fgfr4 Thermo Fisher Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Thermo Fisher gene exp fgfr4 hs01106908 m1
    Expression of FGFRs in the human fetal kidney (A) FGFR gene expression was studied using RT-qPCR. Relative expression was calculated as (2 −ΔCT )*100. Pearson correlation analysis revealed a significant association between GA and FGFR3 ( ; r = 0.63, p = 0.0054) and <t>FGFR4</t> (■; r = 0.72, p = 0.0008) gene expression. (B) Immunostaining of FGFRs in the developing kidney. (C) Secondary antibody control for FGFR staining. Magnification, 20x. Arrows indicate a typical example of a glomerulus (gl), proximal tubule (pt) and distal tubule (dt).
    Gene Exp Fgfr4 Hs01106908 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 46 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp fgfr4 hs01106908 m1/product/Thermo Fisher
    Average 97 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    gene exp fgfr4 hs01106908 m1 - by Bioz Stars, 2020-05
    97/100 stars
      Buy from Supplier

    85
    Thermo Fisher gene exp fgfr4 mm00433314 m1
    Expression of FGFRs in the human fetal kidney (A) FGFR gene expression was studied using RT-qPCR. Relative expression was calculated as (2 −ΔCT )*100. Pearson correlation analysis revealed a significant association between GA and FGFR3 ( ; r = 0.63, p = 0.0054) and <t>FGFR4</t> (■; r = 0.72, p = 0.0008) gene expression. (B) Immunostaining of FGFRs in the developing kidney. (C) Secondary antibody control for FGFR staining. Magnification, 20x. Arrows indicate a typical example of a glomerulus (gl), proximal tubule (pt) and distal tubule (dt).
    Gene Exp Fgfr4 Mm00433314 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp fgfr4 mm00433314 m1/product/Thermo Fisher
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    gene exp fgfr4 mm00433314 m1 - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    86
    Thermo Fisher fgfr4 primers
    <t>FGFR4</t> 80-bp deletion line lost FGFR4 expression and signaling. A , genotyping characterization of the 80-bp deletion FGFR4 KO animals. A predicted 279-bp band in WT littermate control animals, 199 bp in KO animals, and both bands in heterozygous ( HET )
    Fgfr4 Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fgfr4 primers/product/Thermo Fisher
    Average 86 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    fgfr4 primers - by Bioz Stars, 2020-05
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher gene exp fgfr4 rn01441815 m1
    <t>Fgfr4</t> expression is elevated in the Cy/+ rat model for chronic kidney disease (CKD). Differences in gene expression of Fgfr1 , r4 , and α-Klotho in EDL muscle from Cy/+ rats or normal littermates (NL) were calculated using the 2 – Δ Δ C T method ( n = 6). * P
    Gene Exp Fgfr4 Rn01441815 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp fgfr4 rn01441815 m1/product/Thermo Fisher
    Average 86 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    gene exp fgfr4 rn01441815 m1 - by Bioz Stars, 2020-05
    86/100 stars
      Buy from Supplier

    87
    Thermo Fisher copy number variation fgfr4 hs01949336 cn
    <t>Fgfr4</t> expression is elevated in the Cy/+ rat model for chronic kidney disease (CKD). Differences in gene expression of Fgfr1 , r4 , and α-Klotho in EDL muscle from Cy/+ rats or normal littermates (NL) were calculated using the 2 – Δ Δ C T method ( n = 6). * P
    Copy Number Variation Fgfr4 Hs01949336 Cn, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/copy number variation fgfr4 hs01949336 cn/product/Thermo Fisher
    Average 87 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    copy number variation fgfr4 hs01949336 cn - by Bioz Stars, 2020-05
    87/100 stars
      Buy from Supplier

    85
    Thermo Fisher gene exp fgfr4 hs00242558 m1
    <t>FGFR4</t> -dependent downstream signaling. A and B, semiconfluent cultures of SW480 transfectants were starved and cell membranes were prepared and extracted. Protein amount and phosphorylation of PLCγ and FRS2α was analyzed by Western blot analysis. C and D, from parallel cultures, protein lysates were prepared after 24 hours for analysis of signaling molecules using phospho-specific antibodies. Photographs of Western blot analysis show results of representative gel runs. Quantification was conducted from 2 independent experiments using duplicate samples.
    Gene Exp Fgfr4 Hs00242558 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp fgfr4 hs00242558 m1/product/Thermo Fisher
    Average 85 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    gene exp fgfr4 hs00242558 m1 - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    93
    Thermo Fisher gene exp fgfr4 mm01341852 m1
    Abundance and location of FGF receptors (FGFRs) in F subpopulations determined by flow cytometry. F isolated on P8 were fixed immediately after isolation and were either permeabilized (total) or not (surface) before staining for FGFR2 (CD332, n = 5) ( A ). B : representative dot plots for FGFR3 (CD333) showing isotype controls ( b and c ) and CD333 ( e and f ) in permeabilized ( b and e ) or unpermeabilized ( c and f ) groups. Combined data for FGFR3 ( n = 4) ( C ) or <t>FGFR4</t> (CD334, n = 4) ( D ) are shown. CD45+ cells were gated out, and data were expressed relative to the total number of cells in the respective subpopulations, based on the intensity of the PDGFR-α-GFP tag. Comparisons were made among the intracellular pools (open portion of bar) or for the extracellular receptors across (closed portions) the 3 subpopulations. Means ± SE, 2-way ANOVA, Student-Newman-Keuls post hoc test. * P
    Gene Exp Fgfr4 Mm01341852 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp fgfr4 mm01341852 m1/product/Thermo Fisher
    Average 93 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    gene exp fgfr4 mm01341852 m1 - by Bioz Stars, 2020-05
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher fgfr4
    Schematic representations of: (A) Wild type and (−16) splice form of mouse <t>FGFR4</t> cDNA; the positions of PCR primers used to identify different portions of the corresponding RNA transcripts are indicated with colored arrows and product sizes are
    Fgfr4, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fgfr4/product/Thermo Fisher
    Average 99 stars, based on 45 article reviews
    Price from $9.99 to $1999.99
    fgfr4 - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    85
    Thermo Fisher gene exp fgfr4 hs01106910 g1
    TGF-β induced upregulation of FGFR1 in CF-HBECs. ( a ) FGFR1 and <t>FGFR4</t> mRNA levels in HBECs from nonsmokers and CF patients at baseline and ( b ) after stimulation with TGF-β (10 ng/mL) for 24 hours. ( c ) Immunohistochemistry staining with anti-FGFR1-HRP and hematoxylin eosin counterstain of whole lung sections from one control patient (non-smoker) compared to a CF patient (20X, scale bars are 40 μm): staining of the bronchial epithelium (arrows) was detected and increased in the CF lung section (representative specimen from a total of 4 lungs in each group). ( d ) FGFR1 mRNA levels of CF-HBECs, exposed to TGF-β for 24 hours (10 ng/mL) ± LY2157299 (10 μM) or SB203580 (10 μM). ( e ) Representative immunoblots are shown after stimulation of CF-HBEC with TGF-β (30–90 min, 10 ng/ml): increased Smad 3 and increased ERK phosphorylation were seen without changes in PLCγ phosphorylation. ( f ) Bar graphs showing densitometric analysis of TGF-β induced fold changes in phospho ERK/total ERK and phospho Smad 3/total Smad 3 ratios in control HBECs (n = 5) compared to CF-HBEC (n = 6). ( g ) Dot plot indicating densitometric changes in phospho Smad/ total Smad 3 ratios in HBECs and CF-HBECs when untreated and TGF-β treated, shown as fold change increase using unpaired t-test and Mann-Whitney post test. Data is presented as means ± S.E. with *P
    Gene Exp Fgfr4 Hs01106910 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp fgfr4 hs01106910 g1/product/Thermo Fisher
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gene exp fgfr4 hs01106910 g1 - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    85
    Thermo Fisher fgfr4 expression
    TGF-β induced upregulation of FGFR1 in CF-HBECs. ( a ) FGFR1 and <t>FGFR4</t> mRNA levels in HBECs from nonsmokers and CF patients at baseline and ( b ) after stimulation with TGF-β (10 ng/mL) for 24 hours. ( c ) Immunohistochemistry staining with anti-FGFR1-HRP and hematoxylin eosin counterstain of whole lung sections from one control patient (non-smoker) compared to a CF patient (20X, scale bars are 40 μm): staining of the bronchial epithelium (arrows) was detected and increased in the CF lung section (representative specimen from a total of 4 lungs in each group). ( d ) FGFR1 mRNA levels of CF-HBECs, exposed to TGF-β for 24 hours (10 ng/mL) ± LY2157299 (10 μM) or SB203580 (10 μM). ( e ) Representative immunoblots are shown after stimulation of CF-HBEC with TGF-β (30–90 min, 10 ng/ml): increased Smad 3 and increased ERK phosphorylation were seen without changes in PLCγ phosphorylation. ( f ) Bar graphs showing densitometric analysis of TGF-β induced fold changes in phospho ERK/total ERK and phospho Smad 3/total Smad 3 ratios in control HBECs (n = 5) compared to CF-HBEC (n = 6). ( g ) Dot plot indicating densitometric changes in phospho Smad/ total Smad 3 ratios in HBECs and CF-HBECs when untreated and TGF-β treated, shown as fold change increase using unpaired t-test and Mann-Whitney post test. Data is presented as means ± S.E. with *P
    Fgfr4 Expression, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fgfr4 expression/product/Thermo Fisher
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    fgfr4 expression - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    87
    Thermo Fisher snp fgfr4 c 8817791 10
    Functional implication and In silico profiling of <t>FGFR4</t> SNP rs351855 (A) Schematic representation of the full-length human FGFR4 protein domain organization. The orange represent the transmembrane that rs351855 was located in this region. (B) Ribbon diagram depicts the transmembrane of rs351855. The blue circles represent amino acids abbreviation and the black circle represents the rs351855 residue change. (C) Mammalian of FGFR4 proteins sequences showed in this alignment. Human ( homo , NM_002011.4 ), chimp ( Pan troglodytes, NC_006472.4 ), mouse ( mus , NM_008011.2 ), rat ( rattus norvegicus , NM_001109904.1 ), and cow ( bos taurus, NM_001109904.1 ). (D) Prediction of transmembrane helices in rs351855.
    Snp Fgfr4 C 8817791 10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snp fgfr4 c 8817791 10/product/Thermo Fisher
    Average 87 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    snp fgfr4 c 8817791 10 - by Bioz Stars, 2020-05
    87/100 stars
      Buy from Supplier

    91
    Thermo Fisher snp fgfr4 c 11317464 20
    Functional implication and In silico profiling of <t>FGFR4</t> SNP rs351855 (A) Schematic representation of the full-length human FGFR4 protein domain organization. The orange represent the transmembrane that rs351855 was located in this region. (B) Ribbon diagram depicts the transmembrane of rs351855. The blue circles represent amino acids abbreviation and the black circle represents the rs351855 residue change. (C) Mammalian of FGFR4 proteins sequences showed in this alignment. Human ( homo , NM_002011.4 ), chimp ( Pan troglodytes, NC_006472.4 ), mouse ( mus , NM_008011.2 ), rat ( rattus norvegicus , NM_001109904.1 ), and cow ( bos taurus, NM_001109904.1 ). (D) Prediction of transmembrane helices in rs351855.
    Snp Fgfr4 C 11317464 20, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snp fgfr4 c 11317464 20/product/Thermo Fisher
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    snp fgfr4 c 11317464 20 - by Bioz Stars, 2020-05
    91/100 stars
      Buy from Supplier

    85
    Thermo Fisher inducible fgfr4 cdna
    <t>FGFR4-dependent</t> apoptotic cell death increases with increasing KLB expression and is stimulated by either FGF19 or FGF1. A , transient expression of KLB in FGFR4-expressing cells. 293 cells harboring inducible FGFR4 <t>cDNA</t> were transiently transfected (
    Inducible Fgfr4 Cdna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/inducible fgfr4 cdna/product/Thermo Fisher
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    inducible fgfr4 cdna - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    94
    Thermo Fisher taqman assays
    <t>FGFR4-dependent</t> apoptotic cell death increases with increasing KLB expression and is stimulated by either FGF19 or FGF1. A , transient expression of KLB in FGFR4-expressing cells. 293 cells harboring inducible FGFR4 <t>cDNA</t> were transiently transfected (
    Taqman Assays, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 12456 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman assays/product/Thermo Fisher
    Average 94 stars, based on 12456 article reviews
    Price from $9.99 to $1999.99
    taqman assays - by Bioz Stars, 2020-05
    94/100 stars
      Buy from Supplier

    88
    Thermo Fisher transfection fgfr4 small interfering rna
    <t>FGFR4-dependent</t> apoptotic cell death increases with increasing KLB expression and is stimulated by either FGF19 or FGF1. A , transient expression of KLB in FGFR4-expressing cells. 293 cells harboring inducible FGFR4 <t>cDNA</t> were transiently transfected (
    Transfection Fgfr4 Small Interfering Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transfection fgfr4 small interfering rna/product/Thermo Fisher
    Average 88 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    transfection fgfr4 small interfering rna - by Bioz Stars, 2020-05
    88/100 stars
      Buy from Supplier

    85
    Thermo Fisher full length human fgfr4
    Mutations promote <t>FGFR4</t> autophosphorylation, Stat3 phosphorylation, and activation of cell cycle and DNA replication pathways.
    Full Length Human Fgfr4, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/full length human fgfr4/product/Thermo Fisher
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    full length human fgfr4 - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    Image Search Results


    Expression of FGFRs in the human fetal kidney (A) FGFR gene expression was studied using RT-qPCR. Relative expression was calculated as (2 −ΔCT )*100. Pearson correlation analysis revealed a significant association between GA and FGFR3 ( ; r = 0.63, p = 0.0054) and FGFR4 (■; r = 0.72, p = 0.0008) gene expression. (B) Immunostaining of FGFRs in the developing kidney. (C) Secondary antibody control for FGFR staining. Magnification, 20x. Arrows indicate a typical example of a glomerulus (gl), proximal tubule (pt) and distal tubule (dt).

    Journal: The Journal of Clinical Endocrinology and Metabolism

    Article Title: Switch in FGFR 3 and 4 expression profile during human renal development may account for transient hypercalcemia in patients with Sotos syndrome due to 5q35 microdeletions

    doi: 10.1210/jc.2014-1123

    Figure Lengend Snippet: Expression of FGFRs in the human fetal kidney (A) FGFR gene expression was studied using RT-qPCR. Relative expression was calculated as (2 −ΔCT )*100. Pearson correlation analysis revealed a significant association between GA and FGFR3 ( ; r = 0.63, p = 0.0054) and FGFR4 (■; r = 0.72, p = 0.0008) gene expression. (B) Immunostaining of FGFRs in the developing kidney. (C) Secondary antibody control for FGFR staining. Magnification, 20x. Arrows indicate a typical example of a glomerulus (gl), proximal tubule (pt) and distal tubule (dt).

    Article Snippet: The following primer-probe sets were used: FGFR3, Hs00179829_m1; FGFR4, Hs01106908_m1; GAPDH, Hs99999905_m1; Klotho, Hs00183100_m1 (all obtained from Life Technologies).

    Techniques: Expressing, Quantitative RT-PCR, Immunostaining, Staining

    New Sotos syndrome case with infantile hypercalcemia (A) Extent of 5q35 microdeletion including both NSD1 and FGFR4. (B) Dots represent the calcium level per day during the first weeks of life. Grey area depicts the normal range of total serum calcium in healthy neonates, obtained from Roberton’s textbook of neonatology (4 th ed., 2005, Elsevier Churchill Livingstone).

    Journal: The Journal of Clinical Endocrinology and Metabolism

    Article Title: Switch in FGFR 3 and 4 expression profile during human renal development may account for transient hypercalcemia in patients with Sotos syndrome due to 5q35 microdeletions

    doi: 10.1210/jc.2014-1123

    Figure Lengend Snippet: New Sotos syndrome case with infantile hypercalcemia (A) Extent of 5q35 microdeletion including both NSD1 and FGFR4. (B) Dots represent the calcium level per day during the first weeks of life. Grey area depicts the normal range of total serum calcium in healthy neonates, obtained from Roberton’s textbook of neonatology (4 th ed., 2005, Elsevier Churchill Livingstone).

    Article Snippet: The following primer-probe sets were used: FGFR3, Hs00179829_m1; FGFR4, Hs01106908_m1; GAPDH, Hs99999905_m1; Klotho, Hs00183100_m1 (all obtained from Life Technologies).

    Techniques:

    Renal FGFR expression in fetal, neonatal and adult tissue FGFR gene expression was studied using RT-qPCR. (A) Expression of FGFR s in fetal (early GA of 14–16 weeks; late GA of 38–40 weeks) and adult renal tissues. Relative expression was calculated with the 2 −ΔΔCT method. Data are expressed as fold change relative to adult values. Statistical analysis was performed via one-way ANOVA followed by Bonferroni’s Multiple Comparison Test. (B) FGFR4 expression in fetal (late, GA of 38–40 weeks) and adult tissue as compared to FGFR3 . Relative expression was calculated with the 2 −ΔΔCT method. Data are expressed as fold change relative to FGFR3 levels . Statistical analysis was performed via an unpaired Student’s t -test. Results are presented as mean ± SEM of two independent determinations performed in duplicate. *** = p

    Journal: The Journal of Clinical Endocrinology and Metabolism

    Article Title: Switch in FGFR 3 and 4 expression profile during human renal development may account for transient hypercalcemia in patients with Sotos syndrome due to 5q35 microdeletions

    doi: 10.1210/jc.2014-1123

    Figure Lengend Snippet: Renal FGFR expression in fetal, neonatal and adult tissue FGFR gene expression was studied using RT-qPCR. (A) Expression of FGFR s in fetal (early GA of 14–16 weeks; late GA of 38–40 weeks) and adult renal tissues. Relative expression was calculated with the 2 −ΔΔCT method. Data are expressed as fold change relative to adult values. Statistical analysis was performed via one-way ANOVA followed by Bonferroni’s Multiple Comparison Test. (B) FGFR4 expression in fetal (late, GA of 38–40 weeks) and adult tissue as compared to FGFR3 . Relative expression was calculated with the 2 −ΔΔCT method. Data are expressed as fold change relative to FGFR3 levels . Statistical analysis was performed via an unpaired Student’s t -test. Results are presented as mean ± SEM of two independent determinations performed in duplicate. *** = p

    Article Snippet: The following primer-probe sets were used: FGFR3, Hs00179829_m1; FGFR4, Hs01106908_m1; GAPDH, Hs99999905_m1; Klotho, Hs00183100_m1 (all obtained from Life Technologies).

    Techniques: Expressing, Quantitative RT-PCR

    FGFR4 80-bp deletion line lost FGFR4 expression and signaling. A , genotyping characterization of the 80-bp deletion FGFR4 KO animals. A predicted 279-bp band in WT littermate control animals, 199 bp in KO animals, and both bands in heterozygous ( HET )

    Journal: The Journal of Biological Chemistry

    Article Title: Fibroblast Growth Factor Receptor 4 (FGFR4) Deficiency Improves Insulin Resistance and Glucose Metabolism under Diet-induced Obesity Conditions *

    doi: 10.1074/jbc.M114.592022

    Figure Lengend Snippet: FGFR4 80-bp deletion line lost FGFR4 expression and signaling. A , genotyping characterization of the 80-bp deletion FGFR4 KO animals. A predicted 279-bp band in WT littermate control animals, 199 bp in KO animals, and both bands in heterozygous ( HET )

    Article Snippet: FGFR4 primers from ABI (Applied Biosystems, Mm01341852_m1 located in exon boundary 11–12) were also used. qRT-PCR was performed on the Stratagene Mx3000P quantitative PCR machine with the Stratagene Brilliant II qRT-PCR Master Mix Kit, 1-Step (600809, Stratagene) using 50 ng of RNA/well and normalized to mouse GAPDH (4352932E and 4352339E, ABI).

    Techniques: Expressing

    FGFR4 KO mice maintained response to FGF19 treatment induced changes in glucose and insulin regulation. 9–11-week-old male WT and KO mice were fed with 60 kcal % high fat diet for 8 weeks. A , OGTT responses of WT and FGFR4 KO animals ( n = 25 each

    Journal: The Journal of Biological Chemistry

    Article Title: Fibroblast Growth Factor Receptor 4 (FGFR4) Deficiency Improves Insulin Resistance and Glucose Metabolism under Diet-induced Obesity Conditions *

    doi: 10.1074/jbc.M114.592022

    Figure Lengend Snippet: FGFR4 KO mice maintained response to FGF19 treatment induced changes in glucose and insulin regulation. 9–11-week-old male WT and KO mice were fed with 60 kcal % high fat diet for 8 weeks. A , OGTT responses of WT and FGFR4 KO animals ( n = 25 each

    Article Snippet: FGFR4 primers from ABI (Applied Biosystems, Mm01341852_m1 located in exon boundary 11–12) were also used. qRT-PCR was performed on the Stratagene Mx3000P quantitative PCR machine with the Stratagene Brilliant II qRT-PCR Master Mix Kit, 1-Step (600809, Stratagene) using 50 ng of RNA/well and normalized to mouse GAPDH (4352932E and 4352339E, ABI).

    Techniques: Mouse Assay

    Improved glucose metabolism and insulin sensitivity in FGFR4 KO animals upon high fat diet feeding. 12-Week-old male WT and KO mice were fed with 60 kcal % high fat diet. Body weight ( A ), OGTT glucose response ( B ), serum insulin ( C ), and fasting glucose

    Journal: The Journal of Biological Chemistry

    Article Title: Fibroblast Growth Factor Receptor 4 (FGFR4) Deficiency Improves Insulin Resistance and Glucose Metabolism under Diet-induced Obesity Conditions *

    doi: 10.1074/jbc.M114.592022

    Figure Lengend Snippet: Improved glucose metabolism and insulin sensitivity in FGFR4 KO animals upon high fat diet feeding. 12-Week-old male WT and KO mice were fed with 60 kcal % high fat diet. Body weight ( A ), OGTT glucose response ( B ), serum insulin ( C ), and fasting glucose

    Article Snippet: FGFR4 primers from ABI (Applied Biosystems, Mm01341852_m1 located in exon boundary 11–12) were also used. qRT-PCR was performed on the Stratagene Mx3000P quantitative PCR machine with the Stratagene Brilliant II qRT-PCR Master Mix Kit, 1-Step (600809, Stratagene) using 50 ng of RNA/well and normalized to mouse GAPDH (4352932E and 4352339E, ABI).

    Techniques: Mouse Assay

    FGFR4 KO Mice Display Significant Improvement in Glucose Metabolism and Insulin Sensitivity

    Journal: The Journal of Biological Chemistry

    Article Title: Fibroblast Growth Factor Receptor 4 (FGFR4) Deficiency Improves Insulin Resistance and Glucose Metabolism under Diet-induced Obesity Conditions *

    doi: 10.1074/jbc.M114.592022

    Figure Lengend Snippet: FGFR4 KO Mice Display Significant Improvement in Glucose Metabolism and Insulin Sensitivity

    Article Snippet: FGFR4 primers from ABI (Applied Biosystems, Mm01341852_m1 located in exon boundary 11–12) were also used. qRT-PCR was performed on the Stratagene Mx3000P quantitative PCR machine with the Stratagene Brilliant II qRT-PCR Master Mix Kit, 1-Step (600809, Stratagene) using 50 ng of RNA/well and normalized to mouse GAPDH (4352932E and 4352339E, ABI).

    Techniques: Mouse Assay

    Metabolic parameters were not significantly changed in FGFR4 KO animals upon chow diet feeding. Body weight ( A ), serum insulin ( B ), serum triglyceride ( C ), and OGTT glucose response ( D ) were recorded from 13–14-week-old age-matched WT and KO animals

    Journal: The Journal of Biological Chemistry

    Article Title: Fibroblast Growth Factor Receptor 4 (FGFR4) Deficiency Improves Insulin Resistance and Glucose Metabolism under Diet-induced Obesity Conditions *

    doi: 10.1074/jbc.M114.592022

    Figure Lengend Snippet: Metabolic parameters were not significantly changed in FGFR4 KO animals upon chow diet feeding. Body weight ( A ), serum insulin ( B ), serum triglyceride ( C ), and OGTT glucose response ( D ) were recorded from 13–14-week-old age-matched WT and KO animals

    Article Snippet: FGFR4 primers from ABI (Applied Biosystems, Mm01341852_m1 located in exon boundary 11–12) were also used. qRT-PCR was performed on the Stratagene Mx3000P quantitative PCR machine with the Stratagene Brilliant II qRT-PCR Master Mix Kit, 1-Step (600809, Stratagene) using 50 ng of RNA/well and normalized to mouse GAPDH (4352932E and 4352339E, ABI).

    Techniques:

    FGFR4 KO Mice Display Significant Improvement in Glucose Metabolism and Insulin Sensitivity

    Journal: The Journal of Biological Chemistry

    Article Title: Fibroblast Growth Factor Receptor 4 (FGFR4) Deficiency Improves Insulin Resistance and Glucose Metabolism under Diet-induced Obesity Conditions *

    doi: 10.1074/jbc.M114.592022

    Figure Lengend Snippet: FGFR4 KO Mice Display Significant Improvement in Glucose Metabolism and Insulin Sensitivity

    Article Snippet: FGFR4 primers from ABI (Applied Biosystems, Mm01341852_m1 located in exon boundary 11–12) were also used. qRT-PCR was performed on the Stratagene Mx3000P quantitative PCR machine with the Stratagene Brilliant II qRT-PCR Master Mix Kit, 1-Step (600809, Stratagene) using 50 ng of RNA/well and normalized to mouse GAPDH (4352932E and 4352339E, ABI).

    Techniques: Mouse Assay

    A model of FGFR4-mediated metabolic regulations. FGFR4 regulates bile acid synthesis by suppressing expression of Cyp7a1 , the bile acid-producing enzyme in liver. In FGFR4 KO, increased basal bile acid synthesis triggered up-regulation of FGF21 in liver

    Journal: The Journal of Biological Chemistry

    Article Title: Fibroblast Growth Factor Receptor 4 (FGFR4) Deficiency Improves Insulin Resistance and Glucose Metabolism under Diet-induced Obesity Conditions *

    doi: 10.1074/jbc.M114.592022

    Figure Lengend Snippet: A model of FGFR4-mediated metabolic regulations. FGFR4 regulates bile acid synthesis by suppressing expression of Cyp7a1 , the bile acid-producing enzyme in liver. In FGFR4 KO, increased basal bile acid synthesis triggered up-regulation of FGF21 in liver

    Article Snippet: FGFR4 primers from ABI (Applied Biosystems, Mm01341852_m1 located in exon boundary 11–12) were also used. qRT-PCR was performed on the Stratagene Mx3000P quantitative PCR machine with the Stratagene Brilliant II qRT-PCR Master Mix Kit, 1-Step (600809, Stratagene) using 50 ng of RNA/well and normalized to mouse GAPDH (4352932E and 4352339E, ABI).

    Techniques: Expressing

    Fgfr4 expression is elevated in the Cy/+ rat model for chronic kidney disease (CKD). Differences in gene expression of Fgfr1 , r4 , and α-Klotho in EDL muscle from Cy/+ rats or normal littermates (NL) were calculated using the 2 – Δ Δ C T method ( n = 6). * P

    Journal: American Journal of Physiology - Endocrinology and Metabolism

    Article Title: Fibroblast growth factor 23 does not directly influence skeletal muscle cell proliferation and differentiation or ex vivo muscle contractility

    doi: 10.1152/ajpendo.00343.2017

    Figure Lengend Snippet: Fgfr4 expression is elevated in the Cy/+ rat model for chronic kidney disease (CKD). Differences in gene expression of Fgfr1 , r4 , and α-Klotho in EDL muscle from Cy/+ rats or normal littermates (NL) were calculated using the 2 – Δ Δ C T method ( n = 6). * P

    Article Snippet: Premade TaqMan primer/probe sets specific for mouse are as follows: β-actin (Mm01205647_g1), Fgfr1 (Mm00438930_m1), Fgfr2 (Mm01269930_m1), Fgfr3 (Mm00433294_m1), Fgfr4 (Mm01341852_m1), Fgf23 (Mm00445621_m1), α-Klotho (Mm00502002_m1), Pax7 (Mm01354484_m1), Myod (Mm01203489_g1), Myogenin (Mm00446195_g1), Myostatin (Mm01254559_m1); and for rat: β-actin (Rn00667869), Fgfr1 (Rn00577234), Fgfr4 (Rn01441815), and α-Klotho (Rn00580123_m1) were utilized (Applied Biosystems, Foster City, CA).

    Techniques: Expressing

    FGFR4 -dependent downstream signaling. A and B, semiconfluent cultures of SW480 transfectants were starved and cell membranes were prepared and extracted. Protein amount and phosphorylation of PLCγ and FRS2α was analyzed by Western blot analysis. C and D, from parallel cultures, protein lysates were prepared after 24 hours for analysis of signaling molecules using phospho-specific antibodies. Photographs of Western blot analysis show results of representative gel runs. Quantification was conducted from 2 independent experiments using duplicate samples.

    Journal: Cancer research

    Article Title: Differential Effects of Polymorphic Alleles of FGF Receptor 4 on Colon Cancer Growth and Metastasis

    doi: 10.1158/0008-5472.CAN-11-3654

    Figure Lengend Snippet: FGFR4 -dependent downstream signaling. A and B, semiconfluent cultures of SW480 transfectants were starved and cell membranes were prepared and extracted. Protein amount and phosphorylation of PLCγ and FRS2α was analyzed by Western blot analysis. C and D, from parallel cultures, protein lysates were prepared after 24 hours for analysis of signaling molecules using phospho-specific antibodies. Photographs of Western blot analysis show results of representative gel runs. Quantification was conducted from 2 independent experiments using duplicate samples.

    Article Snippet: TaqMan assays from Applied Biosystems were used to determine expression of FGFR4 (Hs00242558_m1) and GAPDH (Hs99999905_m1) mRNAs by quantitative RT-PCR (qRT-PCR).

    Techniques: Western Blot

    Impact of FGFR4 knockdown on clonogenicity and migration in vitro . siRNA oligonucleotides were introduced by lipofection into HCT116 and HT29 cells. Controls were transfected with scrambled control siRNA. A, five days after knockdown, cell viability was measured by MTT assay. B, 24 hours after knockdown, proliferation was determined by 3 H-thymidine uptake. From parallel cultures, cells were harvested 24 hours after transfection and plated at 100 and 200 cells/6-well for colony formation assays (C) and 2 × 10 4 cells/filter for migration assays (D). Results were pooled from at least 3 independent experiments and presented as mean ± SD. # and ## indicate a decrease as compared with control at P

    Journal: Cancer research

    Article Title: Differential Effects of Polymorphic Alleles of FGF Receptor 4 on Colon Cancer Growth and Metastasis

    doi: 10.1158/0008-5472.CAN-11-3654

    Figure Lengend Snippet: Impact of FGFR4 knockdown on clonogenicity and migration in vitro . siRNA oligonucleotides were introduced by lipofection into HCT116 and HT29 cells. Controls were transfected with scrambled control siRNA. A, five days after knockdown, cell viability was measured by MTT assay. B, 24 hours after knockdown, proliferation was determined by 3 H-thymidine uptake. From parallel cultures, cells were harvested 24 hours after transfection and plated at 100 and 200 cells/6-well for colony formation assays (C) and 2 × 10 4 cells/filter for migration assays (D). Results were pooled from at least 3 independent experiments and presented as mean ± SD. # and ## indicate a decrease as compared with control at P

    Article Snippet: TaqMan assays from Applied Biosystems were used to determine expression of FGFR4 (Hs00242558_m1) and GAPDH (Hs99999905_m1) mRNAs by quantitative RT-PCR (qRT-PCR).

    Techniques: Migration, In Vitro, Transfection, MTT Assay

    Impact of FGFR4 overexpression on tumor cell growth and migration in vitro . Stable transfectants overexpressing FGFR4 arg or FGFR4 gly in SW480, HCT116, or HT29 cells were used to assess growth and malignant characteristics in vitro . Stable transfectants with the pcDNA3 vector were used as controls. A, 100 and 200 cells were seeded/6-well, medium was changed after 24 hours, and the number of colonies counted after 10 days of growth. B, five thousand cells each were suspended in soft agar medium and plated in 6-well plates. The number of colonies was counted at a magnification of 10-fold after 3 weeks of growth. C, cell migration was determined by filter migration assay from 2 × 10 4 cells/24-well. Photographs of cultures show representative results from SW480 transfectants. Quantitative results from all cell lines were calculated as % of control, pooled from at least 3 independent experiments, and presented as mean ± SD. *, **, *** indicate an increase as compared with the control at P

    Journal: Cancer research

    Article Title: Differential Effects of Polymorphic Alleles of FGF Receptor 4 on Colon Cancer Growth and Metastasis

    doi: 10.1158/0008-5472.CAN-11-3654

    Figure Lengend Snippet: Impact of FGFR4 overexpression on tumor cell growth and migration in vitro . Stable transfectants overexpressing FGFR4 arg or FGFR4 gly in SW480, HCT116, or HT29 cells were used to assess growth and malignant characteristics in vitro . Stable transfectants with the pcDNA3 vector were used as controls. A, 100 and 200 cells were seeded/6-well, medium was changed after 24 hours, and the number of colonies counted after 10 days of growth. B, five thousand cells each were suspended in soft agar medium and plated in 6-well plates. The number of colonies was counted at a magnification of 10-fold after 3 weeks of growth. C, cell migration was determined by filter migration assay from 2 × 10 4 cells/24-well. Photographs of cultures show representative results from SW480 transfectants. Quantitative results from all cell lines were calculated as % of control, pooled from at least 3 independent experiments, and presented as mean ± SD. *, **, *** indicate an increase as compared with the control at P

    Article Snippet: TaqMan assays from Applied Biosystems were used to determine expression of FGFR4 (Hs00242558_m1) and GAPDH (Hs99999905_m1) mRNAs by quantitative RT-PCR (qRT-PCR).

    Techniques: Over Expression, Migration, In Vitro, Plasmid Preparation

    Abundance and location of FGF receptors (FGFRs) in F subpopulations determined by flow cytometry. F isolated on P8 were fixed immediately after isolation and were either permeabilized (total) or not (surface) before staining for FGFR2 (CD332, n = 5) ( A ). B : representative dot plots for FGFR3 (CD333) showing isotype controls ( b and c ) and CD333 ( e and f ) in permeabilized ( b and e ) or unpermeabilized ( c and f ) groups. Combined data for FGFR3 ( n = 4) ( C ) or FGFR4 (CD334, n = 4) ( D ) are shown. CD45+ cells were gated out, and data were expressed relative to the total number of cells in the respective subpopulations, based on the intensity of the PDGFR-α-GFP tag. Comparisons were made among the intracellular pools (open portion of bar) or for the extracellular receptors across (closed portions) the 3 subpopulations. Means ± SE, 2-way ANOVA, Student-Newman-Keuls post hoc test. * P

    Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology

    Article Title: Fibroblast growth factor signaling in myofibroblasts differs from lipofibroblasts during alveolar septation in mice

    doi: 10.1152/ajplung.00013.2015

    Figure Lengend Snippet: Abundance and location of FGF receptors (FGFRs) in F subpopulations determined by flow cytometry. F isolated on P8 were fixed immediately after isolation and were either permeabilized (total) or not (surface) before staining for FGFR2 (CD332, n = 5) ( A ). B : representative dot plots for FGFR3 (CD333) showing isotype controls ( b and c ) and CD333 ( e and f ) in permeabilized ( b and e ) or unpermeabilized ( c and f ) groups. Combined data for FGFR3 ( n = 4) ( C ) or FGFR4 (CD334, n = 4) ( D ) are shown. CD45+ cells were gated out, and data were expressed relative to the total number of cells in the respective subpopulations, based on the intensity of the PDGFR-α-GFP tag. Comparisons were made among the intracellular pools (open portion of bar) or for the extracellular receptors across (closed portions) the 3 subpopulations. Means ± SE, 2-way ANOVA, Student-Newman-Keuls post hoc test. * P

    Article Snippet: RNA was isolated and subjected to real-time qRT-PCR using the following TaqMan probes ( ): β2-microglobulin (Mm00437762_m1), Spry2 (Mm00442344_m1), Spry4 (Mm00442345_m1), FGFR3 (Mm00433294_m1), FGFR4 (Mm01341852_m1), FGF10 (Mm00433275_m1), and FGF18 (Mm00433286_m1).

    Techniques: Flow Cytometry, Cytometry, Isolation, Staining

    Quantitative real-time PCR showing abundance of FGFR mRNA in F. F were isolated and separated into 3 subpopulations by flow cytometric sorting based on the intensity of GFP and absence of CD45. Means ± SE. A : FGFR3, n = 6; FGFR4 n = 4. FGFR2IIIb ( B , n = 5) and FGFR2IIIc ( A , n = 5) splice forms were distinguished and are shown separately, whereas the splice forms of FGFR3 were not distinguished. 2-way ANOVA, Student-Newman-Keuls post hoc test. * P

    Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology

    Article Title: Fibroblast growth factor signaling in myofibroblasts differs from lipofibroblasts during alveolar septation in mice

    doi: 10.1152/ajplung.00013.2015

    Figure Lengend Snippet: Quantitative real-time PCR showing abundance of FGFR mRNA in F. F were isolated and separated into 3 subpopulations by flow cytometric sorting based on the intensity of GFP and absence of CD45. Means ± SE. A : FGFR3, n = 6; FGFR4 n = 4. FGFR2IIIb ( B , n = 5) and FGFR2IIIc ( A , n = 5) splice forms were distinguished and are shown separately, whereas the splice forms of FGFR3 were not distinguished. 2-way ANOVA, Student-Newman-Keuls post hoc test. * P

    Article Snippet: RNA was isolated and subjected to real-time qRT-PCR using the following TaqMan probes ( ): β2-microglobulin (Mm00437762_m1), Spry2 (Mm00442344_m1), Spry4 (Mm00442345_m1), FGFR3 (Mm00433294_m1), FGFR4 (Mm01341852_m1), FGF10 (Mm00433275_m1), and FGF18 (Mm00433286_m1).

    Techniques: Real-time Polymerase Chain Reaction, Isolation, Flow Cytometry

    Schematic representations of: (A) Wild type and (−16) splice form of mouse FGFR4 cDNA; the positions of PCR primers used to identify different portions of the corresponding RNA transcripts are indicated with colored arrows and product sizes are

    Journal:

    Article Title: FGFR4 and its novel splice form in myogenic cells: interplay of glycosylation and tyrosine phosphorylation

    doi: 10.1002/jcp.21365

    Figure Lengend Snippet: Schematic representations of: (A) Wild type and (−16) splice form of mouse FGFR4 cDNA; the positions of PCR primers used to identify different portions of the corresponding RNA transcripts are indicated with colored arrows and product sizes are

    Article Snippet: The full coding sequence of FGFR4 was then retrieved by PCR using the paired forward / reverse primers: GTGGTCAGTGGGAAGTCTGG / TGCCATGTCTTCTGTCGTTC. cDNA products were cloned into pCRII-TOPO vector using the pCRII-TOPO cloning system (Invitrogen).

    Techniques: Polymerase Chain Reaction

    RT-PCR analysis of mouse FGFR4 forms expressed in: (A) primary myogenic cells cultured for 7 days; MyoD gene expression served as a reference for the myogenic characteristic of the cultures. (B) Organs from 4-day old mice. cDNA templates were made from

    Journal:

    Article Title: FGFR4 and its novel splice form in myogenic cells: interplay of glycosylation and tyrosine phosphorylation

    doi: 10.1002/jcp.21365

    Figure Lengend Snippet: RT-PCR analysis of mouse FGFR4 forms expressed in: (A) primary myogenic cells cultured for 7 days; MyoD gene expression served as a reference for the myogenic characteristic of the cultures. (B) Organs from 4-day old mice. cDNA templates were made from

    Article Snippet: The full coding sequence of FGFR4 was then retrieved by PCR using the paired forward / reverse primers: GTGGTCAGTGGGAAGTCTGG / TGCCATGTCTTCTGTCGTTC. cDNA products were cloned into pCRII-TOPO vector using the pCRII-TOPO cloning system (Invitrogen).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Cell Culture, Expressing, Mouse Assay

    Detection of endogenous and overexpressed forms of mouse FGFR4 by Western blotting. FGFR4 bands were detected directly in the initial lysates or following immunoprecipitation (IP) with the same anti-FGFR4 antibody used for developing the blots. (A) Primary

    Journal:

    Article Title: FGFR4 and its novel splice form in myogenic cells: interplay of glycosylation and tyrosine phosphorylation

    doi: 10.1002/jcp.21365

    Figure Lengend Snippet: Detection of endogenous and overexpressed forms of mouse FGFR4 by Western blotting. FGFR4 bands were detected directly in the initial lysates or following immunoprecipitation (IP) with the same anti-FGFR4 antibody used for developing the blots. (A) Primary

    Article Snippet: The full coding sequence of FGFR4 was then retrieved by PCR using the paired forward / reverse primers: GTGGTCAGTGGGAAGTCTGG / TGCCATGTCTTCTGTCGTTC. cDNA products were cloned into pCRII-TOPO vector using the pCRII-TOPO cloning system (Invitrogen).

    Techniques: Western Blot, Immunoprecipitation

    FGFR4 expression during myogenic differentiation of C2C12 cells. Cells were switched to differentiation medium at time 0 and harvested at different days as indicated at the top of the panels. (A) RT-PCR analysis on templates made from total RNA; GAPDH

    Journal:

    Article Title: FGFR4 and its novel splice form in myogenic cells: interplay of glycosylation and tyrosine phosphorylation

    doi: 10.1002/jcp.21365

    Figure Lengend Snippet: FGFR4 expression during myogenic differentiation of C2C12 cells. Cells were switched to differentiation medium at time 0 and harvested at different days as indicated at the top of the panels. (A) RT-PCR analysis on templates made from total RNA; GAPDH

    Article Snippet: The full coding sequence of FGFR4 was then retrieved by PCR using the paired forward / reverse primers: GTGGTCAGTGGGAAGTCTGG / TGCCATGTCTTCTGTCGTTC. cDNA products were cloned into pCRII-TOPO vector using the pCRII-TOPO cloning system (Invitrogen).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction

    Outcome of co-expression of FGFR4 (or FGFR4(−16)) and FGFR3-1 in 293T cells. Schematics of expressed constructs are depicted in . (A, B) Western blot analysis of tyrosine phosphorylation of FGFR4 and FGFR4(−16) HA-tagged constructs

    Journal:

    Article Title: FGFR4 and its novel splice form in myogenic cells: interplay of glycosylation and tyrosine phosphorylation

    doi: 10.1002/jcp.21365

    Figure Lengend Snippet: Outcome of co-expression of FGFR4 (or FGFR4(−16)) and FGFR3-1 in 293T cells. Schematics of expressed constructs are depicted in . (A, B) Western blot analysis of tyrosine phosphorylation of FGFR4 and FGFR4(−16) HA-tagged constructs

    Article Snippet: The full coding sequence of FGFR4 was then retrieved by PCR using the paired forward / reverse primers: GTGGTCAGTGGGAAGTCTGG / TGCCATGTCTTCTGTCGTTC. cDNA products were cloned into pCRII-TOPO vector using the pCRII-TOPO cloning system (Invitrogen).

    Techniques: Expressing, Construct, Western Blot

    RT-PCR analysis of FGFR4 and FGFR4(−16) expression during myogenic differentiation of the 10T½-MyoD-ER cell line. Cells were maintained in growth medium (10% FBS) or in 2% horse serum (HS) with or without the β-estradiol (10 −7

    Journal:

    Article Title: FGFR4 and its novel splice form in myogenic cells: interplay of glycosylation and tyrosine phosphorylation

    doi: 10.1002/jcp.21365

    Figure Lengend Snippet: RT-PCR analysis of FGFR4 and FGFR4(−16) expression during myogenic differentiation of the 10T½-MyoD-ER cell line. Cells were maintained in growth medium (10% FBS) or in 2% horse serum (HS) with or without the β-estradiol (10 −7

    Article Snippet: The full coding sequence of FGFR4 was then retrieved by PCR using the paired forward / reverse primers: GTGGTCAGTGGGAAGTCTGG / TGCCATGTCTTCTGTCGTTC. cDNA products were cloned into pCRII-TOPO vector using the pCRII-TOPO cloning system (Invitrogen).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing

    TGF-β induced upregulation of FGFR1 in CF-HBECs. ( a ) FGFR1 and FGFR4 mRNA levels in HBECs from nonsmokers and CF patients at baseline and ( b ) after stimulation with TGF-β (10 ng/mL) for 24 hours. ( c ) Immunohistochemistry staining with anti-FGFR1-HRP and hematoxylin eosin counterstain of whole lung sections from one control patient (non-smoker) compared to a CF patient (20X, scale bars are 40 μm): staining of the bronchial epithelium (arrows) was detected and increased in the CF lung section (representative specimen from a total of 4 lungs in each group). ( d ) FGFR1 mRNA levels of CF-HBECs, exposed to TGF-β for 24 hours (10 ng/mL) ± LY2157299 (10 μM) or SB203580 (10 μM). ( e ) Representative immunoblots are shown after stimulation of CF-HBEC with TGF-β (30–90 min, 10 ng/ml): increased Smad 3 and increased ERK phosphorylation were seen without changes in PLCγ phosphorylation. ( f ) Bar graphs showing densitometric analysis of TGF-β induced fold changes in phospho ERK/total ERK and phospho Smad 3/total Smad 3 ratios in control HBECs (n = 5) compared to CF-HBEC (n = 6). ( g ) Dot plot indicating densitometric changes in phospho Smad/ total Smad 3 ratios in HBECs and CF-HBECs when untreated and TGF-β treated, shown as fold change increase using unpaired t-test and Mann-Whitney post test. Data is presented as means ± S.E. with *P

    Journal: Scientific Reports

    Article Title: Klotho Inhibits Interleukin-8 Secretion from Cystic Fibrosis Airway Epithelia

    doi: 10.1038/s41598-017-14811-0

    Figure Lengend Snippet: TGF-β induced upregulation of FGFR1 in CF-HBECs. ( a ) FGFR1 and FGFR4 mRNA levels in HBECs from nonsmokers and CF patients at baseline and ( b ) after stimulation with TGF-β (10 ng/mL) for 24 hours. ( c ) Immunohistochemistry staining with anti-FGFR1-HRP and hematoxylin eosin counterstain of whole lung sections from one control patient (non-smoker) compared to a CF patient (20X, scale bars are 40 μm): staining of the bronchial epithelium (arrows) was detected and increased in the CF lung section (representative specimen from a total of 4 lungs in each group). ( d ) FGFR1 mRNA levels of CF-HBECs, exposed to TGF-β for 24 hours (10 ng/mL) ± LY2157299 (10 μM) or SB203580 (10 μM). ( e ) Representative immunoblots are shown after stimulation of CF-HBEC with TGF-β (30–90 min, 10 ng/ml): increased Smad 3 and increased ERK phosphorylation were seen without changes in PLCγ phosphorylation. ( f ) Bar graphs showing densitometric analysis of TGF-β induced fold changes in phospho ERK/total ERK and phospho Smad 3/total Smad 3 ratios in control HBECs (n = 5) compared to CF-HBEC (n = 6). ( g ) Dot plot indicating densitometric changes in phospho Smad/ total Smad 3 ratios in HBECs and CF-HBECs when untreated and TGF-β treated, shown as fold change increase using unpaired t-test and Mann-Whitney post test. Data is presented as means ± S.E. with *P

    Article Snippet: Real-time quantitative PCR was performed using the following TaqMan probes: Hs00241111_m1 for FGFR1, Hs01106910_g1 for FGFR4, Hs00934627_m1 for KL, Hs00174103_m1 for IL-8, Mm00446190_m1 for IL-6, and Hs02758991_g1 for GAPDH.

    Techniques: Immunohistochemistry, Staining, Western Blot, MANN-WHITNEY

    Functional implication and In silico profiling of FGFR4 SNP rs351855 (A) Schematic representation of the full-length human FGFR4 protein domain organization. The orange represent the transmembrane that rs351855 was located in this region. (B) Ribbon diagram depicts the transmembrane of rs351855. The blue circles represent amino acids abbreviation and the black circle represents the rs351855 residue change. (C) Mammalian of FGFR4 proteins sequences showed in this alignment. Human ( homo , NM_002011.4 ), chimp ( Pan troglodytes, NC_006472.4 ), mouse ( mus , NM_008011.2 ), rat ( rattus norvegicus , NM_001109904.1 ), and cow ( bos taurus, NM_001109904.1 ). (D) Prediction of transmembrane helices in rs351855.

    Journal: Oncotarget

    Article Title: Functional FGFR4 Gly388Arg polymorphism contributes to oral squamous cell carcinoma susceptibility

    doi: 10.18632/oncotarget.21958

    Figure Lengend Snippet: Functional implication and In silico profiling of FGFR4 SNP rs351855 (A) Schematic representation of the full-length human FGFR4 protein domain organization. The orange represent the transmembrane that rs351855 was located in this region. (B) Ribbon diagram depicts the transmembrane of rs351855. The blue circles represent amino acids abbreviation and the black circle represents the rs351855 residue change. (C) Mammalian of FGFR4 proteins sequences showed in this alignment. Human ( homo , NM_002011.4 ), chimp ( Pan troglodytes, NC_006472.4 ), mouse ( mus , NM_008011.2 ), rat ( rattus norvegicus , NM_001109904.1 ), and cow ( bos taurus, NM_001109904.1 ). (D) Prediction of transmembrane helices in rs351855.

    Article Snippet: Allelic discrimination for the FGFR4 SNPs was assessed using the TaqMan assay (ID C_8817791_10 for rs2011077, C_3166614_10 for rs351855, C_11270571_10 for rs7708357, and C_11317464_20 for rs1966265) with an ABI StepOne™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) Subsequent assessment was performed using SDS version 3.0.

    Techniques: Functional Assay, In Silico

    Exon and intron position of FGFR4 gene in human and FGFR4 gene polymorphisms assessed in study (A) The position of four SNPs of FGFR4 gene from the chromosome chr 5:177089630 to 177104771 (reference genome GRCh38.p7). The lower panel shows population-specific heterozygosity frequencies of this polymorphism in East Asian population (HAPMAP-CHB). (B) FGFR4gene polymorphisms assessed in this study.

    Journal: Oncotarget

    Article Title: Functional FGFR4 Gly388Arg polymorphism contributes to oral squamous cell carcinoma susceptibility

    doi: 10.18632/oncotarget.21958

    Figure Lengend Snippet: Exon and intron position of FGFR4 gene in human and FGFR4 gene polymorphisms assessed in study (A) The position of four SNPs of FGFR4 gene from the chromosome chr 5:177089630 to 177104771 (reference genome GRCh38.p7). The lower panel shows population-specific heterozygosity frequencies of this polymorphism in East Asian population (HAPMAP-CHB). (B) FGFR4gene polymorphisms assessed in this study.

    Article Snippet: Allelic discrimination for the FGFR4 SNPs was assessed using the TaqMan assay (ID C_8817791_10 for rs2011077, C_3166614_10 for rs351855, C_11270571_10 for rs7708357, and C_11317464_20 for rs1966265) with an ABI StepOne™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) Subsequent assessment was performed using SDS version 3.0.

    Techniques:

    FGFR4 mRNA levels increased in OSCC samples (A) Different cancer types of FGFR4 mRNA level from The Cancer Genome Atlas (TCGA) Data Portal from Broad GDAC Firehose data portal. (B) The expression of FGFR4 in normal and OSCC from TCGA Data Portal. (C) Relative expression of FGFR4 in 32 pairs of OSCC tumor tissues and their corresponding adjacent non-cancerous tissues. (D) Relative FGFR4 levels were compared according to clinical stage. (E) Relative FGFR4 levels were compared according to tumor T status.

    Journal: Oncotarget

    Article Title: Functional FGFR4 Gly388Arg polymorphism contributes to oral squamous cell carcinoma susceptibility

    doi: 10.18632/oncotarget.21958

    Figure Lengend Snippet: FGFR4 mRNA levels increased in OSCC samples (A) Different cancer types of FGFR4 mRNA level from The Cancer Genome Atlas (TCGA) Data Portal from Broad GDAC Firehose data portal. (B) The expression of FGFR4 in normal and OSCC from TCGA Data Portal. (C) Relative expression of FGFR4 in 32 pairs of OSCC tumor tissues and their corresponding adjacent non-cancerous tissues. (D) Relative FGFR4 levels were compared according to clinical stage. (E) Relative FGFR4 levels were compared according to tumor T status.

    Article Snippet: Allelic discrimination for the FGFR4 SNPs was assessed using the TaqMan assay (ID C_8817791_10 for rs2011077, C_3166614_10 for rs351855, C_11270571_10 for rs7708357, and C_11317464_20 for rs1966265) with an ABI StepOne™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) Subsequent assessment was performed using SDS version 3.0.

    Techniques: Expressing

    FGFR4-dependent apoptotic cell death increases with increasing KLB expression and is stimulated by either FGF19 or FGF1. A , transient expression of KLB in FGFR4-expressing cells. 293 cells harboring inducible FGFR4 cDNA were transiently transfected (

    Journal: The Journal of Biological Chemistry

    Article Title: Metabolic Regulator ?Klotho Interacts with Fibroblast Growth Factor Receptor 4 (FGFR4) to Induce Apoptosis and Inhibit Tumor Cell Proliferation *

    doi: 10.1074/jbc.M110.148288

    Figure Lengend Snippet: FGFR4-dependent apoptotic cell death increases with increasing KLB expression and is stimulated by either FGF19 or FGF1. A , transient expression of KLB in FGFR4-expressing cells. 293 cells harboring inducible FGFR4 cDNA were transiently transfected (

    Article Snippet: KLB-expressing AT3 cells ( ) bearing inducible FGFR4 cDNA were established with reagents and protocols from Invitrogen.

    Techniques: Expressing, Transfection

    Co-expression of KLB and FGFR4 also restricts nonhepatic cell population growth. A , cell morphology. Untransfected T-Rex-293 cells ( 293 ), cells stably transfected with KLB ( cKLB ), cells transfected with inducible FGFR4 cDNA ( iFGFR4 ), and cKLB cells bearing

    Journal: The Journal of Biological Chemistry

    Article Title: Metabolic Regulator ?Klotho Interacts with Fibroblast Growth Factor Receptor 4 (FGFR4) to Induce Apoptosis and Inhibit Tumor Cell Proliferation *

    doi: 10.1074/jbc.M110.148288

    Figure Lengend Snippet: Co-expression of KLB and FGFR4 also restricts nonhepatic cell population growth. A , cell morphology. Untransfected T-Rex-293 cells ( 293 ), cells stably transfected with KLB ( cKLB ), cells transfected with inducible FGFR4 cDNA ( iFGFR4 ), and cKLB cells bearing

    Article Snippet: KLB-expressing AT3 cells ( ) bearing inducible FGFR4 cDNA were established with reagents and protocols from Invitrogen.

    Techniques: Expressing, Stable Transfection, Transfection

    Mutations promote FGFR4 autophosphorylation, Stat3 phosphorylation, and activation of cell cycle and DNA replication pathways.

    Journal: The Journal of Clinical Investigation

    Article Title: Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models

    doi: 10.1172/JCI39703

    Figure Lengend Snippet: Mutations promote FGFR4 autophosphorylation, Stat3 phosphorylation, and activation of cell cycle and DNA replication pathways.

    Article Snippet: Full-length human FGFR4 (clone ID 4121396 in pOTB7; Invitrogen) was subcloned into the XhoI site of the pMSCVpuro vector (Clontech Laboratories).

    Techniques: Activation Assay

    FGFR4 suppression leads to inhibition of in vivo growth and lung metastasis.

    Journal: The Journal of Clinical Investigation

    Article Title: Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models

    doi: 10.1172/JCI39703

    Figure Lengend Snippet: FGFR4 suppression leads to inhibition of in vivo growth and lung metastasis.

    Article Snippet: Full-length human FGFR4 (clone ID 4121396 in pOTB7; Invitrogen) was subcloned into the XhoI site of the pMSCVpuro vector (Clontech Laboratories).

    Techniques: Inhibition, In Vivo

    FGFR4 mutations transform 3T3 cells.

    Journal: The Journal of Clinical Investigation

    Article Title: Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models

    doi: 10.1172/JCI39703

    Figure Lengend Snippet: FGFR4 mutations transform 3T3 cells.

    Article Snippet: Full-length human FGFR4 (clone ID 4121396 in pOTB7; Invitrogen) was subcloned into the XhoI site of the pMSCVpuro vector (Clontech Laboratories).

    Techniques:

    FGFR4 mutations accelerate growth and promote a metastasis phenotype.

    Journal: The Journal of Clinical Investigation

    Article Title: Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models

    doi: 10.1172/JCI39703

    Figure Lengend Snippet: FGFR4 mutations accelerate growth and promote a metastasis phenotype.

    Article Snippet: Full-length human FGFR4 (clone ID 4121396 in pOTB7; Invitrogen) was subcloned into the XhoI site of the pMSCVpuro vector (Clontech Laboratories).

    Techniques:

    FGFR4 expression in RMS shows correlation with FGFR4 protein, advanced stage, ARMS histology, and poor survival.

    Journal: The Journal of Clinical Investigation

    Article Title: Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models

    doi: 10.1172/JCI39703

    Figure Lengend Snippet: FGFR4 expression in RMS shows correlation with FGFR4 protein, advanced stage, ARMS histology, and poor survival.

    Article Snippet: Full-length human FGFR4 (clone ID 4121396 in pOTB7; Invitrogen) was subcloned into the XhoI site of the pMSCVpuro vector (Clontech Laboratories).

    Techniques: Expressing

    Oncogene dependence and inhibition of FGFR4 .

    Journal: The Journal of Clinical Investigation

    Article Title: Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models

    doi: 10.1172/JCI39703

    Figure Lengend Snippet: Oncogene dependence and inhibition of FGFR4 .

    Article Snippet: Full-length human FGFR4 (clone ID 4121396 in pOTB7; Invitrogen) was subcloned into the XhoI site of the pMSCVpuro vector (Clontech Laboratories).

    Techniques: Inhibition

    FGFR4 knockdown with an inducible shRNA leads to reduced in vitro growth.

    Journal: The Journal of Clinical Investigation

    Article Title: Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models

    doi: 10.1172/JCI39703

    Figure Lengend Snippet: FGFR4 knockdown with an inducible shRNA leads to reduced in vitro growth.

    Article Snippet: Full-length human FGFR4 (clone ID 4121396 in pOTB7; Invitrogen) was subcloned into the XhoI site of the pMSCVpuro vector (Clontech Laboratories).

    Techniques: shRNA, In Vitro

    Identification of FGFR4 TK domain mutations in human RMS tumors.

    Journal: The Journal of Clinical Investigation

    Article Title: Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models

    doi: 10.1172/JCI39703

    Figure Lengend Snippet: Identification of FGFR4 TK domain mutations in human RMS tumors.

    Article Snippet: Full-length human FGFR4 (clone ID 4121396 in pOTB7; Invitrogen) was subcloned into the XhoI site of the pMSCVpuro vector (Clontech Laboratories).

    Techniques:

    Structural modeling of the FGFR4 codon 535 and 550 mutations.

    Journal: The Journal of Clinical Investigation

    Article Title: Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models

    doi: 10.1172/JCI39703

    Figure Lengend Snippet: Structural modeling of the FGFR4 codon 535 and 550 mutations.

    Article Snippet: Full-length human FGFR4 (clone ID 4121396 in pOTB7; Invitrogen) was subcloned into the XhoI site of the pMSCVpuro vector (Clontech Laboratories).

    Techniques:

    FGFR4 TK domain mutations in RMS.

    Journal: The Journal of Clinical Investigation

    Article Title: Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models

    doi: 10.1172/JCI39703

    Figure Lengend Snippet: FGFR4 TK domain mutations in RMS.

    Article Snippet: Full-length human FGFR4 (clone ID 4121396 in pOTB7; Invitrogen) was subcloned into the XhoI site of the pMSCVpuro vector (Clontech Laboratories).

    Techniques:

    FGFR4 mutations promote FGFR4 autophosphorylation, STAT3 phosphorylation, and activation of cell cycle and DNA replication pathways.

    Journal: The Journal of Clinical Investigation

    Article Title: Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models

    doi: 10.1172/JCI39703

    Figure Lengend Snippet: FGFR4 mutations promote FGFR4 autophosphorylation, STAT3 phosphorylation, and activation of cell cycle and DNA replication pathways.

    Article Snippet: Full-length human FGFR4 (clone ID 4121396 in pOTB7; Invitrogen) was subcloned into the XhoI site of the pMSCVpuro vector (Clontech Laboratories).

    Techniques: Activation Assay

    High FGFR4 expression in RMS is associated with advanced stage, ARMS histology, and poor survival.

    Journal: The Journal of Clinical Investigation

    Article Title: Identification of FGFR4-activating mutations in human rhabdomyosarcomas that promote metastasis in xenotransplanted models

    doi: 10.1172/JCI39703

    Figure Lengend Snippet: High FGFR4 expression in RMS is associated with advanced stage, ARMS histology, and poor survival.

    Article Snippet: Full-length human FGFR4 (clone ID 4121396 in pOTB7; Invitrogen) was subcloned into the XhoI site of the pMSCVpuro vector (Clontech Laboratories).

    Techniques: Expressing