Journal: eLife

Article Title: Sae2/CtIP prevents R-loop accumulation in eukaryotic cells

doi: 10.7554/eLife.42733

Figure Lengend Snippet: CtIP and its nuclease activity promote ssDNA break formation. ( A ) DNA breaks were quantified in wild-type and CtIP-depleted U2OS cells by alkaline comet assay. Cells were untreated (DMSO) or exposed to 5 µM CPT for 1 hr, with DRB (20 µM) or aphidicolin (2 µg/mL) pretreatment as indicated. Olive moments were calculated by analyzing at least 100 comets for each sample; error bars represent S.E.M. ( B ) Quantification of ssDNA breaks by alkaline comet assay was performed in wild-type, CtIP-depleted, XPG-depleted, or CtIP/XPG-depleted U2OS cells as in ( A ). ( C ) Quantification of ssDNA breaks by alkaline comet assay was performed in wild-type or CtIP-depleted U2OS cells complemented with wild-type eGFP-CtIP or nuclease-deficient NA/HA mutant CtIP as in ( A ). ( D ) A schematic representation of Ligation-mediated (LM)-PCR assay (top). Primer extension with a biotinylated primer (in red) from genomic DNA produces a double-stranded DNA end that is isolated with streptavidin and amplified by ligation-mediated PCR (asymmetric duplex and nested primers are presented in blue and green, respectively). LM-PCR assay measuring DNA breaks on the bottom strand of the RPL13A gene (bottom). DNA single-strand breaks were measured by LM-PCR at the endogenous RPL13A locus in wild-type or CtIP-depleted cells; n = 6, error bars represent S.E.M. * and **** denote p

Article Snippet: Genomic DNA (gDNA) was purified using genomic DNA preparation kit (Zymo Research Quick-gDNA MiniPrep - Capped column, Genesee Scientific, 11-317AC) and gDNA concentration was determined using Nanodrop.

Techniques: Activity Assay, Alkaline Single Cell Gel Electrophoresis, Cycling Probe Technology, Mutagenesis, Ligation, Polymerase Chain Reaction, Isolation, Amplification

Journal: Nature

Article Title: Structure of a Naegleria Tet-like dioxygenase in complex with 5-methylcytosine DNA

doi: 10.1038/nature12905

Figure Lengend Snippet: Activity of NgTet1 on various DNA substrates a–c , The time courses (lanes 5–13) of the reactions using 32-bp DNA substrates containing 5mC (panel a ), 5hmC (panel b ) or 5caC (panel c ). Lanes 1–4: antibody sensitivity against 10 pmol of control oligonucleotides and 2 fold serial dilutions. Lanes 5–13: the rate of conversion appears to be the fastest for the reaction of 5mC to 5hmC, and decreases with each subsequent reaction: 5mC to 5hmC > 5hmC to 5fC > 5fC to 5caC. d , Activities of NgTet1 (20 µM) on genomic DNA (gDNA) of Hela cells (2.5 µg). After 1 h reaction, 87% of the products are 5caC in gDNA with the remaining being 5fC and 5hmC. The percentages were estimated from integration of the peaks in LC-MS traces. The mean and standard deviation (±s.e.m.) were estimated from three repeated experiments. e , Human thymine DNA glycosylase (TDG) excises 5fC and 5caC (but not 5mC and 5hmC) when paired with a guanine in a CpG sequence (lanes 1–4) (He et al., 2011; Maiti and Drohat, 2011; Hashimoto et al., 2012). After NgTet1 reactions with DNA substrates containing 5mC, 5hmC or 5fC, in the presence of αKG, the product DNA containing 5fC and 5caC becomes a substrate for TDG (lanes 6, 8 and 10), but not with NOG (lanes 5 and 7), again demonstrating the production of 5fC and 5caC by NgTet1. f , Activities of NgTet1 on 56-bp double-stranded (ds) DNA-2 with methylation on both strands (M/M) or single strand (hemi-methylated either on top M/C or bottom C/M strand) or single-stranded (ss) DNA (Reaction time 1 h and ±s.e.m. estimated from three repeats). We note that an in vitro activity of the mouse Tet1 catalytic domain on single-stranded DNA has also been observed (Zhang et al., 2012). g , LC-MS traces of a sample reaction mix on the hemi-methylated 5mCpG dsDNA-1 (top panel), reaction control with no enzyme (middle panel), and the standard deoxyribonucleoside mix (bottom panel). Arrows indicate peaks of 5mC, 5hmC, 5fC and 5caC. Identities of the peaks are confirmed by comparing the retention time with the standard as well as by mass spectrometry. Hashimoto, H., Hong, S., Bhagwat, A. S., Zhang, X. Cheng, X. Excision of 5-hydroxymethyluracil and 5-carboxylcytosine by the thymine DNA glycosylase domain: its structural basis and implications for active DNA demethylation. Nucleic Acids Res 40 , 10203–10214 (2012). He, Y. F. et al . Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science 333 , 1303–1307 (2011). Maiti, A. Drohat, A. C. Thymine DNA glycosylase can rapidly excise 5-formylcytosine and 5-carboxylcytosine: potential implications for active demethylation of CpG sites. J Biol Chem 286 , 35334–35338 (2011). Zhang, L., Yu, M. He, C. Mouse Tet1 protein can oxidize 5mC to 5hmC and 5caC on single-stranded DNA. Acta Chimica Sinica 70 , 2123–2126 (2012).

Article Snippet: For quantitative analyses of various 5mC oxidative species, either the 56-bp hemi-methylated dsDNA-1 ( ) or genomic DNA (gDNA) of Hela cells (NEB #N4006S) ( ) were used as substrates.

Techniques: Activity Assay, Liquid Chromatography with Mass Spectroscopy, Standard Deviation, Sequencing, Methylation, In Vitro, Mass Spectrometry

Journal: Nature

Article Title: Structure of a Naegleria Tet-like dioxygenase in complex with 5-methylcytosine DNA

doi: 10.1038/nature12905

Figure Lengend Snippet: Pairwise comparison of NgTet1 and mammalian Tet1 a , Schematic representation of hTet1 C-terminal catalytic domain. b , Sequence alignment of NgTet1, hTet1 and mTet1. Labels above the sequences indicate that i for intra-molecular polar interaction; s for exposed surface residue; h for hydrophobic core; t for structural turn; α for αKG binding; m for metal ion coordination; P for DNA phosphate interaction; g for DNA base interaction with the orphaned guanine; G for DNA base interaction with the 3’ guanine to 5mC; C for 5mC interaction; a for active site residues (A212 and V293) near the methyl group of 5mC. c , Structure of NgTet1 with arrows indicating the two large insertions of mammalian Tet1. Highlighted is the charge-charge interaction between invariant K86 and E108. d , A kinked helix α4, owing to P172 (conserved among NgTet1, human and mouse Tet1, Tet2 and Tet3) located in the middle. f , Antibody detection of 5hmC in genomic DNA of HEK293T cells (top panel) expressing Flag tagged mouse Tet1 catalytic domain or its internal deletions (bottom panel). Top panel: Lane 1 is the 32-bp oligonucleotide containing a single 5hmC (20 pmol and 2 fold serial dilutions) and lanes 2–7 are the genomic DNA (500 ng and 2 fold serial dilutions). Bottom panel: Lane 1 is the molecular weight marker and Lanes 2 and 7 are the whole cell lysates with approximately equal amount of protein.

Article Snippet: For quantitative analyses of various 5mC oxidative species, either the 56-bp hemi-methylated dsDNA-1 ( ) or genomic DNA (gDNA) of Hela cells (NEB #N4006S) ( ) were used as substrates.

Techniques: Sequencing, Binding Assay, Expressing, Molecular Weight, Marker

Journal: PLoS Pathogens

Article Title: The Clostridium difficile Cell Wall Protein CwpV is Antigenically Variable between Strains, but Exhibits Conserved Aggregation-Promoting Function

doi: 10.1371/journal.ppat.1002024

Figure Lengend Snippet: Isolation of Δ recV mutants. A. PCR confirmation of recV gene disruption using ClosTron. Primers NF1215+NF1356 flanking the ClosTron target site in recV give a 665 bp product in 630Δ erm (WT). After mutagenesis, four erythromycin resistant colonies were tested and a 2839 bp product was amplified, indicative of insertion of the group II intron into recV . These clones were designated Δ recV 1-4. B. Diagrammatic representation of the cwpV DNA switch orientation-specific PCR assay. Primers NF823+NF826 amplify a product from OFF, whilst primers NF823+NF825 amplify a product from ON. C. Analysis of the orientation of the cwpV DNA switch in C. difficile clones by orientation PCR. (i), products for the ON and OFF orientations are amplified from WT. (ii), all four isolated Δ recV mutants contain only the OFF orientation of the cwpV DNA switch, therefore these strains are referred to as 630Δ recV OFF. (iii), complementation of 630Δ recV OFF using a plasmid encoding recV (pRecV+) reconstituted the switching phenotype. (iv), a recV Y176F mutant was unable to complement Δ recV OFF confirming the key role of this tyrosine residue in RecV activity. (v), Δ recV (pRecV+) was serially sub-cultured without thiamphenicol selection to enable curing of the pRecV+ plasmid. Four thiamphenicol sensitive colonies were isolated from which only the ON orientation of the cwpV DNA switch could be amplified. These strains were therefore designated Δ recV ON. D. Colony morphologies of WT and Δ recV OFF are similar, however Δ recV ON exhibit a smaller, smoother-edged colony morphology.

Article Snippet: To clone the cwpV genes from strains of unknown genomic sequence, genomic DNA was digested overnight at 37°C with Ase I (NEB) and then ligated overnight at 16°C using T4 ligase (NEB).

Techniques: Isolation, Polymerase Chain Reaction, Mutagenesis, Amplification, Clone Assay, Plasmid Preparation, Activity Assay, Cell Culture, Selection

Journal: ISRN Endocrinology

Article Title: Expression of an Androgenic Gland-Specific Insulin-Like Peptide during the Course of Prawn Sexual and Morphotypic Differentiation

doi: 10.5402/2011/476283

Figure Lengend Snippet: PCR of genomic DNA and RT-PCR of RNA extracted from larvae and juvenile and mature male and female M. rosenbergii individuals. Genomic-based PCR indicates maleness, where no female specific marker was amplified. RT-PCR was applied for detection of Mr-IAG expression by using Mr-IAG specific primers and β -actin as positive control. (a) For adult male and female individuals, there is a correlation between the absence of the female specific marker and Mr-IAG expression. On the basis of this result, larvae and juveniles were defined as males according to the absence of the genomic sex marker (marked by arrows in Figure 2(b) ). (b) None of the individuals sampled at larval stages (zoeae 3, 6, 9, and 11) expressed Mr-IAG regardless of the presence or absence of the genomic sex marker. At PL 20 and onwards, all individuals identified as males according to absence of the female specific marker also expressed Mr-IAG .

Article Snippet: PCR of Female Specific and Positive Control Sequences PCR was performed with 100 ng genomic DNA, 1 μ M forward primer and 1 μ M reverse primer (primer sequences are available upon request), 12.5 μ L Ready Mix REDTaq (Sigma) and water to a final volume of 25 μ L. The PCR conditions were: 35 cycles of 30 s at 94°C, 30 s at 56°C, and 60 s at 72°C.

Techniques: Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Marker, Amplification, Expressing, Positive Control

Journal: Disease Models & Mechanisms

Article Title: Decreased N-TAF1 expression in X-linked dystonia-parkinsonism patient-specific neural stem cells

doi: 10.1242/dmm.022590

Figure Lengend Snippet: TAF1 and MTS transcript expression levels in fibroblasts. (A) Genomic DNA (gDNA) from all individuals was PCR amplified with primers flanking the insertion site to confirm the presence of the SVA. Lane 1: 1 kb DNA ladder. Lane 2: no template control (H 2 O). Lanes 3-7: XDP lines (left to right) 32517, 33109, 33363, 33808, 34363. Lanes 8-12: Control lines (left to right) 32643, 33113, 33114, 33809, 33362. The predicted 3229 bp SVA product was present in all XDP samples (upper arrow), whereas controls had a product of ∼599 bp (lower arrow), a difference consistent with the size of the SVA. (B) Quantitative expression analysis of TAF1 transcript fragments in XDP vs control fibroblasts ( n =5 each) based on comparative Ct method. Expression levels were normalized to the mean of housekeeping genes HPRT1 and TFRC . Levels of transcript fragments amplified by primer sets TA02-334, TAF1-3′, TA14-385N and TAF1-3′N were significantly lower in XDP vs control cells, whereas expression of the transcript amplified by TA09-693 was significantly increased in XDP vs control samples. The neural-specific transcript, N-TAF1, amplified by primer set TA14-391, as well as all six transcripts incorporating MTS sequences, were not detected in fibroblasts. Data represent mean fold changes±standard errors, analyzed by Student's t -test. * P

Article Snippet: Genotyping Genomic DNA (gDNA) was isolated from cells using DNeasy Blood and Tissue kit (Qiagen, Valencia, CA, USA), as recommended.

Techniques: Expressing, Polymerase Chain Reaction, Amplification

Journal: The Yale Journal of Biology and Medicine

Article Title: Association of Plasmodium falciparum with Human Endothelial Cells in vitro

doi:

Figure Lengend Snippet: Measurement of P. falciparum rRNA and DNA associated with HUVECs by SYBR Green quantitative PCR. P. falciparum infected RBCs were added to HUVEC cell cultures for the indicated times, as described in Materials and Methods. Following these incubations, RNA and genomic DNA were purified from HUVECS. A. P. falciparum SSU rRNA amounts from HUVECs as measured by reverse-transcription qPCR. No PCR products were detected in RNA samples not treated with reverse-transcriptase (data not shown). Error bars represent standard deviation from three independent replicates. B. The SSU rRNA gene was amplified from P. falciparum genomic DNA (gDNA) from HUVECs and measured by qPCR. P. falciparum RNA and DNA amounts were normalized to human GAPDH RNA and DNA amounts, respectively. As a control, HUVECs were incubated with uninfected RBCs. No P. falciparum -specific PCR products were detected (data not shown). All experiments were done in triplicate.

Article Snippet: Total RNA and genomic DNA (gDNA) were purified from HUVEC cells using Trizol reagent (Invitrogen) according to the manufacturer’s instructions.

Techniques: SYBR Green Assay, Real-time Polymerase Chain Reaction, Infection, Purification, Polymerase Chain Reaction, Standard Deviation, Amplification, Incubation

Journal: Clinical chemistry

Article Title: Denaturation-enhanced droplet digital PCR for liquid biopsies

doi: 10.1373/clinchem.2018.293845

Figure Lengend Snippet: For a given DNA input, the number of positive events using dddPCR is twice that of ddPCR, thus improving the relative standard error in the analysis. (A) Demonstration of the concept. (B) ddPCR and dddPCR for BRAF V600E using 10ng of HTB-19 cell line gDNA serially diluted into wild type DNA (WT). Outer bars represent the standard error of the mean for the replicates; the inner error bar is the 95% confidence interval for the Poisson distribution. Each sample is composed of 4 merged replicates. RSE=relative standard error.

Article Snippet: Genomic DNA (gDNA) from cell-line MDA-MB-435S (HTB-129D, ATCC) and the Tru-Q1 Reference Standard (HD728, Horizon Discovery) were used as mutated DNA controls for BRAF p.V600E and NRAS p.Q61K.

Techniques:

Journal: Clinical chemistry

Article Title: Denaturation-enhanced droplet digital PCR for liquid biopsies

doi: 10.1373/clinchem.2018.293845

Figure Lengend Snippet: dddPCR allows the analysis of 2 different targets in independent reactions using the same quantity of DNA used for a single ddPCR reaction and producing similar number of WT and MT copies in each reaction. (A) demonstration of the concept. (B) and (C) Analysis of gDNA HD728 serially diluted in WT DNA using 30ng (ddPCR, non-denatured), or split in two 15ng samples (dddPCR, denatured) as DNA input: BRAF V600E and NRAS Q61K screened, respectively. Undiluted gDNA HD728 contains BRAF V600E and NRAS Q61K mutations at 8% and 5% allelic frequencies, respectively. Error bars represent the 95% confidence interval for the Poisson distribution. The dddPCR results represent merged wells for 2 replicates. The concentration of WT and MT copies obtained were similar for both dddPCR and ddPCR (for WT, P = 0.49, 0.71 and 0.69 for 1:5, 1:20 and 1:50 dilutions, respectively. For MT, P = is 0.79, 0.34 and 0.19, respectively. The differences are not significant).

Article Snippet: Genomic DNA (gDNA) from cell-line MDA-MB-435S (HTB-129D, ATCC) and the Tru-Q1 Reference Standard (HD728, Horizon Discovery) were used as mutated DNA controls for BRAF p.V600E and NRAS p.Q61K.

Techniques: Concentration Assay

Journal: BMC Medical Genomics

Article Title: Digital karyotyping reveals probable target genes at 7q21.3 locus in hepatocellular carcinoma

doi: 10.1186/1755-8794-4-60

Figure Lengend Snippet: Real-time quantitative PCR validation of digital karyotyping data . Totally 52 normal individuals and 52 HCC samples were examined for genomic DNA level of (A) SGCE, (B) PEG10, (C) DYNC1I1 and (D) SLC25A13 respectively by real-time quantitative PCR. The purple horizontal line represented an average of genomic DNA level of each group. HCC samples which gained genomic amplification of examined genes were shown by red squares.

Article Snippet: PCR reaction mixture of 25 μl was composed of 50 ng genomic DNA, 12.5 μl SYBR Premix Ex Taq (TaKaRa), 250 nM of each primer and appropriate volume of ddH2 O.

Techniques: Real-time Polymerase Chain Reaction, Amplification

Journal: Applied and Environmental Microbiology

Article Title: Molecular Characterization of an Endopolygalacturonase from Fusarium oxysporum Expressed during Early Stages of Infection

doi: 10.1128/AEM.67.5.2191-2196.2001

Figure Lengend Snippet: Southern hybridization analysis of RT-PCR products, showing the expression pattern of pg5 during infection of tomato plants by F. oxysporum f. sp. lycopersici . First-strand cDNAs were generated from total RNA isolated at the indicated time points (in hours) from roots and stems of uninfected or infected plants and used as templates for PCR with primers specific for pg5 (see Materials and Methods). Aliquots of the PCR products were electrophoresed on a 2% agarose gel, blotted onto a nylon membrane, and hybridized with the labeled pg5 probe. The position and size (in base pairs) of the pg5 fragment are indicated. The numbers represent days after inoculation. gDNA, genomic DNA.

Article Snippet: Genomic DNA was extracted from F. oxysporum mycelium as described previously , digested with appropriate restriction enzymes, and subjected to Southern hybridization analysis, as described in standard protocols (25), by using a nonisotopic digoxigenin labeling kit (Roche Molecular Biochemicals, Mannheim, Germany) according to the instructions of the manufacturer.

Techniques: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Infection, Generated, Isolation, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Labeling

Journal: FEBS Open Bio

Article Title: Creation of targeted genomic deletions using TALEN or CRISPR/Cas nuclease pairs in one-cell mouse embryos

doi: 10.1016/j.fob.2014.11.009

Figure Lengend Snippet: Germline transmission of Rab38 Δ 9.3 alleles. (A) PCR detection of Rab38 Δ 9.3 alleles using primers P-forA and P-del with tail DNA from pups derived from founder AB3 or AB25. M: size marker, +: positive control, −: negative control. (B) Sequence comparison of cloned PCR products (see A) derived from pups AB3-1 and AB25-2 with the parental Rab38 Δ 9.3 allele.

Article Snippet: For the genotyping of founder mice and their progeny, PCR reactions using 1 μL genomic DNA (∼100 ng) and 1 μL of each appropriate primer (10 μM) was carried out in a total volume of 25 μL using the 5 PRIME Mastermix (5 PRIME GmbH, Hilden, Germany) and PCR steps of: 94 °C – 5 min; {94 °C – 40 s; 60 °C – 40 s; 72 °C – 60 s} for 30 cycles; 72 °C – 10 min. For the detection of TALEN induced deletions we used the primer pair P-forA (AAGCTCCAGGCTCCGCAAGAC) and P-revA (CCGAACTCCTCACTGGCTCAC) to amplify the TALEN-A1/2 region, the primer pair P-forB (AATGCTACTGTGTTTGCCTTGG) and P-del (CATCTCAAATGTTGGGATCACAAG) to amplify the TALEN-B1/2 region and the primers P-forA and P-del to detect Rab38 Δ 9.3 alleles.

Techniques: Transmission Assay, Polymerase Chain Reaction, Derivative Assay, Marker, Positive Control, Negative Control, Sequencing, Clone Assay

Journal: FEBS Open Bio

Article Title: Creation of targeted genomic deletions using TALEN or CRISPR/Cas nuclease pairs in one-cell mouse embryos

doi: 10.1016/j.fob.2014.11.009

Figure Lengend Snippet: Deletion of a 3.2 kb Rab38 gene segment in one-cell embryos using Cas9 and two sgRNAs. (A) PCR detection of Rab38 Δ 3.2 alleles (primers P-for2 and P-del3) and of Rab38 wt alleles (primers P-for2 and P-rev2, spanning exon 1) with tail DNA from 27 pups derived from embryos microinjected with sgRab38-2, -3 and Cas9 RNAs. Upper gel image: Eight founders show PCR bands of ∼326 bp (primers P-forA/P-del3) indicating the presence of Rab38 Δ 3.2 alleles; founders #9 and #23 exhibit unexpected, larger PCR products. Lower gel image: from the founders #6, #8 and #23 the region covering exon 1 of Rab38 could not be amplified, suggesting that both gene copies were processed by Cas9. M: size marker, +: positive control, −: negative control. (B) Sequence comparison of cloned PCR products derived from mutant founders (see A) with the genomic sgRNA target regions of Rab38 and the ODNΔ2/3 (sequence insert underlined). The sequencing of 3–5 clones from each founder revealed in six founders the presence of two mutant alleles. The number of clones classified as type a or b allele is shown in brackets. The deletion endpoints are either located at the DSB site 3 bp upstream of the sgRNA’s PAM sequence (red arrows) or show the loss of additional nucleotides, leading to the disruption of the Rab38 reading frame between codon 34 and 37. In the aberrant alleles #9b and #23b the deleted 3.2 kb region was replaced by sequence inserts of 398 bp (#9b) or 163 bp (#23b) that are derived from the Rab38 gene, located upstream (#9b) or downstream (#23b) of the sgRab38-3 target sequence. (C) Comparison of the coat color of founder #8 and #23 with an agouti colored littermate control ( Rab38 WT ) and of dorsal awls showing the reduced pigmentation of hairs in founder #8 (right insert; 40× magnification). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: For the genotyping of founder mice and their progeny, PCR reactions using 1 μL genomic DNA (∼100 ng) and 1 μL of each appropriate primer (10 μM) was carried out in a total volume of 25 μL using the 5 PRIME Mastermix (5 PRIME GmbH, Hilden, Germany) and PCR steps of: 94 °C – 5 min; {94 °C – 40 s; 60 °C – 40 s; 72 °C – 60 s} for 30 cycles; 72 °C – 10 min. For the detection of TALEN induced deletions we used the primer pair P-forA (AAGCTCCAGGCTCCGCAAGAC) and P-revA (CCGAACTCCTCACTGGCTCAC) to amplify the TALEN-A1/2 region, the primer pair P-forB (AATGCTACTGTGTTTGCCTTGG) and P-del (CATCTCAAATGTTGGGATCACAAG) to amplify the TALEN-B1/2 region and the primers P-forA and P-del to detect Rab38 Δ 9.3 alleles.

Techniques: Polymerase Chain Reaction, Derivative Assay, Amplification, Marker, Positive Control, Negative Control, Sequencing, Clone Assay, Mutagenesis

Journal: FEBS Open Bio

Article Title: Creation of targeted genomic deletions using TALEN or CRISPR/Cas nuclease pairs in one-cell mouse embryos

doi: 10.1016/j.fob.2014.11.009

Figure Lengend Snippet: Germline transmission of Rab38 Δ 3.2 alleles. (A) PCR detection of Rab38 Δ 3.2 alleles (primers P-for/P-del3) using tail DNA from pups derived from matings of the indicated mutant founders with wildtype mice. M: size marker, +: positive control, −: negative control. (B) Sequence comparison of PCR products (see A) obtained from the indicated pups with the parental Rab38 Δ 3.2 alleles. The number of deleted basepairs is indicated.

Article Snippet: For the genotyping of founder mice and their progeny, PCR reactions using 1 μL genomic DNA (∼100 ng) and 1 μL of each appropriate primer (10 μM) was carried out in a total volume of 25 μL using the 5 PRIME Mastermix (5 PRIME GmbH, Hilden, Germany) and PCR steps of: 94 °C – 5 min; {94 °C – 40 s; 60 °C – 40 s; 72 °C – 60 s} for 30 cycles; 72 °C – 10 min. For the detection of TALEN induced deletions we used the primer pair P-forA (AAGCTCCAGGCTCCGCAAGAC) and P-revA (CCGAACTCCTCACTGGCTCAC) to amplify the TALEN-A1/2 region, the primer pair P-forB (AATGCTACTGTGTTTGCCTTGG) and P-del (CATCTCAAATGTTGGGATCACAAG) to amplify the TALEN-B1/2 region and the primers P-forA and P-del to detect Rab38 Δ 9.3 alleles.

Techniques: Transmission Assay, Polymerase Chain Reaction, Derivative Assay, Mutagenesis, Mouse Assay, Marker, Positive Control, Negative Control, Sequencing

Journal: FEBS Open Bio

Article Title: Creation of targeted genomic deletions using TALEN or CRISPR/Cas nuclease pairs in one-cell mouse embryos

doi: 10.1016/j.fob.2014.11.009

Figure Lengend Snippet: Deletion of a 9.3 kb Rab38 gene segment in one-cell embryos using two pairs of TALEN. (A) Schematic diagram of the Rab38 gene and the planned deletion of 9.3 kb ( Rab38 Δ 9.3 allele), indicating the position of the first exon, of the TALEN recognition sites and PCR primer pairs. (B) PCR detection of Rab38 Δ 9.3 alleles using primers P-forA and P-del using tail DNA from 31 pups derived from embryos microinjected with TAL-A1/2 and TAL-B1/2 mRNAs. M: size marker, +: positive control, −: negative control. (C) Sequence comparison of cloned PCR products from founders AB3 and AB25 with the Rab38 wildtype locus, indicating identical deletions of 9355 bp in both founders. The deletion endpoints are located within the TALEN spacer regions. The upstream deletion endpoint disrupts codon 31, followed by a random translational frame. (D) PCR analysis of the TAL-A1/2 target region with tail DNA from 31 pups derived from microinjected embryos using primers P-forA and P-revA. The PCR products amplified from the second Rab38 allele of founders AB3 and AB25 show reduced size, indicating the presence of small deletions. (E) Sequence analysis of cloned PCR products (see D) showing the deletion of 11 bp or of 25 bp within the TAL-A1/2 target region of the second Rab38 allele of founder AB3 or AB25, respectively. The translation of the TAL-A1/2 target sequence within the first exon of Rab38 shows reading frameshifts after codon 31 (AB3) or 27 (AB25). (F) Comparison of the coat color of founder AB25 with an agouti colored littermate control ( Rab38 wt ) and of dorsal awls showing the reduced pigmentation of hairs in the mutant (20× magnification). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: For the genotyping of founder mice and their progeny, PCR reactions using 1 μL genomic DNA (∼100 ng) and 1 μL of each appropriate primer (10 μM) was carried out in a total volume of 25 μL using the 5 PRIME Mastermix (5 PRIME GmbH, Hilden, Germany) and PCR steps of: 94 °C – 5 min; {94 °C – 40 s; 60 °C – 40 s; 72 °C – 60 s} for 30 cycles; 72 °C – 10 min. For the detection of TALEN induced deletions we used the primer pair P-forA (AAGCTCCAGGCTCCGCAAGAC) and P-revA (CCGAACTCCTCACTGGCTCAC) to amplify the TALEN-A1/2 region, the primer pair P-forB (AATGCTACTGTGTTTGCCTTGG) and P-del (CATCTCAAATGTTGGGATCACAAG) to amplify the TALEN-B1/2 region and the primers P-forA and P-del to detect Rab38 Δ 9.3 alleles.

Techniques: Polymerase Chain Reaction, Derivative Assay, Marker, Positive Control, Negative Control, Sequencing, Clone Assay, Amplification, Mutagenesis

Journal: BMC Genomics

Article Title: Lost in plasmids: next generation sequencing and the complex genome of the tick-borne pathogen Borrelia burgdorferi

doi: 10.1186/s12864-017-3804-5

Figure Lengend Snippet: Visualization of assemblies of cp32-1 of B31-NRZ aligned to the reference B31-GB. De novo assembly of total genomic DNA sequenced from a TS library preparation ( purple color , labelled TS library). The alignment shows several gaps covering only three quarter of the plasmid. Using enriched plasmid DNA for NX library construction followed by de novo assembly in the CLC Genomics workbench ( red color , plasmid ( de novo )), the size of gaps was reduced. Read mapping of Illumina reads on B31-GB using enriched plasmid DNA for NX library construction ( blue color , plasmid (read mapping)) produced a gapless alignment of reads to the reference. De novo assemblies of Pacific Bioscience SMRT sequences ( torquois color , SMRT Bell library) showed complete coverage of the cp32-1 plasmid. The image shows the larger size of the SMRT assembly with a gap appearing around 17 kb which likely reflect the differences observed between B31-NRZ and B31-GB. Different shades of coloration in one panel indicate different identities between aligned sequences. Regions with lighter shades correspond to less sequence similarity (see region app. 3.5 kbp to 4.0 kbp in de novo assembly using enriched plasmids)

Article Snippet: DNA purification, plasmid enrichment and library construction To generate genomic DNA for Illumina sequencing, Borrelia strains were cultured in MKP medium using conditions as described previously [ ].

Techniques: Plasmid Preparation, Produced, Sequencing

Journal: BMC Genomics

Article Title: Lost in plasmids: next generation sequencing and the complex genome of the tick-borne pathogen Borrelia burgdorferi

doi: 10.1186/s12864-017-3804-5

Figure Lengend Snippet: Visualization of assemblies of lp17 in PAbe aligned to the reference B31-GB using BRIG. Total genomic DNA was used for TS library preparation ( purple color , labelled TS library). A spurious gap in the region from 0 to 2.5 kb is visible. Using enriched plasmid DNA for NX library construction improved the assembly and a smaller gap at 16–17 kb is visible ( red color , labelled plasmid ( de novo )). Not surprinsingly, read mapping of Illumina reads on B31-GB using enriched plasmid DNA for library construction showed complete coverage suggesting that reads for the complete plasmid existed but were not assembled de novo ( blue color , labelled plasmid readmapping). De novo assemblies of Pacific Bioscience SMRT sequences showed complete coverage of lp17 confirming that the complete plasmid was present in PAbe and that the gaps presenting in de novo assemblies of short reads were artefacts either of library construction or short read assembly ( torquois color , labelled SMRT Bell library)

Article Snippet: DNA purification, plasmid enrichment and library construction To generate genomic DNA for Illumina sequencing, Borrelia strains were cultured in MKP medium using conditions as described previously [ ].

Techniques: Plasmid Preparation

Journal: Nature Communications

Article Title: Wnt-PLC-IP3-Connexin-Ca2+ axis maintains ependymal motile cilia in zebrafish spinal cord

doi: 10.1038/s41467-020-15248-2

Figure Lengend Snippet: c x43 null zebrafish have reduced motile cilia in ECs. a Electropherograms of the target sequences of the cx43 gDNA in WT and cx43 −/− zebrafish. Arrow indicates the deletion of the T nucleotide. b Zebrafish ( n = 71) at 2 months post-fertilization (mpf) from mating of cx43 +/− zebrafish were genotyped for cx43 . c Images of 3 mpf zebrafish with the indicated cx43 genotype. d WT or cx43 −/− embryos at 2 dpf were immunostained with anti-acetylated-α-tubulin antibody, imaged with a confocal microscope and genotyped for cx43 . Arrowheads represent motile cilia. Dorsal view anterior to the left. Scale bar = 20 μm. e Larvae at 8 dpf from mating of cx43 +/− zebrafish were cut into cranial and caudal halves. The cranial half was used for cx43 genotyping, and the caudal half was coronally sectioned at a thickness of 14 μm and then processed for IF staining with anti-acetylated-α-tubulin antibody. Arrowheads represent motile cilia. Dorsal view anterior to the left. Scale bar = 30 μm. f Quantification of the number of cilia per frame in embryos in e . Mean ± SD. **** P

Article Snippet: For mice genotyping, gDNA was extracted from mice ear punches using a Wizard Genomic DNA Purification Kit as per the manufacturer’s instructions (Promega).

Techniques: Microscopy, Staining

Journal: Stem Cell Reports

Article Title: Murine iPSC-Derived Macrophages as a Tool for Disease Modeling of Hereditary Pulmonary Alveolar Proteinosis due to Csf2rb Deficiency

doi: 10.1016/j.stemcr.2016.06.011

Figure Lengend Snippet: Characterization of Disease-Specific iPSCs from Csf2rb −/− Mice (A and B) ESC-like morphology in bright-field images (A) and positive alkaline phosphatase staining of miPAP1 iPSCs (B). Scale bar, 200 μm. (C) NANOG, OCT4, and SOX2 expression by immunofluorescence staining (C; scale bar, 50 μm) as well as by (D) qRT-PCR using murine-specific primers (independent experiments, n = 3, mean ± SD). ns, not significant compared with ESCs, two-way ANOVA. (E) Representative flow cytometry plot revealing expression of the SSEA-1 surface marker. (F) Representative pictures of miPAP1-derived teratomas containing tissues of all three embryonic germ layers. Scale bar, 50 μm for ectoderm and endoderm; 100 μm for mesoderm. (G) Scheme and gel electrophoresis of PCR on genomic DNA for genotyping miPAP clones.

Article Snippet: PCR on Genomic DNA Genomic DNA (gDNA) was isolated from tissues or iPSCs using the Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich) according to the manufacturer's instructions.

Techniques: Mouse Assay, Staining, Expressing, Immunofluorescence, Quantitative RT-PCR, Flow Cytometry, Cytometry, Marker, Derivative Assay, Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Clone Assay

Journal: PLoS ONE

Article Title: Circulating cell-free DNA from plasma undergoes less fragmentation during bisulfite treatment than genomic DNA due to low molecular weight

doi: 10.1371/journal.pone.0224338

Figure Lengend Snippet: Agarose gel of PCR product and bis-treated PCR product following (A) 15 minutes and (B) 40 minutes of electrophoresis. Size of each PCR product is as indicated. gDNA–untreated genomic DNA; bis gDNA–bis-treated genomic DNA.

Article Snippet: Human genomic DNA (gDNA) purchased from Roche (Cat #11691112001) and stored at 4°C as specified by the manufacturer was used as the high molecular weight DNA sample.

Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Electrophoresis

Journal: PLoS ONE

Article Title: Circulating cell-free DNA from plasma undergoes less fragmentation during bisulfite treatment than genomic DNA due to low molecular weight

doi: 10.1371/journal.pone.0224338

Figure Lengend Snippet: Agarose gel of cirDNA and bis-treated cirDNA following (A) 15 minutes and (B) 40 minutes of electrophoresis. The amount of cirDNA in each lane corresponds to the total cirDNA extracted from the plasma volumes indicated. gDNA–untreated genomic DNA.

Article Snippet: Human genomic DNA (gDNA) purchased from Roche (Cat #11691112001) and stored at 4°C as specified by the manufacturer was used as the high molecular weight DNA sample.

Techniques: Agarose Gel Electrophoresis, Electrophoresis

Journal: mSystems

Article Title: Impact of Sample Type and DNA Isolation Procedure on Genomic Inference of Microbiome Composition

doi: 10.1128/mSystems.00095-16

Figure Lengend Snippet: Comparison of DNA extraction methods. (A) Experimental design. Human feces, pig feces, and hospital sewage were extracted using seven different DNA extraction methods ( Table 1 ): InnuPure C16, MagNA Pure LC DNA isolation kit III, Easy-DNA gDNA purification kit, MP FastDNA Spin kit, PowerSoil DNA isolation kit, QIAamp DNA stool minikit, and QIAamp DNA stool minikit plus bead beating (for details, see Materials and Methods). DNA concentration, purity, and stability were examined, and microbial community composition was determined using 16S rRNA gene profiling and metagenomics (selected samples). (B) DNA from each method was dissolved in 100 µl solution, and DNA concentrations were determined using Qubit dsDNA BR assay kit measurements. Values represent averages from duplicate or triplicate DNA extractions (see also Table S1A in the supplemental material). (C) Ecological richness (Chao 1) and diversity (Shannon index) were determined based on contingency tables from 16S rRNA gene profiling and metagenomic sequencing data at OTU and species levels, respectively (see also Table S1B ).

Article Snippet: In a first step, seven DNA isolation procedures were examined, namely, InnuPure C16 from Analytic Jena AG (InnuPure), MagNA Pure LC DNA isolation kit III from Roche (MagNA Pure), Easy-DNA genomic DNA (gDNA) purification kit from Invitrogen (Easy-DNA), MP FastDNA Spin kit from MP Biomedicals (FastDNA), PowerSoil DNA isolation kit from MoBio (PowerSoil.HMP), QIAamp DNA stool minikit from Qiagen (QIAStool), and QIAamp DNA stool minikit plus bead beating from Qiagen (QIAStool+BB) ( and details below).

Techniques: DNA Extraction, Purification, Concentration Assay, Sequencing

Journal: Nucleic Acids Research

Article Title: A novel NGS library preparation method to characterize native termini of fragmented DNA

doi: 10.1093/nar/gkaa128

Figure Lengend Snippet: . Overhangs created by enzymatic DNA shearing. Overhang counts, base composition of overhangs, and overhang sequences in a gDNA pool treated with the DNaseI ( A – C ) and Micrococcal nuclease ( D – F ). Input DNA for all libraries is human genomic DNA extracted from GM12878 cells. All results are the average of two independent libraries; error bars on the overhang abundance plots show maximum and minimum value. In c and f, we computed the difference between the normalized 3′ and 5′ count of each overhang sequence, divided by the mean of the two counts. Shown in text in C and F are sequences for which this value was significant (above the upper 99th percentile of the distribution).

Article Snippet: NA12878 genomic DNA (gDNA) NA12878 gDNA was purchased from the Coriell Institute for Medical Research, was prepared for XACTLY ligation in several ways.

Techniques: Sequencing