genomic dna gdna Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Kapa Biosystems gdna
    Gdna, supplied by Kapa Biosystems, used in various techniques. Bioz Stars score: 98/100, based on 358 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gdna/product/Kapa Biosystems
    Average 98 stars, based on 358 article reviews
    Price from $9.99 to $1999.99
    gdna - by Bioz Stars, 2021-01
    98/100 stars
      Buy from Supplier

    99
    Zymo Research quick gdna miniprep kit
    Quick Gdna Miniprep Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1235 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quick gdna miniprep kit/product/Zymo Research
    Average 99 stars, based on 1235 article reviews
    Price from $9.99 to $1999.99
    quick gdna miniprep kit - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    99
    TaKaRa gdna eraser
    Gdna Eraser, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 32696 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gdna eraser/product/TaKaRa
    Average 99 stars, based on 32696 article reviews
    Price from $9.99 to $1999.99
    gdna eraser - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    92
    Toyobo gdna remover
    Genomic imprinting recapitulated in LCb118 knock-in mice. a Breeding scheme. In order to distinguish parental origin of the alleles by using SNPs between inbred mouse strains, endo-LCb118 homo-knock-in mice (LCb118/LCb118; C57BL/6 J [B6] background) were mated with wild-type mice ( H19 ICR/ H19 ICR; JF1/Msf [JF1]), and offspring was obtained. b – d Livers from two pairs of E18.5 embryos, each inheriting the knock-in allele either paternally (pat.; P) or maternally (mat.; M) were used for genomic DNA, total RNA, and chromatin preparations, as in Fig. 6 . b DNA methylation status of LCb118 region (the same position as in Fig. 7 a) was analyzed by bisulfite sequencing. c ChIP analysis of CTCF occupancy at the LCb118 sequence. Chromatin was immunoprecipitated using either control IgG or anti-CTCF antibodies. Following <t>qPCR</t> analyses of three distinct genomic regions ( Necdin ; negative control, endogenous H19 ICR; positive control, and LCb118), relative enrichment values (CTCF/IgG signal ratio) were calculated. The average and standard deviation (S.D.), determined by three reactions, are depicted. Statistical differences were determined using an unpaired t test (N.S., not significant). d The allele-specific expression of the Igf2 and H19 genes was examined by RFLP analysis. Igf2 and H19 gene transcripts were amplified by RT-PCR followed by BstUI or Cac8I digestions, respectively. Parental origin of transcripts was discriminated by allele-specific restriction sites. The sites were also introduced into primer sequence so that complete digestion of PCR products can be concomitantly monitored. e Schematic representation of the genomic imprinting recapitulated in the LCb118 knock-in allele. f Hypothetical model for post-fertilization methylation maintenance mechanism at the Igf2/H19 locus
    Gdna Remover, supplied by Toyobo, used in various techniques. Bioz Stars score: 92/100, based on 3213 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gdna remover/product/Toyobo
    Average 92 stars, based on 3213 article reviews
    Price from $9.99 to $1999.99
    gdna remover - by Bioz Stars, 2021-01
    92/100 stars
      Buy from Supplier

    99
    Thermo Fisher gdna
    Genomic imprinting recapitulated in LCb118 knock-in mice. a Breeding scheme. In order to distinguish parental origin of the alleles by using SNPs between inbred mouse strains, endo-LCb118 homo-knock-in mice (LCb118/LCb118; C57BL/6 J [B6] background) were mated with wild-type mice ( H19 ICR/ H19 ICR; JF1/Msf [JF1]), and offspring was obtained. b – d Livers from two pairs of E18.5 embryos, each inheriting the knock-in allele either paternally (pat.; P) or maternally (mat.; M) were used for genomic DNA, total RNA, and chromatin preparations, as in Fig. 6 . b DNA methylation status of LCb118 region (the same position as in Fig. 7 a) was analyzed by bisulfite sequencing. c ChIP analysis of CTCF occupancy at the LCb118 sequence. Chromatin was immunoprecipitated using either control IgG or anti-CTCF antibodies. Following <t>qPCR</t> analyses of three distinct genomic regions ( Necdin ; negative control, endogenous H19 ICR; positive control, and LCb118), relative enrichment values (CTCF/IgG signal ratio) were calculated. The average and standard deviation (S.D.), determined by three reactions, are depicted. Statistical differences were determined using an unpaired t test (N.S., not significant). d The allele-specific expression of the Igf2 and H19 genes was examined by RFLP analysis. Igf2 and H19 gene transcripts were amplified by RT-PCR followed by BstUI or Cac8I digestions, respectively. Parental origin of transcripts was discriminated by allele-specific restriction sites. The sites were also introduced into primer sequence so that complete digestion of PCR products can be concomitantly monitored. e Schematic representation of the genomic imprinting recapitulated in the LCb118 knock-in allele. f Hypothetical model for post-fertilization methylation maintenance mechanism at the Igf2/H19 locus
    Gdna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 9495 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gdna/product/Thermo Fisher
    Average 99 stars, based on 9495 article reviews
    Price from $9.99 to $1999.99
    gdna - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher genomic dna gdna
    Genomic imprinting recapitulated in LCb118 knock-in mice. a Breeding scheme. In order to distinguish parental origin of the alleles by using SNPs between inbred mouse strains, endo-LCb118 homo-knock-in mice (LCb118/LCb118; C57BL/6 J [B6] background) were mated with wild-type mice ( H19 ICR/ H19 ICR; JF1/Msf [JF1]), and offspring was obtained. b – d Livers from two pairs of E18.5 embryos, each inheriting the knock-in allele either paternally (pat.; P) or maternally (mat.; M) were used for genomic DNA, total RNA, and chromatin preparations, as in Fig. 6 . b DNA methylation status of LCb118 region (the same position as in Fig. 7 a) was analyzed by bisulfite sequencing. c ChIP analysis of CTCF occupancy at the LCb118 sequence. Chromatin was immunoprecipitated using either control IgG or anti-CTCF antibodies. Following <t>qPCR</t> analyses of three distinct genomic regions ( Necdin ; negative control, endogenous H19 ICR; positive control, and LCb118), relative enrichment values (CTCF/IgG signal ratio) were calculated. The average and standard deviation (S.D.), determined by three reactions, are depicted. Statistical differences were determined using an unpaired t test (N.S., not significant). d The allele-specific expression of the Igf2 and H19 genes was examined by RFLP analysis. Igf2 and H19 gene transcripts were amplified by RT-PCR followed by BstUI or Cac8I digestions, respectively. Parental origin of transcripts was discriminated by allele-specific restriction sites. The sites were also introduced into primer sequence so that complete digestion of PCR products can be concomitantly monitored. e Schematic representation of the genomic imprinting recapitulated in the LCb118 knock-in allele. f Hypothetical model for post-fertilization methylation maintenance mechanism at the Igf2/H19 locus
    Genomic Dna Gdna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1174 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/Thermo Fisher
    Average 99 stars, based on 1174 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    91
    TransGen biotech co transscript one step gdna removal
    Genomic imprinting recapitulated in LCb118 knock-in mice. a Breeding scheme. In order to distinguish parental origin of the alleles by using SNPs between inbred mouse strains, endo-LCb118 homo-knock-in mice (LCb118/LCb118; C57BL/6 J [B6] background) were mated with wild-type mice ( H19 ICR/ H19 ICR; JF1/Msf [JF1]), and offspring was obtained. b – d Livers from two pairs of E18.5 embryos, each inheriting the knock-in allele either paternally (pat.; P) or maternally (mat.; M) were used for genomic DNA, total RNA, and chromatin preparations, as in Fig. 6 . b DNA methylation status of LCb118 region (the same position as in Fig. 7 a) was analyzed by bisulfite sequencing. c ChIP analysis of CTCF occupancy at the LCb118 sequence. Chromatin was immunoprecipitated using either control IgG or anti-CTCF antibodies. Following <t>qPCR</t> analyses of three distinct genomic regions ( Necdin ; negative control, endogenous H19 ICR; positive control, and LCb118), relative enrichment values (CTCF/IgG signal ratio) were calculated. The average and standard deviation (S.D.), determined by three reactions, are depicted. Statistical differences were determined using an unpaired t test (N.S., not significant). d The allele-specific expression of the Igf2 and H19 genes was examined by RFLP analysis. Igf2 and H19 gene transcripts were amplified by RT-PCR followed by BstUI or Cac8I digestions, respectively. Parental origin of transcripts was discriminated by allele-specific restriction sites. The sites were also introduced into primer sequence so that complete digestion of PCR products can be concomitantly monitored. e Schematic representation of the genomic imprinting recapitulated in the LCb118 knock-in allele. f Hypothetical model for post-fertilization methylation maintenance mechanism at the Igf2/H19 locus
    Transscript One Step Gdna Removal, supplied by TransGen biotech co, used in various techniques. Bioz Stars score: 91/100, based on 947 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transscript one step gdna removal/product/TransGen biotech co
    Average 91 stars, based on 947 article reviews
    Price from $9.99 to $1999.99
    transscript one step gdna removal - by Bioz Stars, 2021-01
    91/100 stars
      Buy from Supplier

    90
    Toyobo gdna remover kit
    Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared <t>cDNA</t> samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).
    Gdna Remover Kit, supplied by Toyobo, used in various techniques. Bioz Stars score: 90/100, based on 668 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gdna remover kit/product/Toyobo
    Average 90 stars, based on 668 article reviews
    Price from $9.99 to $1999.99
    gdna remover kit - by Bioz Stars, 2021-01
    90/100 stars
      Buy from Supplier

    99
    Bio-Rad iscript gdna clear cdna synthesis kit
    Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared <t>cDNA</t> samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).
    Iscript Gdna Clear Cdna Synthesis Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 406 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iscript gdna clear cdna synthesis kit/product/Bio-Rad
    Average 99 stars, based on 406 article reviews
    Price from $9.99 to $1999.99
    iscript gdna clear cdna synthesis kit - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher easy dna kit
    Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared <t>cDNA</t> samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).
    Easy Dna Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2198 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/easy dna kit/product/Thermo Fisher
    Average 99 stars, based on 2198 article reviews
    Price from $9.99 to $1999.99
    easy dna kit - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    99
    Millipore gdna
    Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared <t>cDNA</t> samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).
    Gdna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1013 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gdna/product/Millipore
    Average 99 stars, based on 1013 article reviews
    Price from $9.99 to $1999.99
    gdna - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher iprep purelink gdna blood kit
    Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared <t>cDNA</t> samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).
    Iprep Purelink Gdna Blood Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 159 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iprep purelink gdna blood kit/product/Thermo Fisher
    Average 99 stars, based on 159 article reviews
    Price from $9.99 to $1999.99
    iprep purelink gdna blood kit - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    92
    Zymo Research gdna
    Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared <t>cDNA</t> samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).
    Gdna, supplied by Zymo Research, used in various techniques. Bioz Stars score: 92/100, based on 1349 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gdna/product/Zymo Research
    Average 92 stars, based on 1349 article reviews
    Price from $9.99 to $1999.99
    gdna - by Bioz Stars, 2021-01
    92/100 stars
      Buy from Supplier

    99
    Zymo Research quick gdna miniprep
    Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared <t>cDNA</t> samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).
    Quick Gdna Miniprep, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 314 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quick gdna miniprep/product/Zymo Research
    Average 99 stars, based on 314 article reviews
    Price from $9.99 to $1999.99
    quick gdna miniprep - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    99
    Millipore genomic dna gdna
    Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared <t>cDNA</t> samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).
    Genomic Dna Gdna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 531 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/Millipore
    Average 99 stars, based on 531 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher chargeswitch gdna mini tissue kit
    Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared <t>cDNA</t> samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).
    Chargeswitch Gdna Mini Tissue Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 160 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chargeswitch gdna mini tissue kit/product/Thermo Fisher
    Average 99 stars, based on 160 article reviews
    Price from $9.99 to $1999.99
    chargeswitch gdna mini tissue kit - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    99
    Zymo Research genomic dna gdna
    Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared <t>cDNA</t> samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).
    Genomic Dna Gdna, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 281 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/Zymo Research
    Average 99 stars, based on 281 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    95
    Thermo Fisher chargeswitch gdna mini bacteria kit
    Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared <t>cDNA</t> samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).
    Chargeswitch Gdna Mini Bacteria Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 181 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chargeswitch gdna mini bacteria kit/product/Thermo Fisher
    Average 95 stars, based on 181 article reviews
    Price from $9.99 to $1999.99
    chargeswitch gdna mini bacteria kit - by Bioz Stars, 2021-01
    95/100 stars
      Buy from Supplier

    N/A
    Standard format Plasmid sent in bacteria as agar stab
      Buy from Supplier

    N/A
    Standard format Plasmid sent in bacteria as agar stab
      Buy from Supplier

    N/A
    PCR DNA hybridization enzyme manipulation cloning Southern blot and array based experiments 50 assays
      Buy from Supplier

    N/A
    Standard format Plasmid sent in bacteria as agar stab
      Buy from Supplier

    Image Search Results


    Genomic imprinting recapitulated in LCb118 knock-in mice. a Breeding scheme. In order to distinguish parental origin of the alleles by using SNPs between inbred mouse strains, endo-LCb118 homo-knock-in mice (LCb118/LCb118; C57BL/6 J [B6] background) were mated with wild-type mice ( H19 ICR/ H19 ICR; JF1/Msf [JF1]), and offspring was obtained. b – d Livers from two pairs of E18.5 embryos, each inheriting the knock-in allele either paternally (pat.; P) or maternally (mat.; M) were used for genomic DNA, total RNA, and chromatin preparations, as in Fig. 6 . b DNA methylation status of LCb118 region (the same position as in Fig. 7 a) was analyzed by bisulfite sequencing. c ChIP analysis of CTCF occupancy at the LCb118 sequence. Chromatin was immunoprecipitated using either control IgG or anti-CTCF antibodies. Following qPCR analyses of three distinct genomic regions ( Necdin ; negative control, endogenous H19 ICR; positive control, and LCb118), relative enrichment values (CTCF/IgG signal ratio) were calculated. The average and standard deviation (S.D.), determined by three reactions, are depicted. Statistical differences were determined using an unpaired t test (N.S., not significant). d The allele-specific expression of the Igf2 and H19 genes was examined by RFLP analysis. Igf2 and H19 gene transcripts were amplified by RT-PCR followed by BstUI or Cac8I digestions, respectively. Parental origin of transcripts was discriminated by allele-specific restriction sites. The sites were also introduced into primer sequence so that complete digestion of PCR products can be concomitantly monitored. e Schematic representation of the genomic imprinting recapitulated in the LCb118 knock-in allele. f Hypothetical model for post-fertilization methylation maintenance mechanism at the Igf2/H19 locus

    Journal: Epigenetics & Chromatin

    Article Title: Recapitulation of gametic DNA methylation and its post-fertilization maintenance with reassembled DNA elements at the mouse Igf2/H19 locus

    doi: 10.1186/s13072-019-0326-1

    Figure Lengend Snippet: Genomic imprinting recapitulated in LCb118 knock-in mice. a Breeding scheme. In order to distinguish parental origin of the alleles by using SNPs between inbred mouse strains, endo-LCb118 homo-knock-in mice (LCb118/LCb118; C57BL/6 J [B6] background) were mated with wild-type mice ( H19 ICR/ H19 ICR; JF1/Msf [JF1]), and offspring was obtained. b – d Livers from two pairs of E18.5 embryos, each inheriting the knock-in allele either paternally (pat.; P) or maternally (mat.; M) were used for genomic DNA, total RNA, and chromatin preparations, as in Fig. 6 . b DNA methylation status of LCb118 region (the same position as in Fig. 7 a) was analyzed by bisulfite sequencing. c ChIP analysis of CTCF occupancy at the LCb118 sequence. Chromatin was immunoprecipitated using either control IgG or anti-CTCF antibodies. Following qPCR analyses of three distinct genomic regions ( Necdin ; negative control, endogenous H19 ICR; positive control, and LCb118), relative enrichment values (CTCF/IgG signal ratio) were calculated. The average and standard deviation (S.D.), determined by three reactions, are depicted. Statistical differences were determined using an unpaired t test (N.S., not significant). d The allele-specific expression of the Igf2 and H19 genes was examined by RFLP analysis. Igf2 and H19 gene transcripts were amplified by RT-PCR followed by BstUI or Cac8I digestions, respectively. Parental origin of transcripts was discriminated by allele-specific restriction sites. The sites were also introduced into primer sequence so that complete digestion of PCR products can be concomitantly monitored. e Schematic representation of the genomic imprinting recapitulated in the LCb118 knock-in allele. f Hypothetical model for post-fertilization methylation maintenance mechanism at the Igf2/H19 locus

    Article Snippet: RT-qPCR Total RNA was recovered from phenylhydrazine treated anaemic adult spleens (1–2 months old) of LCb118 YAC TgM using ISOGEN (Nippon Gene) and converted to cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO).

    Techniques: Knock-In, Mouse Assay, DNA Methylation Assay, Methylation Sequencing, Chromatin Immunoprecipitation, Sequencing, Immunoprecipitation, Real-time Polymerase Chain Reaction, Negative Control, Positive Control, Standard Deviation, Expressing, Amplification, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Methylation

    Genomic imprinting recapitulated in the LCb118 YAC-TgM. a – c Two pairs of LCb118-TgM (ID No. 2601/2602 and 2633/2640), each inheriting the transgene either paternally (P) or maternally (M) were made anaemic and spleens were removed, from which one-quarter each was used for genomic DNA or total RNA preparation with the remaining half used for chromatin preparation. a DNA methylation status of the transgene was determined by Southern blot analysis using BamHI with (+) or without (−) BstUI (vertical lines) and a λ probe. *: methylated, uncut fragments in BstUI (+) lanes. b ChIP analysis of CTCF occupancy at the transgene. Chromatin was immunoprecipitated using either control IgG or anti-CTCF antibodies. Following qPCR analyses of three distinct genomic regions ( Necdin ; negative control, endogenous H19 ICR; positive control, and LCb118 transgene), relative enrichment values (CTCF/IgG signal ratio) were calculated. The average and standard deviation (S.D.), determined by three reactions, are depicted, as a signal for Necdin (M) was arbitrary set at 1.0. Statistical differences were determined using an unpaired t test (N.S., not significant). c The relative expression levels of the human β-globin gene, after normalization to that of the endogenous mouse α-globin gene were determined by RT-qPCR analysis. The average and standard deviation (S.D.), determined by three reactions, are depicted, as a value of No. 2640 animal was arbitrary set at 1.0

    Journal: Epigenetics & Chromatin

    Article Title: Recapitulation of gametic DNA methylation and its post-fertilization maintenance with reassembled DNA elements at the mouse Igf2/H19 locus

    doi: 10.1186/s13072-019-0326-1

    Figure Lengend Snippet: Genomic imprinting recapitulated in the LCb118 YAC-TgM. a – c Two pairs of LCb118-TgM (ID No. 2601/2602 and 2633/2640), each inheriting the transgene either paternally (P) or maternally (M) were made anaemic and spleens were removed, from which one-quarter each was used for genomic DNA or total RNA preparation with the remaining half used for chromatin preparation. a DNA methylation status of the transgene was determined by Southern blot analysis using BamHI with (+) or without (−) BstUI (vertical lines) and a λ probe. *: methylated, uncut fragments in BstUI (+) lanes. b ChIP analysis of CTCF occupancy at the transgene. Chromatin was immunoprecipitated using either control IgG or anti-CTCF antibodies. Following qPCR analyses of three distinct genomic regions ( Necdin ; negative control, endogenous H19 ICR; positive control, and LCb118 transgene), relative enrichment values (CTCF/IgG signal ratio) were calculated. The average and standard deviation (S.D.), determined by three reactions, are depicted, as a signal for Necdin (M) was arbitrary set at 1.0. Statistical differences were determined using an unpaired t test (N.S., not significant). c The relative expression levels of the human β-globin gene, after normalization to that of the endogenous mouse α-globin gene were determined by RT-qPCR analysis. The average and standard deviation (S.D.), determined by three reactions, are depicted, as a value of No. 2640 animal was arbitrary set at 1.0

    Article Snippet: RT-qPCR Total RNA was recovered from phenylhydrazine treated anaemic adult spleens (1–2 months old) of LCb118 YAC TgM using ISOGEN (Nippon Gene) and converted to cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO).

    Techniques: DNA Methylation Assay, Southern Blot, Methylation, Chromatin Immunoprecipitation, Immunoprecipitation, Real-time Polymerase Chain Reaction, Negative Control, Positive Control, Standard Deviation, Expressing, Quantitative RT-PCR

    Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared cDNA samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).

    Journal: Plants

    Article Title: A Cyclic Nucleotide-Gated Channel, HvCNGC2-3, Is Activated by the Co-Presence of Na+ and K+ and Permeable to Na+ and K+ Non-Selectively

    doi: 10.3390/plants7030061

    Figure Lengend Snippet: Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared cDNA samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).

    Article Snippet: Single strand cDNA was synthesized using ReverTra Ace® qPCR RT Master Mix with gDNA Remover kit (FSQ-301S, Toyobo Co. Ltd., Osaka, Japan). cDNA fragments of HvCNGC2-3 were amplified with a set of primers, HvCNGC2-3FW: CGTCGACGAGATGTTCTTCA and HvCNGC2-3RV: ACCTTGACACCAGGAACGTC.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Marker, Polymerase Chain Reaction