gdna Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs genomic dna
    Methylation analysis in genomic <t>DNA</t> using MspJI and homologs. ( A ) Formation of a 32-mer. <t>HeLa</t> genomic DNA was incubated with 1 unit of MspJI, FspEI, LpnPI, RlaI, or a cocktail (0.2 unit each) as indicated, overnight at 37 °C
    Genomic Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 8104 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna/product/New England Biolabs
    Average 99 stars, based on 8104 article reviews
    Price from $9.99 to $1999.99
    genomic dna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher genomic dna gdna
    Measurement of P. falciparum rRNA and <t>DNA</t> associated with HUVECs by SYBR Green quantitative PCR. P. falciparum infected RBCs were added to HUVEC cell cultures for the indicated times, as described in Materials and Methods. Following these incubations, RNA and genomic DNA were purified from HUVECS. A. P. falciparum SSU rRNA amounts from HUVECs as measured by reverse-transcription qPCR. No PCR products were detected in RNA samples not treated with reverse-transcriptase (data not shown). Error bars represent standard deviation from three independent replicates. B. The SSU rRNA gene was amplified from P. falciparum genomic DNA <t>(gDNA)</t> from HUVECs and measured by qPCR. P. falciparum RNA and DNA amounts were normalized to human GAPDH RNA and DNA amounts, respectively. As a control, HUVECs were incubated with uninfected RBCs. No P. falciparum -specific PCR products were detected (data not shown). All experiments were done in triplicate.
    Genomic Dna Gdna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/Thermo Fisher
    Average 99 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore genomic dna
    Global analysis of <t>DNA</t> methylation in Mbd3 −/− ES cells. Genomic DNA from parental ES cells (+/−), Mbd3 −/− ES cells (−/−) or from ES cells expressing only Mbd3a, Mbd3b or Mbd3c was digested with MspI (M) and HpaII (H) (A) or with HpyCH4IV (B) before being Southern blotted and hybridised with probes for the minor (A) or major satellite DNA repeats (B), or for IAP LTRs (A). Mito: mitochondrial DNA probe used as a loading and digestion control. (C) Total <t>5-methylcytosine</t> levels were quantitated in two different Mbd3 Flox/- ES cell lines (WT1 and WT2) and two different Mbd3 −/− ES cell lines (KO1 and KO2) by HPLC and mass spectrometry. Error bars represent SEM of three technical replicates.
    Genomic Dna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 8239 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna/product/Millipore
    Average 99 stars, based on 8239 article reviews
    Price from $9.99 to $1999.99
    genomic dna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    91
    TaKaRa genomic dna gdna eraser
    Cytogenetic and molecular analysis. ( a ) Partial karyotyping of patient's bone marrow cells. The derivative chromosome 5 and 8 are shown by arrows. ( b ) Southern blot analysis, presenting rearrangement within FGFR1 gene. Arrows indicate the abnormal bands. ( c ) <t>RT-PCR</t> detection of the fusion transcripts in the patient. ( d ) Partial sequence of SQSTM1 - FGFR1 and reciprocal FGFR1 - SQSTM1 fusion cDNA. The amino-acid translations spanning the fusion are shown under the sequence. ( e ) Detection of der(5) and der(8) chromosomes in the patient's leukemic cells. Amplified genomic <t>DNA</t> fragments from the patient's sample are indicated by arrows. ( f ) Genomic organization of FGFR1 and SQSTM1 , encompassing the breakpoints. Horizontal arrows indicate primers used in PCR. Lanes C and P represent normal control and the patient's sample, respectively.
    Genomic Dna Gdna Eraser, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 1012 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna eraser/product/TaKaRa
    Average 91 stars, based on 1012 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna eraser - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    95
    Toyobo genomic dna gdna remover kit
    Cytogenetic and molecular analysis. ( a ) Partial karyotyping of patient's bone marrow cells. The derivative chromosome 5 and 8 are shown by arrows. ( b ) Southern blot analysis, presenting rearrangement within FGFR1 gene. Arrows indicate the abnormal bands. ( c ) <t>RT-PCR</t> detection of the fusion transcripts in the patient. ( d ) Partial sequence of SQSTM1 - FGFR1 and reciprocal FGFR1 - SQSTM1 fusion cDNA. The amino-acid translations spanning the fusion are shown under the sequence. ( e ) Detection of der(5) and der(8) chromosomes in the patient's leukemic cells. Amplified genomic <t>DNA</t> fragments from the patient's sample are indicated by arrows. ( f ) Genomic organization of FGFR1 and SQSTM1 , encompassing the breakpoints. Horizontal arrows indicate primers used in PCR. Lanes C and P represent normal control and the patient's sample, respectively.
    Genomic Dna Gdna Remover Kit, supplied by Toyobo, used in various techniques. Bioz Stars score: 95/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna remover kit/product/Toyobo
    Average 95 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna remover kit - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    93
    Roche human genomic dna gdna
    Agarose gel of PCR product and bis-treated PCR product following (A) 15 minutes and (B) 40 minutes of electrophoresis. Size of each PCR product is as indicated. <t>gDNA–untreated</t> genomic <t>DNA;</t> bis gDNA–bis-treated genomic DNA.
    Human Genomic Dna Gdna, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human genomic dna gdna/product/Roche
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    human genomic dna gdna - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    99
    PerkinElmer genomic dna gdna
    Agarose gel of PCR product and bis-treated PCR product following (A) 15 minutes and (B) 40 minutes of electrophoresis. Size of each PCR product is as indicated. <t>gDNA–untreated</t> genomic <t>DNA;</t> bis gDNA–bis-treated genomic DNA.
    Genomic Dna Gdna, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/PerkinElmer
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    93
    fluidigm genomic dna gdna
    Agarose gel of PCR product and bis-treated PCR product following (A) 15 minutes and (B) 40 minutes of electrophoresis. Size of each PCR product is as indicated. <t>gDNA–untreated</t> genomic <t>DNA;</t> bis gDNA–bis-treated genomic DNA.
    Genomic Dna Gdna, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/fluidigm
    Average 93 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    94
    Illumina Inc genomic dna gdna
    Sequencing results for Human genomic <t>DNA.</t> Libraries are prepared using 50 ng of input DNA. Similar enzyme concentrations of Tn5-059 and standard Tn5 are used and 2x151 bp sequencing run is performed on a HiSeqX. a Uniformity of Coverage. Sequencing results are down sampled to 20× coverage. Tn5-059 shows improved uniformity over standard Tn5 in NexteraV2 kit. b Normalized GC plot. Grey bar shows schematic GC composition of Human genome. Standard Tn5 has a clear bias towards GC rich regions while undercovers AT rich regions. c AT/GC dropout. Tn5-059 improves AT dropout while adding little on GC dropout
    Genomic Dna Gdna, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/Illumina Inc
    Average 94 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    91
    iNtRON Biotechnology genomic dna gdna
    Sequencing results for Human genomic <t>DNA.</t> Libraries are prepared using 50 ng of input DNA. Similar enzyme concentrations of Tn5-059 and standard Tn5 are used and 2x151 bp sequencing run is performed on a HiSeqX. a Uniformity of Coverage. Sequencing results are down sampled to 20× coverage. Tn5-059 shows improved uniformity over standard Tn5 in NexteraV2 kit. b Normalized GC plot. Grey bar shows schematic GC composition of Human genome. Standard Tn5 has a clear bias towards GC rich regions while undercovers AT rich regions. c AT/GC dropout. Tn5-059 improves AT dropout while adding little on GC dropout
    Genomic Dna Gdna, supplied by iNtRON Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/iNtRON Biotechnology
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    93
    GE Healthcare genomic dna gdna
    Sequencing results for Human genomic <t>DNA.</t> Libraries are prepared using 50 ng of input DNA. Similar enzyme concentrations of Tn5-059 and standard Tn5 are used and 2x151 bp sequencing run is performed on a HiSeqX. a Uniformity of Coverage. Sequencing results are down sampled to 20× coverage. Tn5-059 shows improved uniformity over standard Tn5 in NexteraV2 kit. b Normalized GC plot. Grey bar shows schematic GC composition of Human genome. Standard Tn5 has a clear bias towards GC rich regions while undercovers AT rich regions. c AT/GC dropout. Tn5-059 improves AT dropout while adding little on GC dropout
    Genomic Dna Gdna, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/GE Healthcare
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    94
    Pacific Biosciences genomic dna gdna
    Sequencing results for Human genomic <t>DNA.</t> Libraries are prepared using 50 ng of input DNA. Similar enzyme concentrations of Tn5-059 and standard Tn5 are used and 2x151 bp sequencing run is performed on a HiSeqX. a Uniformity of Coverage. Sequencing results are down sampled to 20× coverage. Tn5-059 shows improved uniformity over standard Tn5 in NexteraV2 kit. b Normalized GC plot. Grey bar shows schematic GC composition of Human genome. Standard Tn5 has a clear bias towards GC rich regions while undercovers AT rich regions. c AT/GC dropout. Tn5-059 improves AT dropout while adding little on GC dropout
    Genomic Dna Gdna, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/Pacific Biosciences
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    94
    Fisher Scientific genomic dna
    Sequencing results for Human genomic <t>DNA.</t> Libraries are prepared using 50 ng of input DNA. Similar enzyme concentrations of Tn5-059 and standard Tn5 are used and 2x151 bp sequencing run is performed on a HiSeqX. a Uniformity of Coverage. Sequencing results are down sampled to 20× coverage. Tn5-059 shows improved uniformity over standard Tn5 in NexteraV2 kit. b Normalized GC plot. Grey bar shows schematic GC composition of Human genome. Standard Tn5 has a clear bias towards GC rich regions while undercovers AT rich regions. c AT/GC dropout. Tn5-059 improves AT dropout while adding little on GC dropout
    Genomic Dna, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 94/100, based on 228 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna/product/Fisher Scientific
    Average 94 stars, based on 228 article reviews
    Price from $9.99 to $1999.99
    genomic dna - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    99
    Promega genomic dna
    KDM5C R1115H mutation in family UM1. (A) Pedigree of family UM1. (B) Sanger sequencing of genomic <t>DNA</t> from <t>lymphoblastoid</t> cell lines generated from proband (UM1 III-3) and father (UM1 II-1). (C) Multi-species conservation alignment of KDM5C homologs. The following RefSeq sequences were used for alignment: human NP_001140174.1, orangutan NP_001125719.1, rhesus XP_014982969.1, mouse NP_038696.2, rat XP_008771368.1, dog NP_001041497.1, elephant XP_010598233.1, frog NP_001072719.1, fugu XP_003963594.1. (D) Conservation alignment of human KDM5 family proteins, KDM5A-D. The following RefSeq sequences were used for alignment: KDM5A NP_001036068.1, KDM5B NP_006609.3, KDM5C NP_001140174.1, KDM5D NP_001140177.1. (E) Schematic of human KDM5C protein and 26 reported mutations associated with KDM5C -XLID. Missense mutations are depicted above the protein, while nonsense and frame-shift mutations are depicted beneath the molecule. JmN, jumonji-N domain; ARID, AT-rich interacting domain; PHD, plant homeodomain box domain; JmjC, jumonji-C catalytic domain; ZF, zinc finger domain; PLU-1, PLU-1-like domain.
    Genomic Dna, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 20592 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna/product/Promega
    Average 99 stars, based on 20592 article reviews
    Price from $9.99 to $1999.99
    genomic dna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    96
    5 PRIME genomic dna
    Germline transmission of Rab38 Δ 9.3 alleles. (A) <t>PCR</t> detection of Rab38 Δ 9.3 alleles using primers P-forA and P-del with tail <t>DNA</t> from pups derived from founder AB3 or AB25. M: size marker, +: positive control, −: negative control. (B) Sequence comparison of cloned PCR products (see A) derived from pups AB3-1 and AB25-2 with the parental Rab38 Δ 9.3 allele.
    Genomic Dna, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 96/100, based on 583 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna/product/5 PRIME
    Average 96 stars, based on 583 article reviews
    Price from $9.99 to $1999.99
    genomic dna - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    91
    Otogenetics Corporation genomic dna gdna
    Germline transmission of Rab38 Δ 9.3 alleles. (A) <t>PCR</t> detection of Rab38 Δ 9.3 alleles using primers P-forA and P-del with tail <t>DNA</t> from pups derived from founder AB3 or AB25. M: size marker, +: positive control, −: negative control. (B) Sequence comparison of cloned PCR products (see A) derived from pups AB3-1 and AB25-2 with the parental Rab38 Δ 9.3 allele.
    Genomic Dna Gdna, supplied by Otogenetics Corporation, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/Otogenetics Corporation
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    99
    Roche genomic dna
    Flow chart diagrams illustrating genome and transcriptome assembly pipelines. (A) Pipeline for assembly of PGT21 and PGTAus-pan genomes from <t>DNA</t> reads from Australian <t>Pgt</t> isolates. (B) Pipeline for assembly of isolate 21-0 transcriptome from RNA reads from isolated haustoria and germinated spores.
    Genomic Dna, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 7663 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna/product/Roche
    Average 99 stars, based on 7663 article reviews
    Price from $9.99 to $1999.99
    genomic dna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    91
    BioChain Institute genomic dna gdna
    Flow chart diagrams illustrating genome and transcriptome assembly pipelines. (A) Pipeline for assembly of PGT21 and PGTAus-pan genomes from <t>DNA</t> reads from Australian <t>Pgt</t> isolates. (B) Pipeline for assembly of isolate 21-0 transcriptome from RNA reads from isolated haustoria and germinated spores.
    Genomic Dna Gdna, supplied by BioChain Institute, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/BioChain Institute
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    91
    Second Genome Inc genomic dna gdna
    Flow chart diagrams illustrating genome and transcriptome assembly pipelines. (A) Pipeline for assembly of PGT21 and PGTAus-pan genomes from <t>DNA</t> reads from Australian <t>Pgt</t> isolates. (B) Pipeline for assembly of isolate 21-0 transcriptome from RNA reads from isolated haustoria and germinated spores.
    Genomic Dna Gdna, supplied by Second Genome Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/Second Genome Inc
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    99
    Promega mouse genomic dna gdna
    Overview of CORALINA (comprehensive <t>gRNA</t> library generation through controlled nuclease activity). a Three CORALINA libraries (L1, L2, L3) from genomic <t>DNA</t> of human and mouse each were generated and analyzed by NGS to compare conditions and corroborate the reproducibility of the method. b In principle, any type of double stranded DNA can be used as a source for CORALINA library generation. The DNA is fragmented through controlled digestion with MNase and ligated to linker oligos containing only one blunt end, but no phosphate residue. Consequently, linkers aligning in wrong orientation or to linker-oligos instead of fragments are excluded. PCR amplification allows size selection of those sequences containing two different linker sequences. Three different linker sequences (L1, L2, L3) have been used for bulk incorporation into gRNA-PLKO.1 using Gibson Assembly (p: phosphate residue; blue , grey lines : linker sequences and homology regions on gRNA-PLKO.1; orange lines : protospacer sequences, small arrows : primer sequences). c The analyzed representative samples of the three generated human CORALINA libraries have little sequence overlap indicating large library complexity. Shown in numbers are the unique occurrences of protospacers longer than 17 bps
    Mouse Genomic Dna Gdna, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse genomic dna gdna/product/Promega
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    mouse genomic dna gdna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    92
    Promega wizard genomic dna gdna purification kit
    Overview of CORALINA (comprehensive <t>gRNA</t> library generation through controlled nuclease activity). a Three CORALINA libraries (L1, L2, L3) from genomic <t>DNA</t> of human and mouse each were generated and analyzed by NGS to compare conditions and corroborate the reproducibility of the method. b In principle, any type of double stranded DNA can be used as a source for CORALINA library generation. The DNA is fragmented through controlled digestion with MNase and ligated to linker oligos containing only one blunt end, but no phosphate residue. Consequently, linkers aligning in wrong orientation or to linker-oligos instead of fragments are excluded. PCR amplification allows size selection of those sequences containing two different linker sequences. Three different linker sequences (L1, L2, L3) have been used for bulk incorporation into gRNA-PLKO.1 using Gibson Assembly (p: phosphate residue; blue , grey lines : linker sequences and homology regions on gRNA-PLKO.1; orange lines : protospacer sequences, small arrows : primer sequences). c The analyzed representative samples of the three generated human CORALINA libraries have little sequence overlap indicating large library complexity. Shown in numbers are the unique occurrences of protospacers longer than 17 bps
    Wizard Genomic Dna Gdna Purification Kit, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard genomic dna gdna purification kit/product/Promega
    Average 92 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    wizard genomic dna gdna purification kit - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    99
    Thermo Fisher gdna kit
    Overview of CORALINA (comprehensive <t>gRNA</t> library generation through controlled nuclease activity). a Three CORALINA libraries (L1, L2, L3) from genomic <t>DNA</t> of human and mouse each were generated and analyzed by NGS to compare conditions and corroborate the reproducibility of the method. b In principle, any type of double stranded DNA can be used as a source for CORALINA library generation. The DNA is fragmented through controlled digestion with MNase and ligated to linker oligos containing only one blunt end, but no phosphate residue. Consequently, linkers aligning in wrong orientation or to linker-oligos instead of fragments are excluded. PCR amplification allows size selection of those sequences containing two different linker sequences. Three different linker sequences (L1, L2, L3) have been used for bulk incorporation into gRNA-PLKO.1 using Gibson Assembly (p: phosphate residue; blue , grey lines : linker sequences and homology regions on gRNA-PLKO.1; orange lines : protospacer sequences, small arrows : primer sequences). c The analyzed representative samples of the three generated human CORALINA libraries have little sequence overlap indicating large library complexity. Shown in numbers are the unique occurrences of protospacers longer than 17 bps
    Gdna Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gdna kit/product/Thermo Fisher
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    gdna kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    91
    Sangon Biotech genomic dna gdna
    Overview of CORALINA (comprehensive <t>gRNA</t> library generation through controlled nuclease activity). a Three CORALINA libraries (L1, L2, L3) from genomic <t>DNA</t> of human and mouse each were generated and analyzed by NGS to compare conditions and corroborate the reproducibility of the method. b In principle, any type of double stranded DNA can be used as a source for CORALINA library generation. The DNA is fragmented through controlled digestion with MNase and ligated to linker oligos containing only one blunt end, but no phosphate residue. Consequently, linkers aligning in wrong orientation or to linker-oligos instead of fragments are excluded. PCR amplification allows size selection of those sequences containing two different linker sequences. Three different linker sequences (L1, L2, L3) have been used for bulk incorporation into gRNA-PLKO.1 using Gibson Assembly (p: phosphate residue; blue , grey lines : linker sequences and homology regions on gRNA-PLKO.1; orange lines : protospacer sequences, small arrows : primer sequences). c The analyzed representative samples of the three generated human CORALINA libraries have little sequence overlap indicating large library complexity. Shown in numbers are the unique occurrences of protospacers longer than 17 bps
    Genomic Dna Gdna, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna/product/Sangon Biotech
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    99
    Promega human genomic dna gdna
    Overview of CORALINA (comprehensive <t>gRNA</t> library generation through controlled nuclease activity). a Three CORALINA libraries (L1, L2, L3) from genomic <t>DNA</t> of human and mouse each were generated and analyzed by NGS to compare conditions and corroborate the reproducibility of the method. b In principle, any type of double stranded DNA can be used as a source for CORALINA library generation. The DNA is fragmented through controlled digestion with MNase and ligated to linker oligos containing only one blunt end, but no phosphate residue. Consequently, linkers aligning in wrong orientation or to linker-oligos instead of fragments are excluded. PCR amplification allows size selection of those sequences containing two different linker sequences. Three different linker sequences (L1, L2, L3) have been used for bulk incorporation into gRNA-PLKO.1 using Gibson Assembly (p: phosphate residue; blue , grey lines : linker sequences and homology regions on gRNA-PLKO.1; orange lines : protospacer sequences, small arrows : primer sequences). c The analyzed representative samples of the three generated human CORALINA libraries have little sequence overlap indicating large library complexity. Shown in numbers are the unique occurrences of protospacers longer than 17 bps
    Human Genomic Dna Gdna, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human genomic dna gdna/product/Promega
    Average 99 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    human genomic dna gdna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore human gdna
    Overview of CORALINA (comprehensive <t>gRNA</t> library generation through controlled nuclease activity). a Three CORALINA libraries (L1, L2, L3) from genomic <t>DNA</t> of human and mouse each were generated and analyzed by NGS to compare conditions and corroborate the reproducibility of the method. b In principle, any type of double stranded DNA can be used as a source for CORALINA library generation. The DNA is fragmented through controlled digestion with MNase and ligated to linker oligos containing only one blunt end, but no phosphate residue. Consequently, linkers aligning in wrong orientation or to linker-oligos instead of fragments are excluded. PCR amplification allows size selection of those sequences containing two different linker sequences. Three different linker sequences (L1, L2, L3) have been used for bulk incorporation into gRNA-PLKO.1 using Gibson Assembly (p: phosphate residue; blue , grey lines : linker sequences and homology regions on gRNA-PLKO.1; orange lines : protospacer sequences, small arrows : primer sequences). c The analyzed representative samples of the three generated human CORALINA libraries have little sequence overlap indicating large library complexity. Shown in numbers are the unique occurrences of protospacers longer than 17 bps
    Human Gdna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human gdna/product/Millipore
    Average 99 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    human gdna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    90
    Illumina Inc assembly genomic dna gdna
    Overview of CORALINA (comprehensive <t>gRNA</t> library generation through controlled nuclease activity). a Three CORALINA libraries (L1, L2, L3) from genomic <t>DNA</t> of human and mouse each were generated and analyzed by NGS to compare conditions and corroborate the reproducibility of the method. b In principle, any type of double stranded DNA can be used as a source for CORALINA library generation. The DNA is fragmented through controlled digestion with MNase and ligated to linker oligos containing only one blunt end, but no phosphate residue. Consequently, linkers aligning in wrong orientation or to linker-oligos instead of fragments are excluded. PCR amplification allows size selection of those sequences containing two different linker sequences. Three different linker sequences (L1, L2, L3) have been used for bulk incorporation into gRNA-PLKO.1 using Gibson Assembly (p: phosphate residue; blue , grey lines : linker sequences and homology regions on gRNA-PLKO.1; orange lines : protospacer sequences, small arrows : primer sequences). c The analyzed representative samples of the three generated human CORALINA libraries have little sequence overlap indicating large library complexity. Shown in numbers are the unique occurrences of protospacers longer than 17 bps
    Assembly Genomic Dna Gdna, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/assembly genomic dna gdna/product/Illumina Inc
    Average 90 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    assembly genomic dna gdna - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    91
    Biomiga bacterial genomic dna gdna
    Overview of CORALINA (comprehensive <t>gRNA</t> library generation through controlled nuclease activity). a Three CORALINA libraries (L1, L2, L3) from genomic <t>DNA</t> of human and mouse each were generated and analyzed by NGS to compare conditions and corroborate the reproducibility of the method. b In principle, any type of double stranded DNA can be used as a source for CORALINA library generation. The DNA is fragmented through controlled digestion with MNase and ligated to linker oligos containing only one blunt end, but no phosphate residue. Consequently, linkers aligning in wrong orientation or to linker-oligos instead of fragments are excluded. PCR amplification allows size selection of those sequences containing two different linker sequences. Three different linker sequences (L1, L2, L3) have been used for bulk incorporation into gRNA-PLKO.1 using Gibson Assembly (p: phosphate residue; blue , grey lines : linker sequences and homology regions on gRNA-PLKO.1; orange lines : protospacer sequences, small arrows : primer sequences). c The analyzed representative samples of the three generated human CORALINA libraries have little sequence overlap indicating large library complexity. Shown in numbers are the unique occurrences of protospacers longer than 17 bps
    Bacterial Genomic Dna Gdna, supplied by Biomiga, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial genomic dna gdna/product/Biomiga
    Average 91 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    bacterial genomic dna gdna - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    85
    Becton Dickinson genomic dna gdna extraction
    Overview of CORALINA (comprehensive <t>gRNA</t> library generation through controlled nuclease activity). a Three CORALINA libraries (L1, L2, L3) from genomic <t>DNA</t> of human and mouse each were generated and analyzed by NGS to compare conditions and corroborate the reproducibility of the method. b In principle, any type of double stranded DNA can be used as a source for CORALINA library generation. The DNA is fragmented through controlled digestion with MNase and ligated to linker oligos containing only one blunt end, but no phosphate residue. Consequently, linkers aligning in wrong orientation or to linker-oligos instead of fragments are excluded. PCR amplification allows size selection of those sequences containing two different linker sequences. Three different linker sequences (L1, L2, L3) have been used for bulk incorporation into gRNA-PLKO.1 using Gibson Assembly (p: phosphate residue; blue , grey lines : linker sequences and homology regions on gRNA-PLKO.1; orange lines : protospacer sequences, small arrows : primer sequences). c The analyzed representative samples of the three generated human CORALINA libraries have little sequence overlap indicating large library complexity. Shown in numbers are the unique occurrences of protospacers longer than 17 bps
    Genomic Dna Gdna Extraction, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna gdna extraction/product/Becton Dickinson
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    genomic dna gdna extraction - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    99
    Jena Bioscience gdna removal kit
    Overview of CORALINA (comprehensive <t>gRNA</t> library generation through controlled nuclease activity). a Three CORALINA libraries (L1, L2, L3) from genomic <t>DNA</t> of human and mouse each were generated and analyzed by NGS to compare conditions and corroborate the reproducibility of the method. b In principle, any type of double stranded DNA can be used as a source for CORALINA library generation. The DNA is fragmented through controlled digestion with MNase and ligated to linker oligos containing only one blunt end, but no phosphate residue. Consequently, linkers aligning in wrong orientation or to linker-oligos instead of fragments are excluded. PCR amplification allows size selection of those sequences containing two different linker sequences. Three different linker sequences (L1, L2, L3) have been used for bulk incorporation into gRNA-PLKO.1 using Gibson Assembly (p: phosphate residue; blue , grey lines : linker sequences and homology regions on gRNA-PLKO.1; orange lines : protospacer sequences, small arrows : primer sequences). c The analyzed representative samples of the three generated human CORALINA libraries have little sequence overlap indicating large library complexity. Shown in numbers are the unique occurrences of protospacers longer than 17 bps
    Gdna Removal Kit, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gdna removal kit/product/Jena Bioscience
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    gdna removal kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Methylation analysis in genomic DNA using MspJI and homologs. ( A ) Formation of a 32-mer. HeLa genomic DNA was incubated with 1 unit of MspJI, FspEI, LpnPI, RlaI, or a cocktail (0.2 unit each) as indicated, overnight at 37 °C

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: The MspJI family of modification-dependent restriction endonucleases for epigenetic studies

    doi: 10.1073/pnas.1018448108

    Figure Lengend Snippet: Methylation analysis in genomic DNA using MspJI and homologs. ( A ) Formation of a 32-mer. HeLa genomic DNA was incubated with 1 unit of MspJI, FspEI, LpnPI, RlaI, or a cocktail (0.2 unit each) as indicated, overnight at 37 °C

    Article Snippet: Genomic DNA samples of HeLa and Jurkat cell DNA as well as 5-Aza-dC-treated ( ) and enzymatically m CpG-methylated Jurkat cell DNA were obtained from NEB, and other genomic DNAs were purchased from BioChain [rabbit liver DNA (#D1834149), corn DNA (#D1634330), soy bean DNA (#D1634370)].

    Techniques: Methylation, Incubation

    Activity of NgTet1 on various DNA substrates a–c , The time courses (lanes 5–13) of the reactions using 32-bp DNA substrates containing 5mC (panel a ), 5hmC (panel b ) or 5caC (panel c ). Lanes 1–4: antibody sensitivity against 10 pmol of control oligonucleotides and 2 fold serial dilutions. Lanes 5–13: the rate of conversion appears to be the fastest for the reaction of 5mC to 5hmC, and decreases with each subsequent reaction: 5mC to 5hmC > 5hmC to 5fC > 5fC to 5caC. d , Activities of NgTet1 (20 µM) on genomic DNA (gDNA) of Hela cells (2.5 µg). After 1 h reaction, 87% of the products are 5caC in gDNA with the remaining being 5fC and 5hmC. The percentages were estimated from integration of the peaks in LC-MS traces. The mean and standard deviation (±s.e.m.) were estimated from three repeated experiments. e , Human thymine DNA glycosylase (TDG) excises 5fC and 5caC (but not 5mC and 5hmC) when paired with a guanine in a CpG sequence (lanes 1–4) (He et al., 2011; Maiti and Drohat, 2011; Hashimoto et al., 2012). After NgTet1 reactions with DNA substrates containing 5mC, 5hmC or 5fC, in the presence of αKG, the product DNA containing 5fC and 5caC becomes a substrate for TDG (lanes 6, 8 and 10), but not with NOG (lanes 5 and 7), again demonstrating the production of 5fC and 5caC by NgTet1. f , Activities of NgTet1 on 56-bp double-stranded (ds) DNA-2 with methylation on both strands (M/M) or single strand (hemi-methylated either on top M/C or bottom C/M strand) or single-stranded (ss) DNA (Reaction time 1 h and ±s.e.m. estimated from three repeats). We note that an in vitro activity of the mouse Tet1 catalytic domain on single-stranded DNA has also been observed (Zhang et al., 2012). g , LC-MS traces of a sample reaction mix on the hemi-methylated 5mCpG dsDNA-1 (top panel), reaction control with no enzyme (middle panel), and the standard deoxyribonucleoside mix (bottom panel). Arrows indicate peaks of 5mC, 5hmC, 5fC and 5caC. Identities of the peaks are confirmed by comparing the retention time with the standard as well as by mass spectrometry. Hashimoto, H., Hong, S., Bhagwat, A. S., Zhang, X. Cheng, X. Excision of 5-hydroxymethyluracil and 5-carboxylcytosine by the thymine DNA glycosylase domain: its structural basis and implications for active DNA demethylation. Nucleic Acids Res 40 , 10203–10214 (2012). He, Y. F. et al . Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science 333 , 1303–1307 (2011). Maiti, A. Drohat, A. C. Thymine DNA glycosylase can rapidly excise 5-formylcytosine and 5-carboxylcytosine: potential implications for active demethylation of CpG sites. J Biol Chem 286 , 35334–35338 (2011). Zhang, L., Yu, M. He, C. Mouse Tet1 protein can oxidize 5mC to 5hmC and 5caC on single-stranded DNA. Acta Chimica Sinica 70 , 2123–2126 (2012).

    Journal: Nature

    Article Title: Structure of a Naegleria Tet-like dioxygenase in complex with 5-methylcytosine DNA

    doi: 10.1038/nature12905

    Figure Lengend Snippet: Activity of NgTet1 on various DNA substrates a–c , The time courses (lanes 5–13) of the reactions using 32-bp DNA substrates containing 5mC (panel a ), 5hmC (panel b ) or 5caC (panel c ). Lanes 1–4: antibody sensitivity against 10 pmol of control oligonucleotides and 2 fold serial dilutions. Lanes 5–13: the rate of conversion appears to be the fastest for the reaction of 5mC to 5hmC, and decreases with each subsequent reaction: 5mC to 5hmC > 5hmC to 5fC > 5fC to 5caC. d , Activities of NgTet1 (20 µM) on genomic DNA (gDNA) of Hela cells (2.5 µg). After 1 h reaction, 87% of the products are 5caC in gDNA with the remaining being 5fC and 5hmC. The percentages were estimated from integration of the peaks in LC-MS traces. The mean and standard deviation (±s.e.m.) were estimated from three repeated experiments. e , Human thymine DNA glycosylase (TDG) excises 5fC and 5caC (but not 5mC and 5hmC) when paired with a guanine in a CpG sequence (lanes 1–4) (He et al., 2011; Maiti and Drohat, 2011; Hashimoto et al., 2012). After NgTet1 reactions with DNA substrates containing 5mC, 5hmC or 5fC, in the presence of αKG, the product DNA containing 5fC and 5caC becomes a substrate for TDG (lanes 6, 8 and 10), but not with NOG (lanes 5 and 7), again demonstrating the production of 5fC and 5caC by NgTet1. f , Activities of NgTet1 on 56-bp double-stranded (ds) DNA-2 with methylation on both strands (M/M) or single strand (hemi-methylated either on top M/C or bottom C/M strand) or single-stranded (ss) DNA (Reaction time 1 h and ±s.e.m. estimated from three repeats). We note that an in vitro activity of the mouse Tet1 catalytic domain on single-stranded DNA has also been observed (Zhang et al., 2012). g , LC-MS traces of a sample reaction mix on the hemi-methylated 5mCpG dsDNA-1 (top panel), reaction control with no enzyme (middle panel), and the standard deoxyribonucleoside mix (bottom panel). Arrows indicate peaks of 5mC, 5hmC, 5fC and 5caC. Identities of the peaks are confirmed by comparing the retention time with the standard as well as by mass spectrometry. Hashimoto, H., Hong, S., Bhagwat, A. S., Zhang, X. Cheng, X. Excision of 5-hydroxymethyluracil and 5-carboxylcytosine by the thymine DNA glycosylase domain: its structural basis and implications for active DNA demethylation. Nucleic Acids Res 40 , 10203–10214 (2012). He, Y. F. et al . Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science 333 , 1303–1307 (2011). Maiti, A. Drohat, A. C. Thymine DNA glycosylase can rapidly excise 5-formylcytosine and 5-carboxylcytosine: potential implications for active demethylation of CpG sites. J Biol Chem 286 , 35334–35338 (2011). Zhang, L., Yu, M. He, C. Mouse Tet1 protein can oxidize 5mC to 5hmC and 5caC on single-stranded DNA. Acta Chimica Sinica 70 , 2123–2126 (2012).

    Article Snippet: For quantitative analyses of various 5mC oxidative species, either the 56-bp hemi-methylated dsDNA-1 ( ) or genomic DNA (gDNA) of Hela cells (NEB #N4006S) ( ) were used as substrates.

    Techniques: Activity Assay, Liquid Chromatography with Mass Spectroscopy, Standard Deviation, Sequencing, Methylation, In Vitro, Mass Spectrometry

    Pairwise comparison of NgTet1 and mammalian Tet1 a , Schematic representation of hTet1 C-terminal catalytic domain. b , Sequence alignment of NgTet1, hTet1 and mTet1. Labels above the sequences indicate that i for intra-molecular polar interaction; s for exposed surface residue; h for hydrophobic core; t for structural turn; α for αKG binding; m for metal ion coordination; P for DNA phosphate interaction; g for DNA base interaction with the orphaned guanine; G for DNA base interaction with the 3’ guanine to 5mC; C for 5mC interaction; a for active site residues (A212 and V293) near the methyl group of 5mC. c , Structure of NgTet1 with arrows indicating the two large insertions of mammalian Tet1. Highlighted is the charge-charge interaction between invariant K86 and E108. d , A kinked helix α4, owing to P172 (conserved among NgTet1, human and mouse Tet1, Tet2 and Tet3) located in the middle. f , Antibody detection of 5hmC in genomic DNA of HEK293T cells (top panel) expressing Flag tagged mouse Tet1 catalytic domain or its internal deletions (bottom panel). Top panel: Lane 1 is the 32-bp oligonucleotide containing a single 5hmC (20 pmol and 2 fold serial dilutions) and lanes 2–7 are the genomic DNA (500 ng and 2 fold serial dilutions). Bottom panel: Lane 1 is the molecular weight marker and Lanes 2 and 7 are the whole cell lysates with approximately equal amount of protein.

    Journal: Nature

    Article Title: Structure of a Naegleria Tet-like dioxygenase in complex with 5-methylcytosine DNA

    doi: 10.1038/nature12905

    Figure Lengend Snippet: Pairwise comparison of NgTet1 and mammalian Tet1 a , Schematic representation of hTet1 C-terminal catalytic domain. b , Sequence alignment of NgTet1, hTet1 and mTet1. Labels above the sequences indicate that i for intra-molecular polar interaction; s for exposed surface residue; h for hydrophobic core; t for structural turn; α for αKG binding; m for metal ion coordination; P for DNA phosphate interaction; g for DNA base interaction with the orphaned guanine; G for DNA base interaction with the 3’ guanine to 5mC; C for 5mC interaction; a for active site residues (A212 and V293) near the methyl group of 5mC. c , Structure of NgTet1 with arrows indicating the two large insertions of mammalian Tet1. Highlighted is the charge-charge interaction between invariant K86 and E108. d , A kinked helix α4, owing to P172 (conserved among NgTet1, human and mouse Tet1, Tet2 and Tet3) located in the middle. f , Antibody detection of 5hmC in genomic DNA of HEK293T cells (top panel) expressing Flag tagged mouse Tet1 catalytic domain or its internal deletions (bottom panel). Top panel: Lane 1 is the 32-bp oligonucleotide containing a single 5hmC (20 pmol and 2 fold serial dilutions) and lanes 2–7 are the genomic DNA (500 ng and 2 fold serial dilutions). Bottom panel: Lane 1 is the molecular weight marker and Lanes 2 and 7 are the whole cell lysates with approximately equal amount of protein.

    Article Snippet: For quantitative analyses of various 5mC oxidative species, either the 56-bp hemi-methylated dsDNA-1 ( ) or genomic DNA (gDNA) of Hela cells (NEB #N4006S) ( ) were used as substrates.

    Techniques: Sequencing, Binding Assay, Expressing, Molecular Weight, Marker

    Measurement of P. falciparum rRNA and DNA associated with HUVECs by SYBR Green quantitative PCR. P. falciparum infected RBCs were added to HUVEC cell cultures for the indicated times, as described in Materials and Methods. Following these incubations, RNA and genomic DNA were purified from HUVECS. A. P. falciparum SSU rRNA amounts from HUVECs as measured by reverse-transcription qPCR. No PCR products were detected in RNA samples not treated with reverse-transcriptase (data not shown). Error bars represent standard deviation from three independent replicates. B. The SSU rRNA gene was amplified from P. falciparum genomic DNA (gDNA) from HUVECs and measured by qPCR. P. falciparum RNA and DNA amounts were normalized to human GAPDH RNA and DNA amounts, respectively. As a control, HUVECs were incubated with uninfected RBCs. No P. falciparum -specific PCR products were detected (data not shown). All experiments were done in triplicate.

    Journal: The Yale Journal of Biology and Medicine

    Article Title: Association of Plasmodium falciparum with Human Endothelial Cells in vitro

    doi:

    Figure Lengend Snippet: Measurement of P. falciparum rRNA and DNA associated with HUVECs by SYBR Green quantitative PCR. P. falciparum infected RBCs were added to HUVEC cell cultures for the indicated times, as described in Materials and Methods. Following these incubations, RNA and genomic DNA were purified from HUVECS. A. P. falciparum SSU rRNA amounts from HUVECs as measured by reverse-transcription qPCR. No PCR products were detected in RNA samples not treated with reverse-transcriptase (data not shown). Error bars represent standard deviation from three independent replicates. B. The SSU rRNA gene was amplified from P. falciparum genomic DNA (gDNA) from HUVECs and measured by qPCR. P. falciparum RNA and DNA amounts were normalized to human GAPDH RNA and DNA amounts, respectively. As a control, HUVECs were incubated with uninfected RBCs. No P. falciparum -specific PCR products were detected (data not shown). All experiments were done in triplicate.

    Article Snippet: Total RNA and genomic DNA (gDNA) were purified from HUVEC cells using Trizol reagent (Invitrogen) according to the manufacturer’s instructions.

    Techniques: SYBR Green Assay, Real-time Polymerase Chain Reaction, Infection, Purification, Polymerase Chain Reaction, Standard Deviation, Amplification, Incubation

    Two-dimensional histogram of conventional dPCR for KRAS genotyping. Multiplex dPCR assays were performed to detect WT KRAS and the four most common KRAS mutations in pancreatic ductal adenocarcinoma: G12D, G12R, G12V and G13D 27 , by using the RainDrop digital PCR system (RainDance Technologies, Billerica, MA), as previously described 26 . ( A ) dPCR plot of the 5-plex assay using a mixture of four types of KRAS mutant genomic DNA reference standards as the DNA template. ( B ) dPCR plot using the genomic DNA reference standard of the G12D mutant as the DNA template. ( C ) dPCR plot using the genomic DNA reference standard of the G12R mutant as the DNA template.

    Journal: Scientific Reports

    Article Title: KRAS genotyping by digital PCR combined with melting curve analysis

    doi: 10.1038/s41598-019-38822-1

    Figure Lengend Snippet: Two-dimensional histogram of conventional dPCR for KRAS genotyping. Multiplex dPCR assays were performed to detect WT KRAS and the four most common KRAS mutations in pancreatic ductal adenocarcinoma: G12D, G12R, G12V and G13D 27 , by using the RainDrop digital PCR system (RainDance Technologies, Billerica, MA), as previously described 26 . ( A ) dPCR plot of the 5-plex assay using a mixture of four types of KRAS mutant genomic DNA reference standards as the DNA template. ( B ) dPCR plot using the genomic DNA reference standard of the G12D mutant as the DNA template. ( C ) dPCR plot using the genomic DNA reference standard of the G12R mutant as the DNA template.

    Article Snippet: Preparation of DNA templates The KRAS gene was amplified using genomic DNA extracted from HCT116 p21 (+) as a template and cloned into the pCR2.1-TOPO vector (Thermo Fisher Scientific, Waltham, MA).

    Techniques: Digital PCR, Multiplex Assay, Plex Assay, Mutagenesis

    Genotyping of KRAS mutation with a 2-plex assay. ( A ) The relationship between Tm and the normalized intensity of each well. The groups (‘negative’ wells, wells containing WT DNA, and wells containing G12D mutant DNA) were divided by Tm and normalized intensity. ( B ) Tm histogram of ‘positive’ wells.

    Journal: Scientific Reports

    Article Title: KRAS genotyping by digital PCR combined with melting curve analysis

    doi: 10.1038/s41598-019-38822-1

    Figure Lengend Snippet: Genotyping of KRAS mutation with a 2-plex assay. ( A ) The relationship between Tm and the normalized intensity of each well. The groups (‘negative’ wells, wells containing WT DNA, and wells containing G12D mutant DNA) were divided by Tm and normalized intensity. ( B ) Tm histogram of ‘positive’ wells.

    Article Snippet: Preparation of DNA templates The KRAS gene was amplified using genomic DNA extracted from HCT116 p21 (+) as a template and cloned into the pCR2.1-TOPO vector (Thermo Fisher Scientific, Waltham, MA).

    Techniques: Mutagenesis, Plex Assay

    Global analysis of DNA methylation in Mbd3 −/− ES cells. Genomic DNA from parental ES cells (+/−), Mbd3 −/− ES cells (−/−) or from ES cells expressing only Mbd3a, Mbd3b or Mbd3c was digested with MspI (M) and HpaII (H) (A) or with HpyCH4IV (B) before being Southern blotted and hybridised with probes for the minor (A) or major satellite DNA repeats (B), or for IAP LTRs (A). Mito: mitochondrial DNA probe used as a loading and digestion control. (C) Total 5-methylcytosine levels were quantitated in two different Mbd3 Flox/- ES cell lines (WT1 and WT2) and two different Mbd3 −/− ES cell lines (KO1 and KO2) by HPLC and mass spectrometry. Error bars represent SEM of three technical replicates.

    Journal: Biology Open

    Article Title: NuRD-dependent DNA methylation prevents ES cells from accessing a trophectoderm fate

    doi: 10.1242/bio.2012513

    Figure Lengend Snippet: Global analysis of DNA methylation in Mbd3 −/− ES cells. Genomic DNA from parental ES cells (+/−), Mbd3 −/− ES cells (−/−) or from ES cells expressing only Mbd3a, Mbd3b or Mbd3c was digested with MspI (M) and HpaII (H) (A) or with HpyCH4IV (B) before being Southern blotted and hybridised with probes for the minor (A) or major satellite DNA repeats (B), or for IAP LTRs (A). Mito: mitochondrial DNA probe used as a loading and digestion control. (C) Total 5-methylcytosine levels were quantitated in two different Mbd3 Flox/- ES cell lines (WT1 and WT2) and two different Mbd3 −/− ES cell lines (KO1 and KO2) by HPLC and mass spectrometry. Error bars represent SEM of three technical replicates.

    Article Snippet: For quantification of global 5-methylcytosine content, genomic DNA samples were boiled, treated with nuclease P1 (Sigma) for 16 h at 37°C, and with alkaline phosphatase (Sigma) for an additional 2 h at 37°C.

    Techniques: DNA Methylation Assay, Expressing, High Performance Liquid Chromatography, Mass Spectrometry

    Alignment of vertebrate six6 genes reveals an evolutionary conserved region 3′ of the six6 coding region. PIP analysis was used to compare vertebrate genomic DNA sequences from mammalian (human, mouse), marsupial (tazmanian devil), aves (chicken), reptile (green sea turtle), lobe-finned fish (coelacanth) and fish (medaka). Golden boxes show evolutionarily conserved regions (R); purple boxes indicate exons; white box, intron; dark and light blue lines, 5′ and 3′ flanking genomic regions, respectively. The line at the bottom of the PIP analysis indicates distance in kilobases from the translation start site. The percent identity of X. tropicalis R3 to each species is included. Exon 1 contains 146 bp of 5′ untranslated region, while exon 2 contains 964 bp of 3′ untranslated region, both depicted in light purple.

    Journal: Developmental biology

    Article Title: Distinct cis-acting regions control six6 expression during eye field and optic cup stages of eye formation

    doi: 10.1016/j.ydbio.2017.04.003

    Figure Lengend Snippet: Alignment of vertebrate six6 genes reveals an evolutionary conserved region 3′ of the six6 coding region. PIP analysis was used to compare vertebrate genomic DNA sequences from mammalian (human, mouse), marsupial (tazmanian devil), aves (chicken), reptile (green sea turtle), lobe-finned fish (coelacanth) and fish (medaka). Golden boxes show evolutionarily conserved regions (R); purple boxes indicate exons; white box, intron; dark and light blue lines, 5′ and 3′ flanking genomic regions, respectively. The line at the bottom of the PIP analysis indicates distance in kilobases from the translation start site. The percent identity of X. tropicalis R3 to each species is included. Exon 1 contains 146 bp of 5′ untranslated region, while exon 2 contains 964 bp of 3′ untranslated region, both depicted in light purple.

    Article Snippet: Genomic DNA (gDNA) was isolated from tails by adding 250μl of lysis buffer [20μg/μl Proteinase K (cat# P2308; Sigma-Aldrich); 10 mM Tris, pH 8.0; 100 mM NaCl; 10 mM EDTA, pH 8.0; 0.5 % SDS] and incubating samples at 60 C overnight.

    Techniques: Fluorescence In Situ Hybridization

    Branch migration assays and asymmetric families of JMs. (a) Branch migration assay. Genomic DNA from wt (CY11340) and sgs1Δ (CY11357) strains carrying the minichromosome YLpFAT7.1 was extracted, digested with ApaI and BamHI, and run in triplicate. The first dimension gel slices were incubated in buffer with or without magnesium at 65°C 43 , before second dimension and subsequent analysis with the leu2d probe. The experiments were conducted three times with qualitatively identical results. A schematic representation of the expected position of the spot caused by branch migration of X-molecules to two linear fragments in 2D gels is shown, together with a schematic representation of the restriction fragment analyzed. (b-c) Representative EM pictures of F5* and F1* families of X-molecules. The analyzed molecules derive from two independent biological experiments. Total views of the indicated X-shaped DNA structures and enlarged views with a schematic representation of the junction point (ssDNA regions in red and dsDNA regions in black). Branch sizes until the junction point are reported in kilobases. Length values indicated with a black or blue code indicate the pairs of branches leading to the size of one minichromosome-derived HindIII fragment. The junction points of the molecules are also represented with a black and light grey code, to show the contributions of the two DNA duplexes to the junction. Scale bars are shown.

    Journal: Nature structural & molecular biology

    Article Title: Visualization of recombination–mediated damage-bypass by template switching

    doi: 10.1038/nsmb.2888

    Figure Lengend Snippet: Branch migration assays and asymmetric families of JMs. (a) Branch migration assay. Genomic DNA from wt (CY11340) and sgs1Δ (CY11357) strains carrying the minichromosome YLpFAT7.1 was extracted, digested with ApaI and BamHI, and run in triplicate. The first dimension gel slices were incubated in buffer with or without magnesium at 65°C 43 , before second dimension and subsequent analysis with the leu2d probe. The experiments were conducted three times with qualitatively identical results. A schematic representation of the expected position of the spot caused by branch migration of X-molecules to two linear fragments in 2D gels is shown, together with a schematic representation of the restriction fragment analyzed. (b-c) Representative EM pictures of F5* and F1* families of X-molecules. The analyzed molecules derive from two independent biological experiments. Total views of the indicated X-shaped DNA structures and enlarged views with a schematic representation of the junction point (ssDNA regions in red and dsDNA regions in black). Branch sizes until the junction point are reported in kilobases. Length values indicated with a black or blue code indicate the pairs of branches leading to the size of one minichromosome-derived HindIII fragment. The junction points of the molecules are also represented with a black and light grey code, to show the contributions of the two DNA duplexes to the junction. Scale bars are shown.

    Article Snippet: Cell culture, psoralen crosslinking and genomic DNA extraction for 2D gels The yeast strains carrying the minichromosome YLpFAT7.1 were grown in synthetic media without leucine, arrested in G1 using alpha factor (SIGMA, 4 μg/ml) and released in YPD media or YPD media containing 0.033% MMS.

    Techniques: Migration, Incubation, Derivative Assay

    X-molecule intermediate isolation and purification. ( a) Typical preparative 2D gels of psoralen-crosslinked genomic DNA of wild-type (wt, CY11340) and sgs1Δ (CY11357) cells carrying the minichromosome. The black arrows indicate the X-spike spots visible after ethidium bromide staining. Agarose fragments containing the X-arcs were extracted. Uncut gels were kept and hybridized in parallel using the leu2d probe. (b) The DNA contained in the agarose fragments extracted from the 2D gels in panel (a) was isolated by electroelution and run on a subsequent 2D gel.

    Journal: Nature structural & molecular biology

    Article Title: Visualization of recombination–mediated damage-bypass by template switching

    doi: 10.1038/nsmb.2888

    Figure Lengend Snippet: X-molecule intermediate isolation and purification. ( a) Typical preparative 2D gels of psoralen-crosslinked genomic DNA of wild-type (wt, CY11340) and sgs1Δ (CY11357) cells carrying the minichromosome. The black arrows indicate the X-spike spots visible after ethidium bromide staining. Agarose fragments containing the X-arcs were extracted. Uncut gels were kept and hybridized in parallel using the leu2d probe. (b) The DNA contained in the agarose fragments extracted from the 2D gels in panel (a) was isolated by electroelution and run on a subsequent 2D gel.

    Article Snippet: Cell culture, psoralen crosslinking and genomic DNA extraction for 2D gels The yeast strains carrying the minichromosome YLpFAT7.1 were grown in synthetic media without leucine, arrested in G1 using alpha factor (SIGMA, 4 μg/ml) and released in YPD media or YPD media containing 0.033% MMS.

    Techniques: Isolation, Purification, Staining, Two-Dimensional Gel Electrophoresis

    Observation of F3 molecules by denaturing spreading and biochemical identification of paranemic pairing. (a) Entire and enlarged view of the junction point of an F3 molecule following denaturing spreading. The analyzed molecules derive from two independent biological experiments. A schematic representation of the junction point is shown, with ssDNA regions in red and dsDNA filaments in black. The black arrow indicates a heavily crosslinked dsDNA filament that can be used as reference for the thickness of a dsDNA filament in this experimental condition. A schematic representation of the junction point showing the contribution of the ssDNA filaments from the two DNA duplexes (labeled, respectively, in black and light gray) to the junction point is shown. Branch sizes until the junction point and the length of the DNA filaments in the junction point are also reported (in black) in kilobases. Scale bars are shown. (b) Schematic representations of the possible outcomes of the Mung Bean nuclease treatment on pseudo double Holliday junctions or classical double Holliday junctions, with or without in vivo psoralen-crosslinking. (c) Genomic DNA from sgs1Δ (CY11357) cells carrying the minichromosome YLpFAT7.1 and replicating in the presence of MMS was extracted after psoralen-crosslinking in vivo or without psoralen-crosslinking. Mung-bean treated and non-treated samples were run on 2D gels in parallel. The experiments were conducted three times with qualitatively identical results. Schematic representations of the 2D gel signals with the transitions from X-arcs to double Y-arcs are shown.

    Journal: Nature structural & molecular biology

    Article Title: Visualization of recombination–mediated damage-bypass by template switching

    doi: 10.1038/nsmb.2888

    Figure Lengend Snippet: Observation of F3 molecules by denaturing spreading and biochemical identification of paranemic pairing. (a) Entire and enlarged view of the junction point of an F3 molecule following denaturing spreading. The analyzed molecules derive from two independent biological experiments. A schematic representation of the junction point is shown, with ssDNA regions in red and dsDNA filaments in black. The black arrow indicates a heavily crosslinked dsDNA filament that can be used as reference for the thickness of a dsDNA filament in this experimental condition. A schematic representation of the junction point showing the contribution of the ssDNA filaments from the two DNA duplexes (labeled, respectively, in black and light gray) to the junction point is shown. Branch sizes until the junction point and the length of the DNA filaments in the junction point are also reported (in black) in kilobases. Scale bars are shown. (b) Schematic representations of the possible outcomes of the Mung Bean nuclease treatment on pseudo double Holliday junctions or classical double Holliday junctions, with or without in vivo psoralen-crosslinking. (c) Genomic DNA from sgs1Δ (CY11357) cells carrying the minichromosome YLpFAT7.1 and replicating in the presence of MMS was extracted after psoralen-crosslinking in vivo or without psoralen-crosslinking. Mung-bean treated and non-treated samples were run on 2D gels in parallel. The experiments were conducted three times with qualitatively identical results. Schematic representations of the 2D gel signals with the transitions from X-arcs to double Y-arcs are shown.

    Article Snippet: Cell culture, psoralen crosslinking and genomic DNA extraction for 2D gels The yeast strains carrying the minichromosome YLpFAT7.1 were grown in synthetic media without leucine, arrested in G1 using alpha factor (SIGMA, 4 μg/ml) and released in YPD media or YPD media containing 0.033% MMS.

    Techniques: Labeling, In Vivo, Two-Dimensional Gel Electrophoresis

    TS intermediates formed on YLpFAT7.1 minichromosomes. (a) Genomic DNA samples isolated from wild-type (wt, CY11340) and sgs1Δ (CY11357) strains carrying YLpFAT7.1 minichromosomes and replicating in the presence of MMS 0.033% were analyzed by 2D gel electrophoresis using a minichromosome-specific probe, leu2d . ( b) Genomic DNA samples from wt (CY11340), sgs1Δ (CY11357) cells carrying the minichromosome YLpFAT7.1, and the corresponding strains without minichromosomes, wt (CY12486) and sgs1Δ (CY13249), were analyzed by 2D gel electrophoresis using probes for the minichromosome ( leu2d ) or the early origin of replication on the endogenous chromosome III ( ARS305) . ( c) The genetic dependency of minichromosome-derived X-molecules was analyzed in wt (CY11340) , sgs1Δ (CY11357) , rad51Δ (CY12388) , rad5Δ (CY12777) , sgs1Δ rad51Δ (CY12390) , sgs1Δ rad5Δ (CY12775).

    Journal: Nature structural & molecular biology

    Article Title: Visualization of recombination–mediated damage-bypass by template switching

    doi: 10.1038/nsmb.2888

    Figure Lengend Snippet: TS intermediates formed on YLpFAT7.1 minichromosomes. (a) Genomic DNA samples isolated from wild-type (wt, CY11340) and sgs1Δ (CY11357) strains carrying YLpFAT7.1 minichromosomes and replicating in the presence of MMS 0.033% were analyzed by 2D gel electrophoresis using a minichromosome-specific probe, leu2d . ( b) Genomic DNA samples from wt (CY11340), sgs1Δ (CY11357) cells carrying the minichromosome YLpFAT7.1, and the corresponding strains without minichromosomes, wt (CY12486) and sgs1Δ (CY13249), were analyzed by 2D gel electrophoresis using probes for the minichromosome ( leu2d ) or the early origin of replication on the endogenous chromosome III ( ARS305) . ( c) The genetic dependency of minichromosome-derived X-molecules was analyzed in wt (CY11340) , sgs1Δ (CY11357) , rad51Δ (CY12388) , rad5Δ (CY12777) , sgs1Δ rad51Δ (CY12390) , sgs1Δ rad5Δ (CY12775).

    Article Snippet: Cell culture, psoralen crosslinking and genomic DNA extraction for 2D gels The yeast strains carrying the minichromosome YLpFAT7.1 were grown in synthetic media without leucine, arrested in G1 using alpha factor (SIGMA, 4 μg/ml) and released in YPD media or YPD media containing 0.033% MMS.

    Techniques: Isolation, Two-Dimensional Gel Electrophoresis, Electrophoresis, Derivative Assay

    Comparative genomic analysis of Clostridium difficile ST201 strains with the epidemic 027/ST1 strain R20291 and 078/ST11 strain M120. a Whole genome sequences comparison of the strains. Circles from inside to outside indicate GC content of strain LC693, GC skew of strain LC693, C. difficile strains LC693, VL-0104, VL-0391, R20291 and M120. Different DNA BLAST identities are shown using different colors . b Venn diagram shows shared genes and unique gene among the strains. Pie chart displays COG functional catalogues of the 641 predicted genes specific for the ST201 strains

    Journal: Gut Pathogens

    Article Title: Genome characterization of a novel binary toxin-positive strain of Clostridium difficile and comparison with the epidemic 027 and 078 strains

    doi: 10.1186/s13099-017-0191-z

    Figure Lengend Snippet: Comparative genomic analysis of Clostridium difficile ST201 strains with the epidemic 027/ST1 strain R20291 and 078/ST11 strain M120. a Whole genome sequences comparison of the strains. Circles from inside to outside indicate GC content of strain LC693, GC skew of strain LC693, C. difficile strains LC693, VL-0104, VL-0391, R20291 and M120. Different DNA BLAST identities are shown using different colors . b Venn diagram shows shared genes and unique gene among the strains. Pie chart displays COG functional catalogues of the 641 predicted genes specific for the ST201 strains

    Article Snippet: Genome sequencing, assembly, and annotation Prior to genomic DNA isolation, a single colony of the strain LC693 was selected from C. difficile agar (Sigma, St. Louis, USA) and inoculated in BHIS medium (Brain–heart infusion broth with 10% (w/v) l -cysteine) incubating under an anaerobic atmosphere at 37 °C for 12–24 h. Then the genomic DNA was extracted using QIAGEN Genomic-tip 500/G (QIAGEN, Hilden, Germany) following the manufactory instructions.

    Techniques: Functional Assay

    PCR detection of the LINE1-c- myc gene rearrangement of CTVT origin from cell-derived FNA samples. PCR products (550 bp) were resolved on a 1.5% (w/v) agarose gel. (Lane 1=100 bp DNA marker, Lane 2=positive control, Lane 3=negative control, Lanes 4–9 are samples from the vaginal mass (case 1), skin mass (case 2), nasal mass (case 7), nasal mass (case 8), nasal mass (case 11 in Table 2 ) and chronic inflammation tissue (case 9), respectively.)

    Journal: The Journal of Veterinary Medical Science

    Article Title: Cell-based polymerase chain reaction for canine transmissible venereal tumor (CTVT) diagnosis

    doi: 10.1292/jvms.15-0710

    Figure Lengend Snippet: PCR detection of the LINE1-c- myc gene rearrangement of CTVT origin from cell-derived FNA samples. PCR products (550 bp) were resolved on a 1.5% (w/v) agarose gel. (Lane 1=100 bp DNA marker, Lane 2=positive control, Lane 3=negative control, Lanes 4–9 are samples from the vaginal mass (case 1), skin mass (case 2), nasal mass (case 7), nasal mass (case 8), nasal mass (case 11 in Table 2 ) and chronic inflammation tissue (case 9), respectively.)

    Article Snippet: The LINE1-c-myc PCR assay : Total genomic DNA was extracted from FNA-derived cells and fresh tissue using Mammalian genomic DNA miniprep kit (Sigma-Aldrich, St. Louis, MO, U.S.A.) following the manufacturer’s instruction.

    Techniques: Polymerase Chain Reaction, Derivative Assay, Agarose Gel Electrophoresis, Marker, Positive Control, Negative Control

    Phylogenetic tree of the LINE-c- myc CTVT sequence of this study and the related sequences from the Genbank database. CTVT from Thailand sequences: FNA sample (triangle) sequences of KU680469 (case 1), KU680470 (case 2), KU680471 (case 7), KU680472 (case 11 in Table 2 ) and KU680473 (case 8); and fresh tissue samples (circle) from KU680474 (case 4), KU680475 (case 5, skin mass), KU680476 (case 5, penile mass), KU680477 (case 6) and KU680478 (case 10). CTVT samples in Genbank: Canis lupus familiaris LINE-1 elememt DNA partial sequence (AB012217), LINE/c- myc junction sequence (S55298), Canis familiaris c- myc gene partial sequence (AY032723), Dog c- myc oncogene DNA with a retroposon insertion target sequence (M37386) and Dog c- myc oncogene with an inserted retroposon (M37385).

    Journal: The Journal of Veterinary Medical Science

    Article Title: Cell-based polymerase chain reaction for canine transmissible venereal tumor (CTVT) diagnosis

    doi: 10.1292/jvms.15-0710

    Figure Lengend Snippet: Phylogenetic tree of the LINE-c- myc CTVT sequence of this study and the related sequences from the Genbank database. CTVT from Thailand sequences: FNA sample (triangle) sequences of KU680469 (case 1), KU680470 (case 2), KU680471 (case 7), KU680472 (case 11 in Table 2 ) and KU680473 (case 8); and fresh tissue samples (circle) from KU680474 (case 4), KU680475 (case 5, skin mass), KU680476 (case 5, penile mass), KU680477 (case 6) and KU680478 (case 10). CTVT samples in Genbank: Canis lupus familiaris LINE-1 elememt DNA partial sequence (AB012217), LINE/c- myc junction sequence (S55298), Canis familiaris c- myc gene partial sequence (AY032723), Dog c- myc oncogene DNA with a retroposon insertion target sequence (M37386) and Dog c- myc oncogene with an inserted retroposon (M37385).

    Article Snippet: The LINE1-c-myc PCR assay : Total genomic DNA was extracted from FNA-derived cells and fresh tissue using Mammalian genomic DNA miniprep kit (Sigma-Aldrich, St. Louis, MO, U.S.A.) following the manufacturer’s instruction.

    Techniques: Sequencing

    PCR detection of the LINE1-c- myc gene from cell-derived FNA samples (cases 12 and 24, Table 2 ). PCR products (550 bp) were resolved on a 1.5% (w/v) agarose gel. (Lane1=100-bp DNA marker, Lane 2 =positive control, Lane 3 =case 12, Lane 4 =case 24 and Lane 5 =negative control)

    Journal: The Journal of Veterinary Medical Science

    Article Title: Cell-based polymerase chain reaction for canine transmissible venereal tumor (CTVT) diagnosis

    doi: 10.1292/jvms.15-0710

    Figure Lengend Snippet: PCR detection of the LINE1-c- myc gene from cell-derived FNA samples (cases 12 and 24, Table 2 ). PCR products (550 bp) were resolved on a 1.5% (w/v) agarose gel. (Lane1=100-bp DNA marker, Lane 2 =positive control, Lane 3 =case 12, Lane 4 =case 24 and Lane 5 =negative control)

    Article Snippet: The LINE1-c-myc PCR assay : Total genomic DNA was extracted from FNA-derived cells and fresh tissue using Mammalian genomic DNA miniprep kit (Sigma-Aldrich, St. Louis, MO, U.S.A.) following the manufacturer’s instruction.

    Techniques: Polymerase Chain Reaction, Derivative Assay, Agarose Gel Electrophoresis, Marker, Positive Control, Negative Control

    Characterization of Disease-Specific iPSCs from Csf2rb −/− Mice (A and B) ESC-like morphology in bright-field images (A) and positive alkaline phosphatase staining of miPAP1 iPSCs (B). Scale bar, 200 μm. (C) NANOG, OCT4, and SOX2 expression by immunofluorescence staining (C; scale bar, 50 μm) as well as by (D) qRT-PCR using murine-specific primers (independent experiments, n = 3, mean ± SD). ns, not significant compared with ESCs, two-way ANOVA. (E) Representative flow cytometry plot revealing expression of the SSEA-1 surface marker. (F) Representative pictures of miPAP1-derived teratomas containing tissues of all three embryonic germ layers. Scale bar, 50 μm for ectoderm and endoderm; 100 μm for mesoderm. (G) Scheme and gel electrophoresis of PCR on genomic DNA for genotyping miPAP clones.

    Journal: Stem Cell Reports

    Article Title: Murine iPSC-Derived Macrophages as a Tool for Disease Modeling of Hereditary Pulmonary Alveolar Proteinosis due to Csf2rb Deficiency

    doi: 10.1016/j.stemcr.2016.06.011

    Figure Lengend Snippet: Characterization of Disease-Specific iPSCs from Csf2rb −/− Mice (A and B) ESC-like morphology in bright-field images (A) and positive alkaline phosphatase staining of miPAP1 iPSCs (B). Scale bar, 200 μm. (C) NANOG, OCT4, and SOX2 expression by immunofluorescence staining (C; scale bar, 50 μm) as well as by (D) qRT-PCR using murine-specific primers (independent experiments, n = 3, mean ± SD). ns, not significant compared with ESCs, two-way ANOVA. (E) Representative flow cytometry plot revealing expression of the SSEA-1 surface marker. (F) Representative pictures of miPAP1-derived teratomas containing tissues of all three embryonic germ layers. Scale bar, 50 μm for ectoderm and endoderm; 100 μm for mesoderm. (G) Scheme and gel electrophoresis of PCR on genomic DNA for genotyping miPAP clones.

    Article Snippet: PCR on Genomic DNA Genomic DNA (gDNA) was isolated from tissues or iPSCs using the Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich) according to the manufacturer's instructions.

    Techniques: Mouse Assay, Staining, Expressing, Immunofluorescence, Quantitative RT-PCR, Flow Cytometry, Cytometry, Marker, Derivative Assay, Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Clone Assay

    (h)MeDIP-Seq demonstrates changes in hydroxymethylation of cell polarity genes A. Immunoprecipitation of methylated and hydroxymethylated DNA followed by deep sequencing was performed on DNA isolated from the tumor and non-tumor tissues of eight patients. Sample 25 had the A1908S mutation in TET1 . B. Distribution of 5hmC densities in the gene bodies of BRSK2 , STK11 , FBF1 and SCRIB genes. The graph in red (third from top) represents the hydroxymethylation levels of sample 25 with the A1908S TET1 mutation. Scale bars were equalized across all samples.

    Journal: Oncotarget

    Article Title: Genomic and epigenomic analysis of high-risk prostate cancer reveals changes in hydroxymethylation and TET1

    doi: 10.18632/oncotarget.8220

    Figure Lengend Snippet: (h)MeDIP-Seq demonstrates changes in hydroxymethylation of cell polarity genes A. Immunoprecipitation of methylated and hydroxymethylated DNA followed by deep sequencing was performed on DNA isolated from the tumor and non-tumor tissues of eight patients. Sample 25 had the A1908S mutation in TET1 . B. Distribution of 5hmC densities in the gene bodies of BRSK2 , STK11 , FBF1 and SCRIB genes. The graph in red (third from top) represents the hydroxymethylation levels of sample 25 with the A1908S TET1 mutation. Scale bars were equalized across all samples.

    Article Snippet: Detection of hydroxymethylated DNA Genomic DNA was isolated using the GenElute Mammalian Genomic DNA Miniprep kit (Sigma-Aldrich).

    Techniques: Immunoprecipitation, Methylation, Sequencing, Isolation, Mutagenesis

    ( A ) Median (Interquartile Range) koala retrovirus (KoRV) genomic DNA load (copies/genome), as measured by qPCR, in DNA extracted from blood in koalas ( Phascolarctos cinereus ) and ( B ) Median (Interquartile Range) KoRV viral RNA load (copies/ul) as measured by qPCR in plasma of koalas. Koalas separated into the following groups: (1) koalas that progress to chlamydial disease (Infected + Diseased; n = 13); (2) koalas that are ‘infected but with no clinical disease’ (Infected Only; n = 10); and (3) Negative animals (that remained Chlamydia negative for longer than 12 months; n = 13). The width of the boxes is drawn proportional to the square root of the number of data values. Outliers not shown on axes (but included in analyses) are indicated by #.

    Journal: Scientific Reports

    Article Title: Infection with koala retrovirus subgroup B (KoRV-B), but not KoRV-A, is associated with chlamydial disease in free-ranging koalas (Phascolarctos cinereus)

    doi: 10.1038/s41598-017-00137-4

    Figure Lengend Snippet: ( A ) Median (Interquartile Range) koala retrovirus (KoRV) genomic DNA load (copies/genome), as measured by qPCR, in DNA extracted from blood in koalas ( Phascolarctos cinereus ) and ( B ) Median (Interquartile Range) KoRV viral RNA load (copies/ul) as measured by qPCR in plasma of koalas. Koalas separated into the following groups: (1) koalas that progress to chlamydial disease (Infected + Diseased; n = 13); (2) koalas that are ‘infected but with no clinical disease’ (Infected Only; n = 10); and (3) Negative animals (that remained Chlamydia negative for longer than 12 months; n = 13). The width of the boxes is drawn proportional to the square root of the number of data values. Outliers not shown on axes (but included in analyses) are indicated by #.

    Article Snippet: Total KoRV genomic DNA PCR and quantification Genomic DNA (gDNA) was extracted from whole blood using REDExtract-N-Amp Blood PCR Kit (Sigma Aldrich).

    Techniques: Real-time Polymerase Chain Reaction, Infection

    Analysis of the right border (RB) junctions. Color codes are shown in the legend and a pPZP RB model, in scale, is provided in the upper left corner. From left to right, each junction is described by: (1) an alphanumeric code identifying the transgenic event, if multiple junctions are isolated from the same event, these are identified by a lowercase letter; (2) a graphical representation, in scale, of the rearrangement occurred during integration at the RB, along with the number of the deleted (Δ) bp, in comparison with the expected intact T-DNA sequence; (3) the sequence showing the 30 bp 5′ and 3′ of the junction; letters in lowercase indicate putative gDNA sequences (not verifiable by BLAST analysis, Table S1 ) Letters in red identify bases belonging to the RB.

    Journal: International Journal of Molecular Sciences

    Article Title: An Insight into T-DNA Integration Events in Medicago sativa

    doi: 10.3390/ijms18091951

    Figure Lengend Snippet: Analysis of the right border (RB) junctions. Color codes are shown in the legend and a pPZP RB model, in scale, is provided in the upper left corner. From left to right, each junction is described by: (1) an alphanumeric code identifying the transgenic event, if multiple junctions are isolated from the same event, these are identified by a lowercase letter; (2) a graphical representation, in scale, of the rearrangement occurred during integration at the RB, along with the number of the deleted (Δ) bp, in comparison with the expected intact T-DNA sequence; (3) the sequence showing the 30 bp 5′ and 3′ of the junction; letters in lowercase indicate putative gDNA sequences (not verifiable by BLAST analysis, Table S1 ) Letters in red identify bases belonging to the RB.

    Article Snippet: Isolation of Sequences Flanking T-DNA Insertions Total gDNA was extracted from young, fully expanded leaves collected from the 46 transgenic lines (events), using the GeneElute Plant Genomic DNA Miniprep Kit (SIGMA, St. Louis, MO, USA).

    Techniques: Transgenic Assay, Isolation, Sequencing

    ( a ) Southern hybridization of genomic DNA extracted from T1 A plants with probe RBINTpr (blue segment) or VBpr (purple segment). The bands that hybridized to both probes are marked with a white triangle. Nt: non transgenic; P: binary vector pPZP- hemL - nptII (not linearized); L: 1 Kb ladder; ( b – d ) schemes (not in scale) of the restriction fragments produced by Nco I digestion (black vertical dotted lines are Nco I sites); ( b ) canonical T-DNA processing; ( c ) wrong initiation at the LB and transfer of whole VB along with a single copy of T-DNA; ( d ) correct initiation at the RB and incorrect termination at the LB, resulting in the transfer of the whole VB sequence along with two T-DNA copies. The position of the probes and the length of the restriction fragments are indicated.

    Journal: International Journal of Molecular Sciences

    Article Title: An Insight into T-DNA Integration Events in Medicago sativa

    doi: 10.3390/ijms18091951

    Figure Lengend Snippet: ( a ) Southern hybridization of genomic DNA extracted from T1 A plants with probe RBINTpr (blue segment) or VBpr (purple segment). The bands that hybridized to both probes are marked with a white triangle. Nt: non transgenic; P: binary vector pPZP- hemL - nptII (not linearized); L: 1 Kb ladder; ( b – d ) schemes (not in scale) of the restriction fragments produced by Nco I digestion (black vertical dotted lines are Nco I sites); ( b ) canonical T-DNA processing; ( c ) wrong initiation at the LB and transfer of whole VB along with a single copy of T-DNA; ( d ) correct initiation at the RB and incorrect termination at the LB, resulting in the transfer of the whole VB sequence along with two T-DNA copies. The position of the probes and the length of the restriction fragments are indicated.

    Article Snippet: Isolation of Sequences Flanking T-DNA Insertions Total gDNA was extracted from young, fully expanded leaves collected from the 46 transgenic lines (events), using the GeneElute Plant Genomic DNA Miniprep Kit (SIGMA, St. Louis, MO, USA).

    Techniques: Hybridization, Transgenic Assay, Plasmid Preparation, Produced, Sequencing

    Analysis of left border (LB) junctions. Color codes are shown in the legend and the pPZP LB structure and sequence, in scale, is provided in the upper left corner. From left to right, each junction is described by: (1) an alphanumeric code identifying the transgenic event, if multiple junctions are isolated from the same event, these are identified by a lowercase letter; (2) a graphical representation, in scale, of the rearrangement occurred at the LB, along with the number of the deleted (Δ) or inserted (+) bp, in comparison with the expected intact transferred DNA (T-DNA) sequence (in one case T-DNA sequences with different orientations were detected, black arrows); (3) the sequence showing the 30 bp 5′ and 3′ of the junction; letters in lowercase indicate putative gDNA sequences (not verifiable by BLAST analysis, Table S1 ). Letters in red identify bases belonging to the LB.

    Journal: International Journal of Molecular Sciences

    Article Title: An Insight into T-DNA Integration Events in Medicago sativa

    doi: 10.3390/ijms18091951

    Figure Lengend Snippet: Analysis of left border (LB) junctions. Color codes are shown in the legend and the pPZP LB structure and sequence, in scale, is provided in the upper left corner. From left to right, each junction is described by: (1) an alphanumeric code identifying the transgenic event, if multiple junctions are isolated from the same event, these are identified by a lowercase letter; (2) a graphical representation, in scale, of the rearrangement occurred at the LB, along with the number of the deleted (Δ) or inserted (+) bp, in comparison with the expected intact transferred DNA (T-DNA) sequence (in one case T-DNA sequences with different orientations were detected, black arrows); (3) the sequence showing the 30 bp 5′ and 3′ of the junction; letters in lowercase indicate putative gDNA sequences (not verifiable by BLAST analysis, Table S1 ). Letters in red identify bases belonging to the LB.

    Article Snippet: Isolation of Sequences Flanking T-DNA Insertions Total gDNA was extracted from young, fully expanded leaves collected from the 46 transgenic lines (events), using the GeneElute Plant Genomic DNA Miniprep Kit (SIGMA, St. Louis, MO, USA).

    Techniques: Sequencing, Transgenic Assay, Isolation

    ( a ) Southern blot of genomic DNA extracted from T 1 B and C plants with probe NTPIIpr (blue segment) and VBpr (purple segment). The bands that hybridized to both probes are marked with a white triangle. Nt: non transgenic; P1: binary vector pPZP- hemL (linearized); P2: binary vector pPZP- nptII (linearized); L: 1 Kb ladder; ( b – d ) schemes (not in scale) of the restriction fragments produced by Nco I (black vertical dotted line) digestion ; ( b ) a canonical T-DNA processing; ( c ) wrong initiation at the LB and transfer of the whole VB along with a single copy of the T-DNA; ( d ) correct initiation at the RB and an incorrect termination at the LB, resulting in the transfer of the whole VB sequence along with two T-DNA copies. The position of the probes and of the restriction sites, and the length of the restriction fragments are indicated.

    Journal: International Journal of Molecular Sciences

    Article Title: An Insight into T-DNA Integration Events in Medicago sativa

    doi: 10.3390/ijms18091951

    Figure Lengend Snippet: ( a ) Southern blot of genomic DNA extracted from T 1 B and C plants with probe NTPIIpr (blue segment) and VBpr (purple segment). The bands that hybridized to both probes are marked with a white triangle. Nt: non transgenic; P1: binary vector pPZP- hemL (linearized); P2: binary vector pPZP- nptII (linearized); L: 1 Kb ladder; ( b – d ) schemes (not in scale) of the restriction fragments produced by Nco I (black vertical dotted line) digestion ; ( b ) a canonical T-DNA processing; ( c ) wrong initiation at the LB and transfer of the whole VB along with a single copy of the T-DNA; ( d ) correct initiation at the RB and an incorrect termination at the LB, resulting in the transfer of the whole VB sequence along with two T-DNA copies. The position of the probes and of the restriction sites, and the length of the restriction fragments are indicated.

    Article Snippet: Isolation of Sequences Flanking T-DNA Insertions Total gDNA was extracted from young, fully expanded leaves collected from the 46 transgenic lines (events), using the GeneElute Plant Genomic DNA Miniprep Kit (SIGMA, St. Louis, MO, USA).

    Techniques: Southern Blot, Transgenic Assay, Plasmid Preparation, Produced, Sequencing

    Cytogenetic and molecular analysis. ( a ) Partial karyotyping of patient's bone marrow cells. The derivative chromosome 5 and 8 are shown by arrows. ( b ) Southern blot analysis, presenting rearrangement within FGFR1 gene. Arrows indicate the abnormal bands. ( c ) RT-PCR detection of the fusion transcripts in the patient. ( d ) Partial sequence of SQSTM1 - FGFR1 and reciprocal FGFR1 - SQSTM1 fusion cDNA. The amino-acid translations spanning the fusion are shown under the sequence. ( e ) Detection of der(5) and der(8) chromosomes in the patient's leukemic cells. Amplified genomic DNA fragments from the patient's sample are indicated by arrows. ( f ) Genomic organization of FGFR1 and SQSTM1 , encompassing the breakpoints. Horizontal arrows indicate primers used in PCR. Lanes C and P represent normal control and the patient's sample, respectively.

    Journal: Blood Cancer Journal

    Article Title: A novel fusion of SQSTM1 and FGFR1 in a patient with acute myelomonocytic leukemia with t(5;8)(q35;p11) translocation

    doi: 10.1038/bcj.2014.86

    Figure Lengend Snippet: Cytogenetic and molecular analysis. ( a ) Partial karyotyping of patient's bone marrow cells. The derivative chromosome 5 and 8 are shown by arrows. ( b ) Southern blot analysis, presenting rearrangement within FGFR1 gene. Arrows indicate the abnormal bands. ( c ) RT-PCR detection of the fusion transcripts in the patient. ( d ) Partial sequence of SQSTM1 - FGFR1 and reciprocal FGFR1 - SQSTM1 fusion cDNA. The amino-acid translations spanning the fusion are shown under the sequence. ( e ) Detection of der(5) and der(8) chromosomes in the patient's leukemic cells. Amplified genomic DNA fragments from the patient's sample are indicated by arrows. ( f ) Genomic organization of FGFR1 and SQSTM1 , encompassing the breakpoints. Horizontal arrows indicate primers used in PCR. Lanes C and P represent normal control and the patient's sample, respectively.

    Article Snippet: To identify the chromosomal breakpoints, genomic DNA was amplified by the long-and-accurate PCR method using LA Taq polymerase (Takara Bio).

    Techniques: Southern Blot, Reverse Transcription Polymerase Chain Reaction, Sequencing, Amplification, Polymerase Chain Reaction

    Analysis of co-transcript unit in the ars clusters of Pantoea sp. IMH by RT-PCR. ( a ) Map position of ars genes and the primers for RT-PCR analysis. Primers used and amplified products (numbered) are given below the schematic representation of the genes. (b) Result of RT-PCR reactions with RNA from IMH grown in 1 mM As(V) condition. The numbering on the top of the gels corresponds to the product numbers drawn schematically in the outline given above. M, DNA mark; (+), positive control in which genomic DNA was used as template in the RT-PCR; RT, standard RT-PCR reaction; (−), negative control in which no reverse transcriptase was added to the RT reaction.

    Journal: Scientific Reports

    Article Title: Arsenic resistance strategy in Pantoea sp. IMH: Organization, function and evolution of ars genes

    doi: 10.1038/srep39195

    Figure Lengend Snippet: Analysis of co-transcript unit in the ars clusters of Pantoea sp. IMH by RT-PCR. ( a ) Map position of ars genes and the primers for RT-PCR analysis. Primers used and amplified products (numbered) are given below the schematic representation of the genes. (b) Result of RT-PCR reactions with RNA from IMH grown in 1 mM As(V) condition. The numbering on the top of the gels corresponds to the product numbers drawn schematically in the outline given above. M, DNA mark; (+), positive control in which genomic DNA was used as template in the RT-PCR; RT, standard RT-PCR reaction; (−), negative control in which no reverse transcriptase was added to the RT reaction.

    Article Snippet: After 8 h, the IMH strains were harvested by centrifugation at 4 °C, and the total RNA was isolated using the PrimeScript® RT reagent Kit with gDNA Eraser (Takara Bio) according to the manufacturer’s instructions.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Positive Control, Negative Control

    Agarose gel of PCR product and bis-treated PCR product following (A) 15 minutes and (B) 40 minutes of electrophoresis. Size of each PCR product is as indicated. gDNA–untreated genomic DNA; bis gDNA–bis-treated genomic DNA.

    Journal: PLoS ONE

    Article Title: Circulating cell-free DNA from plasma undergoes less fragmentation during bisulfite treatment than genomic DNA due to low molecular weight

    doi: 10.1371/journal.pone.0224338

    Figure Lengend Snippet: Agarose gel of PCR product and bis-treated PCR product following (A) 15 minutes and (B) 40 minutes of electrophoresis. Size of each PCR product is as indicated. gDNA–untreated genomic DNA; bis gDNA–bis-treated genomic DNA.

    Article Snippet: Human genomic DNA (gDNA) purchased from Roche (Cat #11691112001) and stored at 4°C as specified by the manufacturer was used as the high molecular weight DNA sample.

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Electrophoresis

    Agarose gel of cirDNA and bis-treated cirDNA following (A) 15 minutes and (B) 40 minutes of electrophoresis. The amount of cirDNA in each lane corresponds to the total cirDNA extracted from the plasma volumes indicated. gDNA–untreated genomic DNA.

    Journal: PLoS ONE

    Article Title: Circulating cell-free DNA from plasma undergoes less fragmentation during bisulfite treatment than genomic DNA due to low molecular weight

    doi: 10.1371/journal.pone.0224338

    Figure Lengend Snippet: Agarose gel of cirDNA and bis-treated cirDNA following (A) 15 minutes and (B) 40 minutes of electrophoresis. The amount of cirDNA in each lane corresponds to the total cirDNA extracted from the plasma volumes indicated. gDNA–untreated genomic DNA.

    Article Snippet: Human genomic DNA (gDNA) purchased from Roche (Cat #11691112001) and stored at 4°C as specified by the manufacturer was used as the high molecular weight DNA sample.

    Techniques: Agarose Gel Electrophoresis, Electrophoresis

    Sequencing results for Human genomic DNA. Libraries are prepared using 50 ng of input DNA. Similar enzyme concentrations of Tn5-059 and standard Tn5 are used and 2x151 bp sequencing run is performed on a HiSeqX. a Uniformity of Coverage. Sequencing results are down sampled to 20× coverage. Tn5-059 shows improved uniformity over standard Tn5 in NexteraV2 kit. b Normalized GC plot. Grey bar shows schematic GC composition of Human genome. Standard Tn5 has a clear bias towards GC rich regions while undercovers AT rich regions. c AT/GC dropout. Tn5-059 improves AT dropout while adding little on GC dropout

    Journal: BMC Biotechnology

    Article Title: Improved genome sequencing using an engineered transposase

    doi: 10.1186/s12896-016-0326-1

    Figure Lengend Snippet: Sequencing results for Human genomic DNA. Libraries are prepared using 50 ng of input DNA. Similar enzyme concentrations of Tn5-059 and standard Tn5 are used and 2x151 bp sequencing run is performed on a HiSeqX. a Uniformity of Coverage. Sequencing results are down sampled to 20× coverage. Tn5-059 shows improved uniformity over standard Tn5 in NexteraV2 kit. b Normalized GC plot. Grey bar shows schematic GC composition of Human genome. Standard Tn5 has a clear bias towards GC rich regions while undercovers AT rich regions. c AT/GC dropout. Tn5-059 improves AT dropout while adding little on GC dropout

    Article Snippet: In short, 25 ng B. cereus genomic DNA (gDNA) was tagmented by various concentrations of mutants or standard Tn5 from Illumina Nextera kit as a control.

    Techniques: Sequencing

    Bias plots , showing percentage of observed bases at each position (or sequencing cycle). Plots show insertion bias for standard Tn5 in NexteraV2 kit and two Tn5 mutants from sequencing E. coli genomic DNA. The intensities after position (cycle) 20 are the base composition of E. coli genomic DNA. a Standard Tn5 in NexteraV2 kit. Notice the symmetry in the plot centered at position 5, between positions 1 through 9 b Tn5 mutant, notice the change in the insertion bias at positions 3 through 7 and position 12 c Tn5 mutant, notice the change in the insertion bias at positions 3 through 7, as well as higher G bias at position 1

    Journal: BMC Biotechnology

    Article Title: Improved genome sequencing using an engineered transposase

    doi: 10.1186/s12896-016-0326-1

    Figure Lengend Snippet: Bias plots , showing percentage of observed bases at each position (or sequencing cycle). Plots show insertion bias for standard Tn5 in NexteraV2 kit and two Tn5 mutants from sequencing E. coli genomic DNA. The intensities after position (cycle) 20 are the base composition of E. coli genomic DNA. a Standard Tn5 in NexteraV2 kit. Notice the symmetry in the plot centered at position 5, between positions 1 through 9 b Tn5 mutant, notice the change in the insertion bias at positions 3 through 7 and position 12 c Tn5 mutant, notice the change in the insertion bias at positions 3 through 7, as well as higher G bias at position 1

    Article Snippet: In short, 25 ng B. cereus genomic DNA (gDNA) was tagmented by various concentrations of mutants or standard Tn5 from Illumina Nextera kit as a control.

    Techniques: Sequencing, Mutagenesis

    Sequencing results for B. cereus genomic DNA. Libraries are prepared using 50 ng of input DNA. a Uniformity of Coverage. Sequencing results are down sampled to 24× coverage. Tn5-059 shows improved uniformity when compared to standard Tn5. b Normalized GC plot . Grey bar shows schematic GC composition of B. cereus genome. Tn5-059 has a more uniform coverage with less AT dropout. c AT/GC dropout percentages. Both enzyme have no GC dropout while Tn5-059 shows significant improvement in AT dropout

    Journal: BMC Biotechnology

    Article Title: Improved genome sequencing using an engineered transposase

    doi: 10.1186/s12896-016-0326-1

    Figure Lengend Snippet: Sequencing results for B. cereus genomic DNA. Libraries are prepared using 50 ng of input DNA. a Uniformity of Coverage. Sequencing results are down sampled to 24× coverage. Tn5-059 shows improved uniformity when compared to standard Tn5. b Normalized GC plot . Grey bar shows schematic GC composition of B. cereus genome. Tn5-059 has a more uniform coverage with less AT dropout. c AT/GC dropout percentages. Both enzyme have no GC dropout while Tn5-059 shows significant improvement in AT dropout

    Article Snippet: In short, 25 ng B. cereus genomic DNA (gDNA) was tagmented by various concentrations of mutants or standard Tn5 from Illumina Nextera kit as a control.

    Techniques: Sequencing

    Percentage of observed bases at each cycle using standard Tn5 in NexteraV2 kit ( a ), or Tn5-059 ( b ) for sequencing B. cereus genomic DNA. In particular, the two plots differ at positions 3, 4, 6, 7, 11, 13 and 14. For Tn5-059, the bias within positions 10–15 is much closer to the overall genome composition

    Journal: BMC Biotechnology

    Article Title: Improved genome sequencing using an engineered transposase

    doi: 10.1186/s12896-016-0326-1

    Figure Lengend Snippet: Percentage of observed bases at each cycle using standard Tn5 in NexteraV2 kit ( a ), or Tn5-059 ( b ) for sequencing B. cereus genomic DNA. In particular, the two plots differ at positions 3, 4, 6, 7, 11, 13 and 14. For Tn5-059, the bias within positions 10–15 is much closer to the overall genome composition

    Article Snippet: In short, 25 ng B. cereus genomic DNA (gDNA) was tagmented by various concentrations of mutants or standard Tn5 from Illumina Nextera kit as a control.

    Techniques: Sequencing

    Dnl4 mutations under study. ( A ) Location of mutations made in this study relative to the functional domains of S. cerevisiae Dnl4 (yDnl4). DBD, DNA binding domain; AdD, adenylation domain; OBD, oligonucleotide binding domain; BRCT, BRCA1 C-terminal repeat; black oval, point mutation; red cross, stop codon. ( B ) Multiple sequence alignments surrounding conserved mutated yDnl4 positions. hLig4, human DNA ligase IV; yCdc9, S. cerevisiae DNA ligase I; hLig1, human DNA ligase I; Chlorella, chlorella virus DNA ligase. Magenta, identical among all proteins; red, identical to yDnl4; blue, conserved relative to yDnl4. ( C ) DNA ligase catalytic active site showing a structural alignment of hLig1 bound to a 5′-adenylated DNA nick (PDB 1X9N [5] , shaded more lightly) and adenylated Chlorella virus ligase bound to a nick (PDB 2Q2T [22] , shaded more darkly). Shown are the AMP (yellow), the substrate DNA strand with labeled 3′ and 5′ nick termini, and the universally conserved residues under study, labeled as the homologous positions in yDnl4. Protein and DNA are shaded by element.

    Journal: PLoS Genetics

    Article Title: Saccharomyces cerevisiae DNA Ligase IV Supports Imprecise End Joining Independently of Its Catalytic Activity

    doi: 10.1371/journal.pgen.1003599

    Figure Lengend Snippet: Dnl4 mutations under study. ( A ) Location of mutations made in this study relative to the functional domains of S. cerevisiae Dnl4 (yDnl4). DBD, DNA binding domain; AdD, adenylation domain; OBD, oligonucleotide binding domain; BRCT, BRCA1 C-terminal repeat; black oval, point mutation; red cross, stop codon. ( B ) Multiple sequence alignments surrounding conserved mutated yDnl4 positions. hLig4, human DNA ligase IV; yCdc9, S. cerevisiae DNA ligase I; hLig1, human DNA ligase I; Chlorella, chlorella virus DNA ligase. Magenta, identical among all proteins; red, identical to yDnl4; blue, conserved relative to yDnl4. ( C ) DNA ligase catalytic active site showing a structural alignment of hLig1 bound to a 5′-adenylated DNA nick (PDB 1X9N [5] , shaded more lightly) and adenylated Chlorella virus ligase bound to a nick (PDB 2Q2T [22] , shaded more darkly). Shown are the AMP (yellow), the substrate DNA strand with labeled 3′ and 5′ nick termini, and the universally conserved residues under study, labeled as the homologous positions in yDnl4. Protein and DNA are shaded by element.

    Article Snippet: Genomic DNA was collected from wild-type, dnl4 -K466A, and dnl4Δ strains at 0-hour and 24-hour time points and PCR products flanking the HO DSB site were subjected to Illumina HiSeq sequencing.

    Techniques: Functional Assay, Binding Assay, Mutagenesis, Sequencing, Labeling

    KDM5C R1115H mutation in family UM1. (A) Pedigree of family UM1. (B) Sanger sequencing of genomic DNA from lymphoblastoid cell lines generated from proband (UM1 III-3) and father (UM1 II-1). (C) Multi-species conservation alignment of KDM5C homologs. The following RefSeq sequences were used for alignment: human NP_001140174.1, orangutan NP_001125719.1, rhesus XP_014982969.1, mouse NP_038696.2, rat XP_008771368.1, dog NP_001041497.1, elephant XP_010598233.1, frog NP_001072719.1, fugu XP_003963594.1. (D) Conservation alignment of human KDM5 family proteins, KDM5A-D. The following RefSeq sequences were used for alignment: KDM5A NP_001036068.1, KDM5B NP_006609.3, KDM5C NP_001140174.1, KDM5D NP_001140177.1. (E) Schematic of human KDM5C protein and 26 reported mutations associated with KDM5C -XLID. Missense mutations are depicted above the protein, while nonsense and frame-shift mutations are depicted beneath the molecule. JmN, jumonji-N domain; ARID, AT-rich interacting domain; PHD, plant homeodomain box domain; JmjC, jumonji-C catalytic domain; ZF, zinc finger domain; PLU-1, PLU-1-like domain.

    Journal: Frontiers in Molecular Neuroscience

    Article Title: Altered Gene-Regulatory Function of KDM5C by a Novel Mutation Associated With Autism and Intellectual Disability

    doi: 10.3389/fnmol.2018.00104

    Figure Lengend Snippet: KDM5C R1115H mutation in family UM1. (A) Pedigree of family UM1. (B) Sanger sequencing of genomic DNA from lymphoblastoid cell lines generated from proband (UM1 III-3) and father (UM1 II-1). (C) Multi-species conservation alignment of KDM5C homologs. The following RefSeq sequences were used for alignment: human NP_001140174.1, orangutan NP_001125719.1, rhesus XP_014982969.1, mouse NP_038696.2, rat XP_008771368.1, dog NP_001041497.1, elephant XP_010598233.1, frog NP_001072719.1, fugu XP_003963594.1. (D) Conservation alignment of human KDM5 family proteins, KDM5A-D. The following RefSeq sequences were used for alignment: KDM5A NP_001036068.1, KDM5B NP_006609.3, KDM5C NP_001140174.1, KDM5D NP_001140177.1. (E) Schematic of human KDM5C protein and 26 reported mutations associated with KDM5C -XLID. Missense mutations are depicted above the protein, while nonsense and frame-shift mutations are depicted beneath the molecule. JmN, jumonji-N domain; ARID, AT-rich interacting domain; PHD, plant homeodomain box domain; JmjC, jumonji-C catalytic domain; ZF, zinc finger domain; PLU-1, PLU-1-like domain.

    Article Snippet: We isolated genomic DNA from lymphoblastoid cell lines from father (UM1 II-1) and proband (UM1 III-3), and confirmed by Sanger sequencing that the variant is present specifically in the proband ( Figure ).

    Techniques: Mutagenesis, Sequencing, Generated

    Germline transmission of Rab38 Δ 9.3 alleles. (A) PCR detection of Rab38 Δ 9.3 alleles using primers P-forA and P-del with tail DNA from pups derived from founder AB3 or AB25. M: size marker, +: positive control, −: negative control. (B) Sequence comparison of cloned PCR products (see A) derived from pups AB3-1 and AB25-2 with the parental Rab38 Δ 9.3 allele.

    Journal: FEBS Open Bio

    Article Title: Creation of targeted genomic deletions using TALEN or CRISPR/Cas nuclease pairs in one-cell mouse embryos

    doi: 10.1016/j.fob.2014.11.009

    Figure Lengend Snippet: Germline transmission of Rab38 Δ 9.3 alleles. (A) PCR detection of Rab38 Δ 9.3 alleles using primers P-forA and P-del with tail DNA from pups derived from founder AB3 or AB25. M: size marker, +: positive control, −: negative control. (B) Sequence comparison of cloned PCR products (see A) derived from pups AB3-1 and AB25-2 with the parental Rab38 Δ 9.3 allele.

    Article Snippet: For the genotyping of founder mice and their progeny, PCR reactions using 1 μL genomic DNA (∼100 ng) and 1 μL of each appropriate primer (10 μM) was carried out in a total volume of 25 μL using the 5 PRIME Mastermix (5 PRIME GmbH, Hilden, Germany) and PCR steps of: 94 °C – 5 min; {94 °C – 40 s; 60 °C – 40 s; 72 °C – 60 s} for 30 cycles; 72 °C – 10 min. For the detection of TALEN induced deletions we used the primer pair P-forA (AAGCTCCAGGCTCCGCAAGAC) and P-revA (CCGAACTCCTCACTGGCTCAC) to amplify the TALEN-A1/2 region, the primer pair P-forB (AATGCTACTGTGTTTGCCTTGG) and P-del (CATCTCAAATGTTGGGATCACAAG) to amplify the TALEN-B1/2 region and the primers P-forA and P-del to detect Rab38 Δ 9.3 alleles.

    Techniques: Transmission Assay, Polymerase Chain Reaction, Derivative Assay, Marker, Positive Control, Negative Control, Sequencing, Clone Assay

    Deletion of a 3.2 kb Rab38 gene segment in one-cell embryos using Cas9 and two sgRNAs. (A) PCR detection of Rab38 Δ 3.2 alleles (primers P-for2 and P-del3) and of Rab38 wt alleles (primers P-for2 and P-rev2, spanning exon 1) with tail DNA from 27 pups derived from embryos microinjected with sgRab38-2, -3 and Cas9 RNAs. Upper gel image: Eight founders show PCR bands of ∼326 bp (primers P-forA/P-del3) indicating the presence of Rab38 Δ 3.2 alleles; founders #9 and #23 exhibit unexpected, larger PCR products. Lower gel image: from the founders #6, #8 and #23 the region covering exon 1 of Rab38 could not be amplified, suggesting that both gene copies were processed by Cas9. M: size marker, +: positive control, −: negative control. (B) Sequence comparison of cloned PCR products derived from mutant founders (see A) with the genomic sgRNA target regions of Rab38 and the ODNΔ2/3 (sequence insert underlined). The sequencing of 3–5 clones from each founder revealed in six founders the presence of two mutant alleles. The number of clones classified as type a or b allele is shown in brackets. The deletion endpoints are either located at the DSB site 3 bp upstream of the sgRNA’s PAM sequence (red arrows) or show the loss of additional nucleotides, leading to the disruption of the Rab38 reading frame between codon 34 and 37. In the aberrant alleles #9b and #23b the deleted 3.2 kb region was replaced by sequence inserts of 398 bp (#9b) or 163 bp (#23b) that are derived from the Rab38 gene, located upstream (#9b) or downstream (#23b) of the sgRab38-3 target sequence. (C) Comparison of the coat color of founder #8 and #23 with an agouti colored littermate control ( Rab38 WT ) and of dorsal awls showing the reduced pigmentation of hairs in founder #8 (right insert; 40× magnification). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

    Journal: FEBS Open Bio

    Article Title: Creation of targeted genomic deletions using TALEN or CRISPR/Cas nuclease pairs in one-cell mouse embryos

    doi: 10.1016/j.fob.2014.11.009

    Figure Lengend Snippet: Deletion of a 3.2 kb Rab38 gene segment in one-cell embryos using Cas9 and two sgRNAs. (A) PCR detection of Rab38 Δ 3.2 alleles (primers P-for2 and P-del3) and of Rab38 wt alleles (primers P-for2 and P-rev2, spanning exon 1) with tail DNA from 27 pups derived from embryos microinjected with sgRab38-2, -3 and Cas9 RNAs. Upper gel image: Eight founders show PCR bands of ∼326 bp (primers P-forA/P-del3) indicating the presence of Rab38 Δ 3.2 alleles; founders #9 and #23 exhibit unexpected, larger PCR products. Lower gel image: from the founders #6, #8 and #23 the region covering exon 1 of Rab38 could not be amplified, suggesting that both gene copies were processed by Cas9. M: size marker, +: positive control, −: negative control. (B) Sequence comparison of cloned PCR products derived from mutant founders (see A) with the genomic sgRNA target regions of Rab38 and the ODNΔ2/3 (sequence insert underlined). The sequencing of 3–5 clones from each founder revealed in six founders the presence of two mutant alleles. The number of clones classified as type a or b allele is shown in brackets. The deletion endpoints are either located at the DSB site 3 bp upstream of the sgRNA’s PAM sequence (red arrows) or show the loss of additional nucleotides, leading to the disruption of the Rab38 reading frame between codon 34 and 37. In the aberrant alleles #9b and #23b the deleted 3.2 kb region was replaced by sequence inserts of 398 bp (#9b) or 163 bp (#23b) that are derived from the Rab38 gene, located upstream (#9b) or downstream (#23b) of the sgRab38-3 target sequence. (C) Comparison of the coat color of founder #8 and #23 with an agouti colored littermate control ( Rab38 WT ) and of dorsal awls showing the reduced pigmentation of hairs in founder #8 (right insert; 40× magnification). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

    Article Snippet: For the genotyping of founder mice and their progeny, PCR reactions using 1 μL genomic DNA (∼100 ng) and 1 μL of each appropriate primer (10 μM) was carried out in a total volume of 25 μL using the 5 PRIME Mastermix (5 PRIME GmbH, Hilden, Germany) and PCR steps of: 94 °C – 5 min; {94 °C – 40 s; 60 °C – 40 s; 72 °C – 60 s} for 30 cycles; 72 °C – 10 min. For the detection of TALEN induced deletions we used the primer pair P-forA (AAGCTCCAGGCTCCGCAAGAC) and P-revA (CCGAACTCCTCACTGGCTCAC) to amplify the TALEN-A1/2 region, the primer pair P-forB (AATGCTACTGTGTTTGCCTTGG) and P-del (CATCTCAAATGTTGGGATCACAAG) to amplify the TALEN-B1/2 region and the primers P-forA and P-del to detect Rab38 Δ 9.3 alleles.

    Techniques: Polymerase Chain Reaction, Derivative Assay, Amplification, Marker, Positive Control, Negative Control, Sequencing, Clone Assay, Mutagenesis

    Germline transmission of Rab38 Δ 3.2 alleles. (A) PCR detection of Rab38 Δ 3.2 alleles (primers P-for/P-del3) using tail DNA from pups derived from matings of the indicated mutant founders with wildtype mice. M: size marker, +: positive control, −: negative control. (B) Sequence comparison of PCR products (see A) obtained from the indicated pups with the parental Rab38 Δ 3.2 alleles. The number of deleted basepairs is indicated.

    Journal: FEBS Open Bio

    Article Title: Creation of targeted genomic deletions using TALEN or CRISPR/Cas nuclease pairs in one-cell mouse embryos

    doi: 10.1016/j.fob.2014.11.009

    Figure Lengend Snippet: Germline transmission of Rab38 Δ 3.2 alleles. (A) PCR detection of Rab38 Δ 3.2 alleles (primers P-for/P-del3) using tail DNA from pups derived from matings of the indicated mutant founders with wildtype mice. M: size marker, +: positive control, −: negative control. (B) Sequence comparison of PCR products (see A) obtained from the indicated pups with the parental Rab38 Δ 3.2 alleles. The number of deleted basepairs is indicated.

    Article Snippet: For the genotyping of founder mice and their progeny, PCR reactions using 1 μL genomic DNA (∼100 ng) and 1 μL of each appropriate primer (10 μM) was carried out in a total volume of 25 μL using the 5 PRIME Mastermix (5 PRIME GmbH, Hilden, Germany) and PCR steps of: 94 °C – 5 min; {94 °C – 40 s; 60 °C – 40 s; 72 °C – 60 s} for 30 cycles; 72 °C – 10 min. For the detection of TALEN induced deletions we used the primer pair P-forA (AAGCTCCAGGCTCCGCAAGAC) and P-revA (CCGAACTCCTCACTGGCTCAC) to amplify the TALEN-A1/2 region, the primer pair P-forB (AATGCTACTGTGTTTGCCTTGG) and P-del (CATCTCAAATGTTGGGATCACAAG) to amplify the TALEN-B1/2 region and the primers P-forA and P-del to detect Rab38 Δ 9.3 alleles.

    Techniques: Transmission Assay, Polymerase Chain Reaction, Derivative Assay, Mutagenesis, Mouse Assay, Marker, Positive Control, Negative Control, Sequencing

    Deletion of a 9.3 kb Rab38 gene segment in one-cell embryos using two pairs of TALEN. (A) Schematic diagram of the Rab38 gene and the planned deletion of 9.3 kb ( Rab38 Δ 9.3 allele), indicating the position of the first exon, of the TALEN recognition sites and PCR primer pairs. (B) PCR detection of Rab38 Δ 9.3 alleles using primers P-forA and P-del using tail DNA from 31 pups derived from embryos microinjected with TAL-A1/2 and TAL-B1/2 mRNAs. M: size marker, +: positive control, −: negative control. (C) Sequence comparison of cloned PCR products from founders AB3 and AB25 with the Rab38 wildtype locus, indicating identical deletions of 9355 bp in both founders. The deletion endpoints are located within the TALEN spacer regions. The upstream deletion endpoint disrupts codon 31, followed by a random translational frame. (D) PCR analysis of the TAL-A1/2 target region with tail DNA from 31 pups derived from microinjected embryos using primers P-forA and P-revA. The PCR products amplified from the second Rab38 allele of founders AB3 and AB25 show reduced size, indicating the presence of small deletions. (E) Sequence analysis of cloned PCR products (see D) showing the deletion of 11 bp or of 25 bp within the TAL-A1/2 target region of the second Rab38 allele of founder AB3 or AB25, respectively. The translation of the TAL-A1/2 target sequence within the first exon of Rab38 shows reading frameshifts after codon 31 (AB3) or 27 (AB25). (F) Comparison of the coat color of founder AB25 with an agouti colored littermate control ( Rab38 wt ) and of dorsal awls showing the reduced pigmentation of hairs in the mutant (20× magnification). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

    Journal: FEBS Open Bio

    Article Title: Creation of targeted genomic deletions using TALEN or CRISPR/Cas nuclease pairs in one-cell mouse embryos

    doi: 10.1016/j.fob.2014.11.009

    Figure Lengend Snippet: Deletion of a 9.3 kb Rab38 gene segment in one-cell embryos using two pairs of TALEN. (A) Schematic diagram of the Rab38 gene and the planned deletion of 9.3 kb ( Rab38 Δ 9.3 allele), indicating the position of the first exon, of the TALEN recognition sites and PCR primer pairs. (B) PCR detection of Rab38 Δ 9.3 alleles using primers P-forA and P-del using tail DNA from 31 pups derived from embryos microinjected with TAL-A1/2 and TAL-B1/2 mRNAs. M: size marker, +: positive control, −: negative control. (C) Sequence comparison of cloned PCR products from founders AB3 and AB25 with the Rab38 wildtype locus, indicating identical deletions of 9355 bp in both founders. The deletion endpoints are located within the TALEN spacer regions. The upstream deletion endpoint disrupts codon 31, followed by a random translational frame. (D) PCR analysis of the TAL-A1/2 target region with tail DNA from 31 pups derived from microinjected embryos using primers P-forA and P-revA. The PCR products amplified from the second Rab38 allele of founders AB3 and AB25 show reduced size, indicating the presence of small deletions. (E) Sequence analysis of cloned PCR products (see D) showing the deletion of 11 bp or of 25 bp within the TAL-A1/2 target region of the second Rab38 allele of founder AB3 or AB25, respectively. The translation of the TAL-A1/2 target sequence within the first exon of Rab38 shows reading frameshifts after codon 31 (AB3) or 27 (AB25). (F) Comparison of the coat color of founder AB25 with an agouti colored littermate control ( Rab38 wt ) and of dorsal awls showing the reduced pigmentation of hairs in the mutant (20× magnification). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

    Article Snippet: For the genotyping of founder mice and their progeny, PCR reactions using 1 μL genomic DNA (∼100 ng) and 1 μL of each appropriate primer (10 μM) was carried out in a total volume of 25 μL using the 5 PRIME Mastermix (5 PRIME GmbH, Hilden, Germany) and PCR steps of: 94 °C – 5 min; {94 °C – 40 s; 60 °C – 40 s; 72 °C – 60 s} for 30 cycles; 72 °C – 10 min. For the detection of TALEN induced deletions we used the primer pair P-forA (AAGCTCCAGGCTCCGCAAGAC) and P-revA (CCGAACTCCTCACTGGCTCAC) to amplify the TALEN-A1/2 region, the primer pair P-forB (AATGCTACTGTGTTTGCCTTGG) and P-del (CATCTCAAATGTTGGGATCACAAG) to amplify the TALEN-B1/2 region and the primers P-forA and P-del to detect Rab38 Δ 9.3 alleles.

    Techniques: Polymerase Chain Reaction, Derivative Assay, Marker, Positive Control, Negative Control, Sequencing, Clone Assay, Amplification, Mutagenesis

    Flow chart diagrams illustrating genome and transcriptome assembly pipelines. (A) Pipeline for assembly of PGT21 and PGTAus-pan genomes from DNA reads from Australian Pgt isolates. (B) Pipeline for assembly of isolate 21-0 transcriptome from RNA reads from isolated haustoria and germinated spores.

    Journal: Frontiers in Plant Science

    Article Title: Comparative genomics of Australian isolates of the wheat stem rust pathogen Puccinia graminis f. sp. tritici reveals extensive polymorphism in candidate effector genes

    doi: 10.3389/fpls.2014.00759

    Figure Lengend Snippet: Flow chart diagrams illustrating genome and transcriptome assembly pipelines. (A) Pipeline for assembly of PGT21 and PGTAus-pan genomes from DNA reads from Australian Pgt isolates. (B) Pipeline for assembly of isolate 21-0 transcriptome from RNA reads from isolated haustoria and germinated spores.

    Article Snippet: Pgt isolate 21-0 genomic DNA was sequenced by Roche GS FLX 454 technology at the Australian Genome Research Facility Ltd (AGRF – Australia).

    Techniques: Flow Cytometry, Isolation

    Overview of CORALINA (comprehensive gRNA library generation through controlled nuclease activity). a Three CORALINA libraries (L1, L2, L3) from genomic DNA of human and mouse each were generated and analyzed by NGS to compare conditions and corroborate the reproducibility of the method. b In principle, any type of double stranded DNA can be used as a source for CORALINA library generation. The DNA is fragmented through controlled digestion with MNase and ligated to linker oligos containing only one blunt end, but no phosphate residue. Consequently, linkers aligning in wrong orientation or to linker-oligos instead of fragments are excluded. PCR amplification allows size selection of those sequences containing two different linker sequences. Three different linker sequences (L1, L2, L3) have been used for bulk incorporation into gRNA-PLKO.1 using Gibson Assembly (p: phosphate residue; blue , grey lines : linker sequences and homology regions on gRNA-PLKO.1; orange lines : protospacer sequences, small arrows : primer sequences). c The analyzed representative samples of the three generated human CORALINA libraries have little sequence overlap indicating large library complexity. Shown in numbers are the unique occurrences of protospacers longer than 17 bps

    Journal: BMC Genomics

    Article Title: CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening

    doi: 10.1186/s12864-016-3268-z

    Figure Lengend Snippet: Overview of CORALINA (comprehensive gRNA library generation through controlled nuclease activity). a Three CORALINA libraries (L1, L2, L3) from genomic DNA of human and mouse each were generated and analyzed by NGS to compare conditions and corroborate the reproducibility of the method. b In principle, any type of double stranded DNA can be used as a source for CORALINA library generation. The DNA is fragmented through controlled digestion with MNase and ligated to linker oligos containing only one blunt end, but no phosphate residue. Consequently, linkers aligning in wrong orientation or to linker-oligos instead of fragments are excluded. PCR amplification allows size selection of those sequences containing two different linker sequences. Three different linker sequences (L1, L2, L3) have been used for bulk incorporation into gRNA-PLKO.1 using Gibson Assembly (p: phosphate residue; blue , grey lines : linker sequences and homology regions on gRNA-PLKO.1; orange lines : protospacer sequences, small arrows : primer sequences). c The analyzed representative samples of the three generated human CORALINA libraries have little sequence overlap indicating large library complexity. Shown in numbers are the unique occurrences of protospacers longer than 17 bps

    Article Snippet: The three amplicons were used in 16 Gibson assembly reactions each to incorporate human and mouse genomic DNA into the lentiviral gRNA expression vector efficiently.

    Techniques: Activity Assay, Generated, Next-Generation Sequencing, Polymerase Chain Reaction, Amplification, Selection, Sequencing