full-length lv-rtm-s6m Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Roche long range dntpack
    Long Range Dntpack, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range dntpack/product/Roche
    Average 85 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    long range dntpack - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    92
    Roche reverse primer
    Reverse Primer, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 746 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse primer/product/Roche
    Average 92 stars, based on 746 article reviews
    Price from $9.99 to $1999.99
    reverse primer - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    94
    Roche primer
    Primer, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 3682 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer/product/Roche
    Average 94 stars, based on 3682 article reviews
    Price from $9.99 to $1999.99
    primer - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    93
    Roche pcr analysis
    <t>LV-RTM-S6m</t> transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) <t>PCR</t> analysis on genomic DNA of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.
    Pcr Analysis, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 1200 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr analysis/product/Roche
    Average 93 stars, based on 1200 article reviews
    Price from $9.99 to $1999.99
    pcr analysis - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    99
    Qiagen dna genomic dna
    LV-RTM-S6m transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) <t>PCR</t> analysis on genomic <t>DNA</t> of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.
    Dna Genomic Dna, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 329 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna genomic dna/product/Qiagen
    Average 99 stars, based on 329 article reviews
    Price from $9.99 to $1999.99
    dna genomic dna - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Qiagen dneasy blood and tissue kit
    LV-RTM-S6m transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) <t>PCR</t> analysis on genomic <t>DNA</t> of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.
    Dneasy Blood And Tissue Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 51440 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dneasy blood and tissue kit/product/Qiagen
    Average 99 stars, based on 51440 article reviews
    Price from $9.99 to $1999.99
    dneasy blood and tissue kit - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    LV-RTM-S6m transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) PCR analysis on genomic DNA of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.

    Journal: Nucleic Acids Research

    Article Title: An RNA-targeted therapy for dystrophic epidermolysis bullosa

    doi: 10.1093/nar/gkx669

    Figure Lengend Snippet: LV-RTM-S6m transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) PCR analysis on genomic DNA of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.

    Article Snippet: For detection of full-length LV-RTM-S6m, PCR analysis using a polyA signal specific forward primer (5′CCTCCCCCTGAACCTGAAACATAAAATGAATGC3′), a COL7A1 exon 65 specific reverse primer (5′GATTCAGGCGCCTCTGGGAGAGAAG3′) as well as the Long Range dNTPack (Roche, Vienna, Austria) was performed according to the manufacturer's protocol.

    Techniques: Expressing, Plasmid Preparation, Sequencing, Transduction, Polymerase Chain Reaction, Positive Control, Staining

    Analysis of the trans -spliced COL7A1 mRNA in the LV-RTM-S6m corrected RDEB single cell clone C47. ( A ) Via sqRT-PCR using primers specifically hybridizing to endogenous COL7A1 exon 62/63 and the introduced silent mutation in exon 65 on the RTM, we detected a product of 216 bp, corresponding to the trans -spliced COL7A1 mRNA in LV-RTM-S6m transduced RDEB cell pool and single cell clone C47. LV-RTM-woBD transduced cells served as negative control. ( B ) Sequence analysis of trans-spliced COL7A1 mRNA shows the correct exon 64/65 junction as well as the amplified silent mutations. ( C ) SqRT-PCR analysis showed that 2.113% of COL7A1 mRNA in C47 was correctly trans -spliced. Mean of four individual experiments and error bars (SEM). ***P-value

    Journal: Nucleic Acids Research

    Article Title: An RNA-targeted therapy for dystrophic epidermolysis bullosa

    doi: 10.1093/nar/gkx669

    Figure Lengend Snippet: Analysis of the trans -spliced COL7A1 mRNA in the LV-RTM-S6m corrected RDEB single cell clone C47. ( A ) Via sqRT-PCR using primers specifically hybridizing to endogenous COL7A1 exon 62/63 and the introduced silent mutation in exon 65 on the RTM, we detected a product of 216 bp, corresponding to the trans -spliced COL7A1 mRNA in LV-RTM-S6m transduced RDEB cell pool and single cell clone C47. LV-RTM-woBD transduced cells served as negative control. ( B ) Sequence analysis of trans-spliced COL7A1 mRNA shows the correct exon 64/65 junction as well as the amplified silent mutations. ( C ) SqRT-PCR analysis showed that 2.113% of COL7A1 mRNA in C47 was correctly trans -spliced. Mean of four individual experiments and error bars (SEM). ***P-value

    Article Snippet: For detection of full-length LV-RTM-S6m, PCR analysis using a polyA signal specific forward primer (5′CCTCCCCCTGAACCTGAAACATAAAATGAATGC3′), a COL7A1 exon 65 specific reverse primer (5′GATTCAGGCGCCTCTGGGAGAGAAG3′) as well as the Long Range dNTPack (Roche, Vienna, Austria) was performed according to the manufacturer's protocol.

    Techniques: Polymerase Chain Reaction, Mutagenesis, Negative Control, Sequencing, Amplification

    LV-RTM-S6m transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) PCR analysis on genomic DNA of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.

    Journal: Nucleic Acids Research

    Article Title: An RNA-targeted therapy for dystrophic epidermolysis bullosa

    doi: 10.1093/nar/gkx669

    Figure Lengend Snippet: LV-RTM-S6m transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) PCR analysis on genomic DNA of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.

    Article Snippet: PCR analysis of genomic DNA Genomic DNA of transduced keratinocytes was isolated using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol.

    Techniques: Expressing, Plasmid Preparation, Sequencing, Transduction, Polymerase Chain Reaction, Positive Control, Staining