Journal: Epigenetics & Chromatin

Article Title: Recapitulation of gametic DNA methylation and its post-fertilization maintenance with reassembled DNA elements at the mouse Igf2/H19 locus

doi: 10.1186/s13072-019-0326-1

Figure Lengend Snippet: Genomic imprinting recapitulated in LCb118 knock-in mice. a Breeding scheme. In order to distinguish parental origin of the alleles by using SNPs between inbred mouse strains, endo-LCb118 homo-knock-in mice (LCb118/LCb118; C57BL/6 J [B6] background) were mated with wild-type mice ( H19 ICR/ H19 ICR; JF1/Msf [JF1]), and offspring was obtained. b – d Livers from two pairs of E18.5 embryos, each inheriting the knock-in allele either paternally (pat.; P) or maternally (mat.; M) were used for genomic DNA, total RNA, and chromatin preparations, as in Fig. 6 . b DNA methylation status of LCb118 region (the same position as in Fig. 7 a) was analyzed by bisulfite sequencing. c ChIP analysis of CTCF occupancy at the LCb118 sequence. Chromatin was immunoprecipitated using either control IgG or anti-CTCF antibodies. Following qPCR analyses of three distinct genomic regions ( Necdin ; negative control, endogenous H19 ICR; positive control, and LCb118), relative enrichment values (CTCF/IgG signal ratio) were calculated. The average and standard deviation (S.D.), determined by three reactions, are depicted. Statistical differences were determined using an unpaired t test (N.S., not significant). d The allele-specific expression of the Igf2 and H19 genes was examined by RFLP analysis. Igf2 and H19 gene transcripts were amplified by RT-PCR followed by BstUI or Cac8I digestions, respectively. Parental origin of transcripts was discriminated by allele-specific restriction sites. The sites were also introduced into primer sequence so that complete digestion of PCR products can be concomitantly monitored. e Schematic representation of the genomic imprinting recapitulated in the LCb118 knock-in allele. f Hypothetical model for post-fertilization methylation maintenance mechanism at the Igf2/H19 locus

Article Snippet: RT-qPCR Total RNA was recovered from phenylhydrazine treated anaemic adult spleens (1–2 months old) of LCb118 YAC TgM using ISOGEN (Nippon Gene) and converted to cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO).

Techniques: Knock-In, Mouse Assay, DNA Methylation Assay, Methylation Sequencing, Chromatin Immunoprecipitation, Sequencing, Immunoprecipitation, Real-time Polymerase Chain Reaction, Negative Control, Positive Control, Standard Deviation, Expressing, Amplification, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Methylation

Journal: Epigenetics & Chromatin

Article Title: Recapitulation of gametic DNA methylation and its post-fertilization maintenance with reassembled DNA elements at the mouse Igf2/H19 locus

doi: 10.1186/s13072-019-0326-1

Figure Lengend Snippet: Genomic imprinting recapitulated in the LCb118 YAC-TgM. a – c Two pairs of LCb118-TgM (ID No. 2601/2602 and 2633/2640), each inheriting the transgene either paternally (P) or maternally (M) were made anaemic and spleens were removed, from which one-quarter each was used for genomic DNA or total RNA preparation with the remaining half used for chromatin preparation. a DNA methylation status of the transgene was determined by Southern blot analysis using BamHI with (+) or without (−) BstUI (vertical lines) and a λ probe. *: methylated, uncut fragments in BstUI (+) lanes. b ChIP analysis of CTCF occupancy at the transgene. Chromatin was immunoprecipitated using either control IgG or anti-CTCF antibodies. Following qPCR analyses of three distinct genomic regions ( Necdin ; negative control, endogenous H19 ICR; positive control, and LCb118 transgene), relative enrichment values (CTCF/IgG signal ratio) were calculated. The average and standard deviation (S.D.), determined by three reactions, are depicted, as a signal for Necdin (M) was arbitrary set at 1.0. Statistical differences were determined using an unpaired t test (N.S., not significant). c The relative expression levels of the human β-globin gene, after normalization to that of the endogenous mouse α-globin gene were determined by RT-qPCR analysis. The average and standard deviation (S.D.), determined by three reactions, are depicted, as a value of No. 2640 animal was arbitrary set at 1.0

Article Snippet: RT-qPCR Total RNA was recovered from phenylhydrazine treated anaemic adult spleens (1–2 months old) of LCb118 YAC TgM using ISOGEN (Nippon Gene) and converted to cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO).

Techniques: DNA Methylation Assay, Southern Blot, Methylation, Chromatin Immunoprecipitation, Immunoprecipitation, Real-time Polymerase Chain Reaction, Negative Control, Positive Control, Standard Deviation, Expressing, Quantitative RT-PCR

Journal: Plants

Article Title: A Cyclic Nucleotide-Gated Channel, HvCNGC2-3, Is Activated by the Co-Presence of Na+ and K+ and Permeable to Na+ and K+ Non-Selectively

doi: 10.3390/plants7030061

Figure Lengend Snippet: Expression analysis of HvCNGC2-3 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). DNA fragments of HvEF1α ( A ) and HvCNGC2-3 ( C ) amplified with RT-PCR from three independently prepared cDNA samples were analyzed by agarose gel electrophoresis. G, HvCNGC2-3 band amplified from genomic DNA of barley cultivar Haruna-Nijyo for comparison. Arrowhead indicates the position of HvCNGC2-3 . M, DNA size marker ‘Without RT’ indicates PCR using the template without reverse-transcription reaction controls serving as a control experiment proving free of genomic DNA contamination in the samples using HvEF1α primers ( B ) and HvCNGC2-3 primers ( D ).

Article Snippet: Single strand cDNA was synthesized using ReverTra Ace® qPCR RT Master Mix with gDNA Remover kit (FSQ-301S, Toyobo Co. Ltd., Osaka, Japan). cDNA fragments of HvCNGC2-3 were amplified with a set of primers, HvCNGC2-3FW: CGTCGACGAGATGTTCTTCA and HvCNGC2-3RV: ACCTTGACACCAGGAACGTC.

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Marker, Polymerase Chain Reaction