopaline synthase. Bold lines ( ) show fragments used for DNA probe and arrows ( ) indicates oligo primer sites used for PCR amplification denoted as A 1 B 1, A 2 B 2 and A 3 B 3 respectively.

    Journal: SpringerPlus

    Article Title: Comparative performance of modified full-length and truncated Bacillus thuringiensis-cry1Ac genes in transgenic tomato

    doi: 10.1186/s40064-015-0991-x

    Figure Lengend Snippet: Schematic diagram of T-DNA regions of expression vectors used for tomato transformation. A pRD400. B pNBRI–1. RB and LB-right and left border sequences; npt II-coding region of neomycin phosphotransferase gene; DECaMV35S - CaMV35S promoter with double enhancer; cry1Ac -sequence coding for cry1Ac gene; P nos -promoter sequence of nopaline synthase; T nos -terminator sequence of nopaline synthase. Bold lines ( ) show fragments used for DNA probe and arrows ( ) indicates oligo primer sites used for PCR amplification denoted as A 1 B 1, A 2 B 2 and A 3 B 3 respectively.

    Article Snippet: Screening of transgenic plants by PCR Genomic DNA from leaves of T0 putative transformed plants as well as control plants was isolated using GenElute plant genomic DNA miniprep kit, according to the manufacturer’s instructions (Sigma, USA).

    Techniques: Expressing, Transformation Assay, Sequencing, Polymerase Chain Reaction, Amplification

    African test locations and rhizobial occupation in different Box-PCR clusters. For each location, the number of segments indicate the number of Box-PCR clusters occupied by isolates from that site. Uppercase letters in segments represent the labels of Box-PCR clusters (see Table 1 ). The area of each segment is proportional to the number of isolates from a given location occupying that cluster.

    Journal: Scientific Reports

    Article Title: Distribution and correlation between phylogeny and functional traits of cowpea (Vigna unguiculata L. Walp.)-nodulating microsymbionts from Ghana and South Africa

    doi: 10.1038/s41598-018-36324-0

    Figure Lengend Snippet: African test locations and rhizobial occupation in different Box-PCR clusters. For each location, the number of segments indicate the number of Box-PCR clusters occupied by isolates from that site. Uppercase letters in segments represent the labels of Box-PCR clusters (see Table 1 ). The area of each segment is proportional to the number of isolates from a given location occupying that cluster.

    Article Snippet: Extraction of bacterial genomic DNA and BOX-PCR fingerprinting Bacterial genomic DNA was extracted using Sigma’s Bacterial Genomic DNA Kit following the manufacturer’s instructions (GenEluteTM ).

    Techniques: Polymerase Chain Reaction

    Genomic fingerprints of 54 cowpea microsymbionts from Ghana and South Africa. Bold alphabets indicate major clusters. Isolates having distinct Box-PCR profiles at a cut-off point of 70% similarity are indicated by means of Arabic numerals. Where consecutive isolates exhibit distinct PCR profiles, the numbering is skipped and continued at the next group of isolates. The PCR-amplified products were electrophoresed in 1.2% agarose gel (20 × 15 cm gel size) for 6 h at 85 volt. The sizes of bands were determined using the Image Lab software (Bio-Rad version 4.1). All bands were used for cluster analysis with the UPGMA (Unweighted Pair Group Method with Arithmetic mean) algorithm using the software Bionumerics 7.6. Gel images are supplied in the supplementary file.

    Journal: Scientific Reports

    Article Title: Distribution and correlation between phylogeny and functional traits of cowpea (Vigna unguiculata L. Walp.)-nodulating microsymbionts from Ghana and South Africa

    doi: 10.1038/s41598-018-36324-0

    Figure Lengend Snippet: Genomic fingerprints of 54 cowpea microsymbionts from Ghana and South Africa. Bold alphabets indicate major clusters. Isolates having distinct Box-PCR profiles at a cut-off point of 70% similarity are indicated by means of Arabic numerals. Where consecutive isolates exhibit distinct PCR profiles, the numbering is skipped and continued at the next group of isolates. The PCR-amplified products were electrophoresed in 1.2% agarose gel (20 × 15 cm gel size) for 6 h at 85 volt. The sizes of bands were determined using the Image Lab software (Bio-Rad version 4.1). All bands were used for cluster analysis with the UPGMA (Unweighted Pair Group Method with Arithmetic mean) algorithm using the software Bionumerics 7.6. Gel images are supplied in the supplementary file.

    Article Snippet: Extraction of bacterial genomic DNA and BOX-PCR fingerprinting Bacterial genomic DNA was extracted using Sigma’s Bacterial Genomic DNA Kit following the manufacturer’s instructions (GenEluteTM ).

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Software

    PCR based assay of nuclear matrix associated DNA from Giardia . Nuclear matrix dependent (A;Lane 1) and independent DNA (A;Lane 2) was extracted from nuclear matrix (see methods) according to [20 and used for PCR reactions with predicted S/MAR primers(B). Lane M is the DNA marker (NEB); lanes 1-30 are PCR products of which odd number lanes (1,3,5,7.....27,29) even numberedare nuclear lanes (2,4,6...26,28,30) are nuclear matrix from the Giardia genomic DNA as a positive control(C). The PCRs are loaded in the following order: GlSMAR3, GlSMAR7, GlSMAR10, GlSMAR11, GlSMAR16, GlSMAR20, GlSMAR66, GlSMAR20, GlSMAR22, GlSMAR26-1, GlSMAR26-2, GlSMAR39, GlSMAR42, GlSMAR51, GlSMAR55, GlSMAR58, in both panel B and C. A non-S/MAR sequence was used as a control (PanelD). Amplification of multiple bands was seen in the matrix independent fraction (loop-fraction) lane 2 and no amplification was seen in the matrix dependent fraction.

    Journal: BMC Genomics

    Article Title: Identification of scaffold/Matrix Attachment (S/MAR) like DNA element from the gastrointestinal protozoan parasite Giardia lamblia

    doi: 10.1186/1471-2164-11-386

    Figure Lengend Snippet: PCR based assay of nuclear matrix associated DNA from Giardia . Nuclear matrix dependent (A;Lane 1) and independent DNA (A;Lane 2) was extracted from nuclear matrix (see methods) according to [20 and used for PCR reactions with predicted S/MAR primers(B). Lane M is the DNA marker (NEB); lanes 1-30 are PCR products of which odd number lanes (1,3,5,7.....27,29) even numberedare nuclear lanes (2,4,6...26,28,30) are nuclear matrix from the Giardia genomic DNA as a positive control(C). The PCRs are loaded in the following order: GlSMAR3, GlSMAR7, GlSMAR10, GlSMAR11, GlSMAR16, GlSMAR20, GlSMAR66, GlSMAR20, GlSMAR22, GlSMAR26-1, GlSMAR26-2, GlSMAR39, GlSMAR42, GlSMAR51, GlSMAR55, GlSMAR58, in both panel B and C. A non-S/MAR sequence was used as a control (PanelD). Amplification of multiple bands was seen in the matrix independent fraction (loop-fraction) lane 2 and no amplification was seen in the matrix dependent fraction.

    Article Snippet: Genomic DNA, Designing primers and PCR Giardia lamblia (strain WB1267) genomic DNA was prepared from confluent Giardia cultures using the Genomic DNA Isolation kit (Sigma) according to the manufacturers instruction.

    Techniques: Polymerase Chain Reaction, Marker, Sequencing, Amplification

    Agarose gel electrophoresis of PCR assay for the identification of Erysipelothrix rhusiopathiae. Lane 1: 100bp DNA marker; Lanes 2–8 and 11: positive samples; Lanes 10: negative control; Lane 12: Erysipelothrix rhusiopathiae ATCC 19414 as positive control.

    Journal: Iranian Journal of Medical Sciences

    Article Title: Isolation and Detection of Erysipelothrix rhusiopathiae and Its Distribution in Humans and Animals by Phenotypical and Molecular Methods in Ahvaz-Iran in 2015

    doi:

    Figure Lengend Snippet: Agarose gel electrophoresis of PCR assay for the identification of Erysipelothrix rhusiopathiae. Lane 1: 100bp DNA marker; Lanes 2–8 and 11: positive samples; Lanes 10: negative control; Lane 12: Erysipelothrix rhusiopathiae ATCC 19414 as positive control.

    Article Snippet: Detection of E. rhusiopathiae by PCR Genomic DNA was extracted using the High Pure PCR Template Preparation Kit (Roche, Germany).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker, Negative Control, Positive Control

    Analysis of HepG2 cells containing the 4CYPs-POR MAC. (A) Flowchart of the MAC transfer from donor CHO cells to recipient HepG2 cells via MMCT method, which comprises the following steps: micronucleation of donor cells by colcemid, enucleation by cytochalasin B, and microcell purification and fusion with recipient HepG2 cells. HepG2 hybrids were selected with 400 μg/mL G418 and picked for clonal expansion. (B) G418-resistant clones are screened by genomic PCR to determine the presence of the 4CYPs-POR transgene. (C) Representative metaphase fluorescence in situ hybridization images of TC-HepG2 cells. Digoxigenin-labeled mouse cot-1 DNA (red) was used to detect the MAC. Biotin-labeled pPAC-4CYPs-POR (green) was used to detect the 4CYPs-POR cassette in the MAC. Chromosomal DNA was counterstained with DAPI. White arrows indicate MAC vectors, and the inset shows an enlarged image of the MAC.

    Journal: PLoS ONE

    Article Title: Establishment of a novel hepatocyte model that expresses four cytochrome P450 genes stably via mammalian-derived artificial chromosome for pharmacokinetics and toxicity studies

    doi: 10.1371/journal.pone.0187072

    Figure Lengend Snippet: Analysis of HepG2 cells containing the 4CYPs-POR MAC. (A) Flowchart of the MAC transfer from donor CHO cells to recipient HepG2 cells via MMCT method, which comprises the following steps: micronucleation of donor cells by colcemid, enucleation by cytochalasin B, and microcell purification and fusion with recipient HepG2 cells. HepG2 hybrids were selected with 400 μg/mL G418 and picked for clonal expansion. (B) G418-resistant clones are screened by genomic PCR to determine the presence of the 4CYPs-POR transgene. (C) Representative metaphase fluorescence in situ hybridization images of TC-HepG2 cells. Digoxigenin-labeled mouse cot-1 DNA (red) was used to detect the MAC. Biotin-labeled pPAC-4CYPs-POR (green) was used to detect the 4CYPs-POR cassette in the MAC. Chromosomal DNA was counterstained with DAPI. White arrows indicate MAC vectors, and the inset shows an enlarged image of the MAC.

    Article Snippet: Genomic polymerase chain reaction (PCR) Genomic DNA was extracted from cell lines using a genomic DNA extraction kit with DNase-free RNase (Gentra Systems, Minneapolis, USA).

    Techniques: Purification, Clone Assay, Polymerase Chain Reaction, Fluorescence, In Situ Hybridization, Labeling

    Construction and analysis of the 4CYPs-POR MAC vector in CHO cells. (A) Genomic PCR and (B) RT-PCR analysis of CHO cells containing the 4CYPs-POR MAC. N, negative control (parental CHO cells); P, positive control (PAC-4CYPs-POR). (C) FISH analysis of donor CHO cells containing the 4CYPs-POR MAC. Digoxigenin-labeled mouse cot-1 DNA (red) was used to detect the MAC. Biotin-labeled 4CYPs-POR PAC (green) was used to detect the 4CYPs-POR cassette in the MAC. Chromosomal DNA was counterstained with DAPI. White arrow indicates MAC vector, and the inset shows enlarged image of the MAC.

    Journal: PLoS ONE

    Article Title: Establishment of a novel hepatocyte model that expresses four cytochrome P450 genes stably via mammalian-derived artificial chromosome for pharmacokinetics and toxicity studies

    doi: 10.1371/journal.pone.0187072

    Figure Lengend Snippet: Construction and analysis of the 4CYPs-POR MAC vector in CHO cells. (A) Genomic PCR and (B) RT-PCR analysis of CHO cells containing the 4CYPs-POR MAC. N, negative control (parental CHO cells); P, positive control (PAC-4CYPs-POR). (C) FISH analysis of donor CHO cells containing the 4CYPs-POR MAC. Digoxigenin-labeled mouse cot-1 DNA (red) was used to detect the MAC. Biotin-labeled 4CYPs-POR PAC (green) was used to detect the 4CYPs-POR cassette in the MAC. Chromosomal DNA was counterstained with DAPI. White arrow indicates MAC vector, and the inset shows enlarged image of the MAC.

    Article Snippet: Genomic polymerase chain reaction (PCR) Genomic DNA was extracted from cell lines using a genomic DNA extraction kit with DNase-free RNase (Gentra Systems, Minneapolis, USA).

    Techniques: Plasmid Preparation, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Negative Control, Positive Control, Fluorescence In Situ Hybridization, Labeling

    Agarose gel electrophoresis of Neovison vison DQA gene amplification. M: DL2000 DNA marker; ( 1) PCR product with primer pair F1U/F1L; (2) PCR Product with primer pair F2U/F2L; and (3) PCR product with primer pair F3U/F3L.

    Journal: International Journal of Molecular Sciences

    Article Title: Molecular Cloning and Bioinformatics Analysis of DQA Gene from Mink (Neovison vison)

    doi: 10.3390/ijms20051037

    Figure Lengend Snippet: Agarose gel electrophoresis of Neovison vison DQA gene amplification. M: DL2000 DNA marker; ( 1) PCR product with primer pair F1U/F1L; (2) PCR Product with primer pair F2U/F2L; and (3) PCR product with primer pair F3U/F3L.

    Article Snippet: Genomic DNA PCR amplification was performed using ExTaq Kit (TaKaRa, RR01AM).

    Techniques: Agarose Gel Electrophoresis, Amplification, Marker, Polymerase Chain Reaction

    Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the PCR-based methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, Msp I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.

    Journal: British Journal of Cancer

    Article Title: Methylation analysis of the glypican 3 gene in embryonal tumours

    doi: 10.1038/sj.bjc.6601716

    Figure Lengend Snippet: Methylation analysis of the GPC3 promoter in nontumoural samples. ( A ) CpG dinucleotides positions in the GPC3 promoter region. The methylation status of 11 of these CpG sites was determined either by the PCR-based methylation assay (#) or by the Southern blot-based methylation assay (+) using methyl-sensitive restriction endonucleases Hpa II (H), Sac II (S), Eag I (E), and Bss HII (B). Hpa II contains one CpG site, whereas Sac II, Eag I and Bss HII contain two CpG sites each. The distal and proximal sites were amplified in distinct PCRs. ( B and C ) Representative results of the methylation analysis in normal peripheral blood and placental DNA samples obtained by the PCR-based ( B ) and Southern blot-based ( C ) methylation assays. See Table 1 for details concerning the samples. ( D ) PCR-based methylation assay performed on DNA samples from two individuals (AC-1 and DC) affected by the Turner syndrome. Digestions: ( B and D ) H, Hpa II; M, Msp I; U, undigested; ( C ) H, Hind III; B, Bss HII; S, Sac II and E, Eag I. GPC3+, expression of GPC3; GPC3−, no expression of GPC3.

    Article Snippet: Polymerase chain reactions were performed in a total volume of 20 μ l containing 1 μ l of the Hpa II or Msp I digestion reactions (10 ng of genomic DNA), 1 × of ‘GC Genomic PCR Reaction Buffer’ (Clontech, Palo Alto, CA, USA), 1.1 mM Mg(OAc)2 , 200 μ M of each of the four dNTPs, 1 M ‘GC-Melt’ (Clontech, Palo Alto, CA, USA), 0.4 μ M of each primer (proximal sites: B2 (ACGTGCTGCTACCCAGCCGCTGCA) and L2 (GGAACTTCTCCCAGAGCCAGTCAGAGCG); distal sites: E2 (CCGCTCATTGGCCTACAGCCTGGAGGGC) and J2 (TATTCAAAGGTGAGGCAGGCTGTGAAAAGC)) and 1 × of ‘Advantage GC Genomic Polymerase Mix’ (Clontech, Palo Alto, CA, USA).

    Techniques: Methylation, Polymerase Chain Reaction, Southern Blot, Amplification, Expressing

    Methylation analysis of the GPC3 promoter in tumour cell DNA samples. PCR- ( A ) and Southern blot- ( B ) based methylation assays were performed on tumour cell DNA samples from NB cell lines (SK-N-AS, SK-N-SH), primary NBs (N4, N5) and primary WTs (WT51, WT116, WT158, WT177). Only results for samples with abnormal DNA methylation patterns are shown. Digestions: ( A ) H: Hpa II; M: Msp I; U: undigested; ( B ) H: Hind III; B: Bss HII; S: Sac II and E: Eag I.

    Journal: British Journal of Cancer

    Article Title: Methylation analysis of the glypican 3 gene in embryonal tumours

    doi: 10.1038/sj.bjc.6601716

    Figure Lengend Snippet: Methylation analysis of the GPC3 promoter in tumour cell DNA samples. PCR- ( A ) and Southern blot- ( B ) based methylation assays were performed on tumour cell DNA samples from NB cell lines (SK-N-AS, SK-N-SH), primary NBs (N4, N5) and primary WTs (WT51, WT116, WT158, WT177). Only results for samples with abnormal DNA methylation patterns are shown. Digestions: ( A ) H: Hpa II; M: Msp I; U: undigested; ( B ) H: Hind III; B: Bss HII; S: Sac II and E: Eag I.

    Article Snippet: Polymerase chain reactions were performed in a total volume of 20 μ l containing 1 μ l of the Hpa II or Msp I digestion reactions (10 ng of genomic DNA), 1 × of ‘GC Genomic PCR Reaction Buffer’ (Clontech, Palo Alto, CA, USA), 1.1 mM Mg(OAc)2 , 200 μ M of each of the four dNTPs, 1 M ‘GC-Melt’ (Clontech, Palo Alto, CA, USA), 0.4 μ M of each primer (proximal sites: B2 (ACGTGCTGCTACCCAGCCGCTGCA) and L2 (GGAACTTCTCCCAGAGCCAGTCAGAGCG); distal sites: E2 (CCGCTCATTGGCCTACAGCCTGGAGGGC) and J2 (TATTCAAAGGTGAGGCAGGCTGTGAAAAGC)) and 1 × of ‘Advantage GC Genomic Polymerase Mix’ (Clontech, Palo Alto, CA, USA).

    Techniques: Methylation, Polymerase Chain Reaction, Southern Blot, DNA Methylation Assay

    RNA-Sequencing analysis of GhABF2 -overexpressing cotton leaves transcriptome. ( a ) Changes in gene expression profile between control, OE17, and OE18. DEGs, differently expressed genes. vs, versus. The red bar represents up-regulated gene, and the green bar represents down-regulated gene. ( b ) Venn diagram of DEGs in cotton seedling leaves between OE17 vs OE18 and different abiotic stress conditions. The DEGs data response to ABA, drought, and salt treatment were extracted from GEO at NCBI (accession number GSE50770). ( c ) Heatmap of the part of 68 DEGs. TF, transcription factor. OR, oxidation reduction. CB, chlorophyll biosynthetic. ( d ) Expression of TF genes by qRT-PCR. Values are means ± SD of three replicates. * P ≤ 0.01, ** P ≤ 0.01; Student t test.

    Journal: Scientific Reports

    Article Title: GhABF2, a bZIP transcription factor, confers drought and salinity tolerance in cotton (Gossypium hirsutum L.)

    doi: 10.1038/srep35040

    Figure Lengend Snippet: RNA-Sequencing analysis of GhABF2 -overexpressing cotton leaves transcriptome. ( a ) Changes in gene expression profile between control, OE17, and OE18. DEGs, differently expressed genes. vs, versus. The red bar represents up-regulated gene, and the green bar represents down-regulated gene. ( b ) Venn diagram of DEGs in cotton seedling leaves between OE17 vs OE18 and different abiotic stress conditions. The DEGs data response to ABA, drought, and salt treatment were extracted from GEO at NCBI (accession number GSE50770). ( c ) Heatmap of the part of 68 DEGs. TF, transcription factor. OR, oxidation reduction. CB, chlorophyll biosynthetic. ( d ) Expression of TF genes by qRT-PCR. Values are means ± SD of three replicates. * P ≤ 0.01, ** P ≤ 0.01; Student t test.

    Article Snippet: The Genome sequence of GhABF2 was isolated by Genome Walker PCR (TaKaRa, Dalian, China).

    Techniques: RNA Sequencing Assay, Expressing, Quantitative RT-PCR

    Analysis of IgH V region joints derived from B cells in ΔD mice. (A) Alignment of joints amplified from the RNA of 2-wk-old ΔD/ΔD and ΔD/JHT mice. The joints are shown from the codon immediately 5′ of the second cystein (position 104) of the V H gene and extending to the conserved glycine of the J H region. Sequences labeled with an asterisk use the putative D H element, DST4.2 (underlined). The sequences were analyzed using the http://www.DNAPLOT.de , http://www.imgt.cines.fr , or http://www.ncbi.nlm.nih.gov/igblast websites. In the analysis of bulk-sorted cells, some sequences were found repeatedly, as indicated by the superscripts next to the sequence numbers. As we did not observe repeated sequences in the single cell analyses, we consider the repeats in the bulk analysis an artifact resulting from the high number of amplification cycles. Two sets of sequences (1, 11 and 30, 31, 32) may represent hybrid sequences generated in the course of gene amplification by PCR (reference 27 ). Sequences were submitted through http://www.ncbi.nih.gov/Genbank/index.html in a consistent order (GenBank/EMBL/DDBJ accession nos. AY841948 , AY841949 , AY841950 , AY841951 , AY841952 , AY841953 , AY841954 , AY841955 , AY841956 , AY841957 , AY841958 , AY841959 , AY841960 , AY841961 , AY841962 , AY841963 , AY841964 , AY841965 , AY841966 , AY841967 , AY841968 , AY841969 , AY841970 , AY841971 , AY841972 , AY841973 , AY841974 , AY841975 , AY841976 , AY841977 , AY841978 , AY841979 ). (B) Analysis of joints from single cell sorted and bulk sorted or MACS B cells from 5- and 10-wk-old ΔD/ΔD or WT mice. Because of space limitations, only their productive versus nonproductive status is listed. (C) CDR3 length comparison of V H J H joints (excluding sequences using DST4.2) from ΔD/ΔD and ΔD/JHT B cells and V H D H J H joints from WT B cells isolated from 2-, 5-, and 10-wk-old mice. Gray bars represent average number of nucleotides in the CDR3 defined as starting after the cysteine in the 3′ end of the V H and ending with the last nucleotide before the conserved tryptophan of J H . Error bars represent standard deviations. To demonstrate that the difference in the CDR3 length of the joints from ΔD/ΔD and WT B cells is due to the absence of D H elements and only a single round of N and P nucleotide addition, the average length of D H sequence in WT V H D H J H joints (white bars) plus that of N/P nucleotides added in a single round (black bars) are shown on top of the CDR3 values for ΔD/ΔD sequences. The first group of bars represents a mix of sequences amplified from cDNA of 2-wk-old mice with a natural distribution of J H usage. The second and third group is from DNA of 5-wk-old mice sequenced using a J H 4 or J H 2 primer, respectively. Because J H element length varies, different J H elements contribute differently to overall CDR3 length. The last bar gives the average and standard deviation for sequences derived from DNA of single cells of a 10-wk-old mouse using J H 2 primer. Sequences from appropriately age-matched WT mice were are not available. The average D H element length in V H D H J H joints was calculated from the number of nucleotides of D H origin in the WT sequences of the corresponding group. To approximate the average number of nucleotides per one round of N/P nucleotide addition, the N/P nucleotides at the D H J H and V H D H border in the WT joints of a corresponding group were added and divided by the number of sequences and by a factor of two.

    Journal: The Journal of Experimental Medicine

    Article Title: Direct in vivo VH to JH rearrangement violating the 12/23 rule

    doi: 10.1084/jem.20041577

    Figure Lengend Snippet: Analysis of IgH V region joints derived from B cells in ΔD mice. (A) Alignment of joints amplified from the RNA of 2-wk-old ΔD/ΔD and ΔD/JHT mice. The joints are shown from the codon immediately 5′ of the second cystein (position 104) of the V H gene and extending to the conserved glycine of the J H region. Sequences labeled with an asterisk use the putative D H element, DST4.2 (underlined). The sequences were analyzed using the http://www.DNAPLOT.de , http://www.imgt.cines.fr , or http://www.ncbi.nlm.nih.gov/igblast websites. In the analysis of bulk-sorted cells, some sequences were found repeatedly, as indicated by the superscripts next to the sequence numbers. As we did not observe repeated sequences in the single cell analyses, we consider the repeats in the bulk analysis an artifact resulting from the high number of amplification cycles. Two sets of sequences (1, 11 and 30, 31, 32) may represent hybrid sequences generated in the course of gene amplification by PCR (reference 27 ). Sequences were submitted through http://www.ncbi.nih.gov/Genbank/index.html in a consistent order (GenBank/EMBL/DDBJ accession nos. AY841948 , AY841949 , AY841950 , AY841951 , AY841952 , AY841953 , AY841954 , AY841955 , AY841956 , AY841957 , AY841958 , AY841959 , AY841960 , AY841961 , AY841962 , AY841963 , AY841964 , AY841965 , AY841966 , AY841967 , AY841968 , AY841969 , AY841970 , AY841971 , AY841972 , AY841973 , AY841974 , AY841975 , AY841976 , AY841977 , AY841978 , AY841979 ). (B) Analysis of joints from single cell sorted and bulk sorted or MACS B cells from 5- and 10-wk-old ΔD/ΔD or WT mice. Because of space limitations, only their productive versus nonproductive status is listed. (C) CDR3 length comparison of V H J H joints (excluding sequences using DST4.2) from ΔD/ΔD and ΔD/JHT B cells and V H D H J H joints from WT B cells isolated from 2-, 5-, and 10-wk-old mice. Gray bars represent average number of nucleotides in the CDR3 defined as starting after the cysteine in the 3′ end of the V H and ending with the last nucleotide before the conserved tryptophan of J H . Error bars represent standard deviations. To demonstrate that the difference in the CDR3 length of the joints from ΔD/ΔD and WT B cells is due to the absence of D H elements and only a single round of N and P nucleotide addition, the average length of D H sequence in WT V H D H J H joints (white bars) plus that of N/P nucleotides added in a single round (black bars) are shown on top of the CDR3 values for ΔD/ΔD sequences. The first group of bars represents a mix of sequences amplified from cDNA of 2-wk-old mice with a natural distribution of J H usage. The second and third group is from DNA of 5-wk-old mice sequenced using a J H 4 or J H 2 primer, respectively. Because J H element length varies, different J H elements contribute differently to overall CDR3 length. The last bar gives the average and standard deviation for sequences derived from DNA of single cells of a 10-wk-old mouse using J H 2 primer. Sequences from appropriately age-matched WT mice were are not available. The average D H element length in V H D H J H joints was calculated from the number of nucleotides of D H origin in the WT sequences of the corresponding group. To approximate the average number of nucleotides per one round of N/P nucleotide addition, the N/P nucleotides at the D H J H and V H D H border in the WT joints of a corresponding group were added and divided by the number of sequences and by a factor of two.

    Article Snippet: To isolate the unknown sequence fused to the JH region in the nonproductively rearranged IgH allele of the LN1 mouse, a “pan”-PCR genome walking strategy was performed using adaptor AP1 and adaptor specific primers A1 and A2 (GenomeWalker Kit; CLONTECH Laboratories, Inc.) as described in the original publication by the inventors ( ).

    Techniques: Derivative Assay, Mouse Assay, Amplification, Labeling, Sequencing, Generated, Polymerase Chain Reaction, Magnetic Cell Separation, Isolation, Standard Deviation

    RT-PCR analysis of the TC genes of Y. enterocolitica T83. Expression of tcbA (lanes 2 to 7), tcaC (lanes 8 to 13), and tccC (lanes 14 to 19) was assessed at 30°C (lanes 2, 8, and 14) and at 37°C (lanes 4, 10, and 16). Lanes: 1 and 20,

    Journal:

    Article Title: Homologues of Insecticidal Toxin Complex Genes in Yersinia enterocolitica Biotype 1A and Their Contribution to Virulence

    doi: 10.1128/IAI.73.10.6860-6867.2005

    Figure Lengend Snippet: RT-PCR analysis of the TC genes of Y. enterocolitica T83. Expression of tcbA (lanes 2 to 7), tcaC (lanes 8 to 13), and tccC (lanes 14 to 19) was assessed at 30°C (lanes 2, 8, and 14) and at 37°C (lanes 4, 10, and 16). Lanes: 1 and 20,

    Article Snippet: Genomic subtractive hybridization was performed using the Clontech PCR-Select Bacterial Genome Subtraction kit with Y. enterocolitica T83, a clinical isolate, as the tester and Y. enterocolitica IP2222, an isolate from water, as the driver.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing

    Generation of Xb130 −/− mice. A. Schematic strategy of xb130 gene targeting. Structure of Xb130 gene (5′ part), targeting construct, targeted allele and final knockout allele are shown (Empty Boxes: exons; S: SacI; B: BamHI, Filled boxes: Sites for Southern blot probes). Homologous recombination of ES cell genomic DNA with targeting construct inserts Loxp and Frt sites flanking an 879 bp region including Exon 7 and a floxed neomycin cassette. The deletion of Exon 7 causes a frame shift mutation and translation termination in Exon 8. B. Southern blotting with 3′ probe. Mice were derived from Xb130 +/− progeny. C. Western blotting. Protein lysates were extracted from spleen and lung tissues of Xb130 +/+ , Xb130 +/− and Xb130 −/− mice that were genotyped by Southern blotting. D. PCR based genotyping . Arrows indicate the location of primers used for PCR amplification. PCR product amplified from F1 and R1 in WT allele was undetectable due to competition from short product F2/R1. E. RT-PCR. The exons of RT-PCR products from WT (a) and knockout (b and c) mice are indicated based on sequencing data. Red stars indicate induced in-frame stop codons. F. Predicted Xb130 knockout allele based on RT-PCR and genomic PCR data. The primers used for long PCR and the amplicon are indicated as arrows and green line respectively.

    Journal: PLoS ONE

    Article Title: XB130 Deficiency Affects Tracheal Epithelial Differentiation during Airway Repair

    doi: 10.1371/journal.pone.0108952

    Figure Lengend Snippet: Generation of Xb130 −/− mice. A. Schematic strategy of xb130 gene targeting. Structure of Xb130 gene (5′ part), targeting construct, targeted allele and final knockout allele are shown (Empty Boxes: exons; S: SacI; B: BamHI, Filled boxes: Sites for Southern blot probes). Homologous recombination of ES cell genomic DNA with targeting construct inserts Loxp and Frt sites flanking an 879 bp region including Exon 7 and a floxed neomycin cassette. The deletion of Exon 7 causes a frame shift mutation and translation termination in Exon 8. B. Southern blotting with 3′ probe. Mice were derived from Xb130 +/− progeny. C. Western blotting. Protein lysates were extracted from spleen and lung tissues of Xb130 +/+ , Xb130 +/− and Xb130 −/− mice that were genotyped by Southern blotting. D. PCR based genotyping . Arrows indicate the location of primers used for PCR amplification. PCR product amplified from F1 and R1 in WT allele was undetectable due to competition from short product F2/R1. E. RT-PCR. The exons of RT-PCR products from WT (a) and knockout (b and c) mice are indicated based on sequencing data. Red stars indicate induced in-frame stop codons. F. Predicted Xb130 knockout allele based on RT-PCR and genomic PCR data. The primers used for long PCR and the amplicon are indicated as arrows and green line respectively.

    Article Snippet: Expand long genomic PCR amplification Genomic long PCR product was amplified by Forward Primer GT-F1 (5′ CCTCTGCCGAAAACTCATAC 3′) and Reverse primer Intron7-R1 (5′ GAAACCCAAATACAATTTGTCTAGGCTGTAG 3′) using Expand Long Template PCR System (Roche Applied Science).

    Techniques: Mouse Assay, Construct, Knock-Out, Southern Blot, Homologous Recombination, Mutagenesis, Derivative Assay, Western Blot, Polymerase Chain Reaction, Amplification, Reverse Transcription Polymerase Chain Reaction, Sequencing