fam-labeled probes Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore fam labeled probes
    FISH detection of H. pylori 26695 strain (ATCC 700392) using <t>FAM-</t> <t>HP_LNA/2OMe_PO</t> and HP_LNA/2OMe_PS probes. FISH analysis was performed by epifluorescent microscopy in smears, using either 50% (vol/vol) formamide and 4 M urea as denaturing agents in the hybridization buffer. Smears without probe were used as negative control (Control) (a). (2B) Average fluorescence intensity from each probe in 4 M urea and 50% formamide (v/v) buffers; fluorescent signal intensity is expressed in arbitrary fluorescent units (AFU) and was quantified using the by ImageJ software. All images were acquired at equal exposure conditions. Original magnification: 1000x.
    Fam Labeled Probes, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled probes/product/Millipore
    Average 99 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    fam labeled probes - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher fam labeled mgb probe
    FISH detection of H. pylori 26695 strain (ATCC 700392) using <t>FAM-</t> <t>HP_LNA/2OMe_PO</t> and HP_LNA/2OMe_PS probes. FISH analysis was performed by epifluorescent microscopy in smears, using either 50% (vol/vol) formamide and 4 M urea as denaturing agents in the hybridization buffer. Smears without probe were used as negative control (Control) (a). (2B) Average fluorescence intensity from each probe in 4 M urea and 50% formamide (v/v) buffers; fluorescent signal intensity is expressed in arbitrary fluorescent units (AFU) and was quantified using the by ImageJ software. All images were acquired at equal exposure conditions. Original magnification: 1000x.
    Fam Labeled Mgb Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 69 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled mgb probe/product/Thermo Fisher
    Average 90 stars, based on 69 article reviews
    Price from $9.99 to $1999.99
    fam labeled mgb probe - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    95
    Thermo Fisher fam labeled probes
    FISH detection of H. pylori 26695 strain (ATCC 700392) using <t>FAM-</t> <t>HP_LNA/2OMe_PO</t> and HP_LNA/2OMe_PS probes. FISH analysis was performed by epifluorescent microscopy in smears, using either 50% (vol/vol) formamide and 4 M urea as denaturing agents in the hybridization buffer. Smears without probe were used as negative control (Control) (a). (2B) Average fluorescence intensity from each probe in 4 M urea and 50% formamide (v/v) buffers; fluorescent signal intensity is expressed in arbitrary fluorescent units (AFU) and was quantified using the by ImageJ software. All images were acquired at equal exposure conditions. Original magnification: 1000x.
    Fam Labeled Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 608 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled probes/product/Thermo Fisher
    Average 95 stars, based on 608 article reviews
    Price from $9.99 to $1999.99
    fam labeled probes - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    85
    Kaneka Corp fam labeled probes
    FISH detection of H. pylori 26695 strain (ATCC 700392) using <t>FAM-</t> <t>HP_LNA/2OMe_PO</t> and HP_LNA/2OMe_PS probes. FISH analysis was performed by epifluorescent microscopy in smears, using either 50% (vol/vol) formamide and 4 M urea as denaturing agents in the hybridization buffer. Smears without probe were used as negative control (Control) (a). (2B) Average fluorescence intensity from each probe in 4 M urea and 50% formamide (v/v) buffers; fluorescent signal intensity is expressed in arbitrary fluorescent units (AFU) and was quantified using the by ImageJ software. All images were acquired at equal exposure conditions. Original magnification: 1000x.
    Fam Labeled Probes, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled probes/product/Kaneka Corp
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    fam labeled probes - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    92
    Thermo Fisher fam labelled probes
    FISH detection of H. pylori 26695 strain (ATCC 700392) using <t>FAM-</t> <t>HP_LNA/2OMe_PO</t> and HP_LNA/2OMe_PS probes. FISH analysis was performed by epifluorescent microscopy in smears, using either 50% (vol/vol) formamide and 4 M urea as denaturing agents in the hybridization buffer. Smears without probe were used as negative control (Control) (a). (2B) Average fluorescence intensity from each probe in 4 M urea and 50% formamide (v/v) buffers; fluorescent signal intensity is expressed in arbitrary fluorescent units (AFU) and was quantified using the by ImageJ software. All images were acquired at equal exposure conditions. Original magnification: 1000x.
    Fam Labelled Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 144 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labelled probes/product/Thermo Fisher
    Average 92 stars, based on 144 article reviews
    Price from $9.99 to $1999.99
    fam labelled probes - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    94
    Thermo Fisher fam labeled taqman probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labeled Taqman Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 264 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled taqman probes/product/Thermo Fisher
    Average 94 stars, based on 264 article reviews
    Price from $9.99 to $1999.99
    fam labeled taqman probes - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    95
    Thermo Fisher fam labeled fluorogenic probe
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labeled Fluorogenic Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled fluorogenic probe/product/Thermo Fisher
    Average 95 stars, based on 44 article reviews
    Price from $9.99 to $1999.99
    fam labeled fluorogenic probe - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    86
    Roche fam tamra labeled probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Tamra Labeled Probes, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam tamra labeled probes/product/Roche
    Average 86 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    fam tamra labeled probes - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    85
    Kaneka Corp fam tamra labeled probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Tamra Labeled Probes, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 85/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam tamra labeled probes/product/Kaneka Corp
    Average 85 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    fam tamra labeled probes - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    85
    BioTeZ fam tamra labeled probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Tamra Labeled Probes, supplied by BioTeZ, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam tamra labeled probes/product/BioTeZ
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    fam tamra labeled probes - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    88
    Kaneka Corp fam labeled telg probe
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labeled Telg Probe, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 88/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled telg probe/product/Kaneka Corp
    Average 88 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    fam labeled telg probe - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    86
    Roche fam labeled universal probe
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labeled Universal Probe, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled universal probe/product/Roche
    Average 86 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    fam labeled universal probe - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher fam dye labeled probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Dye Labeled Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam dye labeled probes/product/Thermo Fisher
    Average 86 stars, based on 49 article reviews
    Price from $9.99 to $1999.99
    fam dye labeled probes - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    90
    Roche fam labeled hydrolysis probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labeled Hydrolysis Probes, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled hydrolysis probes/product/Roche
    Average 90 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    fam labeled hydrolysis probes - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    87
    Thermo Fisher fam tamra labeled probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Tamra Labeled Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam tamra labeled probes/product/Thermo Fisher
    Average 87 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    fam tamra labeled probes - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    91
    Eurofins fam labeled primer probe
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labeled Primer Probe, supplied by Eurofins, used in various techniques. Bioz Stars score: 91/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled primer probe/product/Eurofins
    Average 91 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    fam labeled primer probe - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    93
    Thermo Fisher fam labeled primer probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labeled Primer Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled primer probes/product/Thermo Fisher
    Average 93 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    fam labeled primer probes - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    87
    TaKaRa fam tamra labeled probe
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Tamra Labeled Probe, supplied by TaKaRa, used in various techniques. Bioz Stars score: 87/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam tamra labeled probe/product/TaKaRa
    Average 87 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    fam tamra labeled probe - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    86
    Millipore fam labelled po2 probe
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labelled Po2 Probe, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labelled po2 probe/product/Millipore
    Average 86 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    fam labelled po2 probe - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    93
    Thermo Fisher fam labelled taqman probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labelled Taqman Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labelled taqman probes/product/Thermo Fisher
    Average 93 stars, based on 44 article reviews
    Price from $9.99 to $1999.99
    fam labelled taqman probes - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    95
    Thermo Fisher fam labelled bgb probe
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labelled Bgb Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labelled bgb probe/product/Thermo Fisher
    Average 95 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    fam labelled bgb probe - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    90
    Roche fam labelled hydrolysis probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labelled Hydrolysis Probes, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labelled hydrolysis probes/product/Roche
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    fam labelled hydrolysis probes - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    94
    Thermo Fisher fam dye labeled taqman probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Dye Labeled Taqman Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 41 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam dye labeled taqman probes/product/Thermo Fisher
    Average 94 stars, based on 41 article reviews
    Price from $9.99 to $1999.99
    fam dye labeled taqman probes - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    94
    Thermo Fisher carboxyfluorescein fam labeled probe
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Carboxyfluorescein Fam Labeled Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/carboxyfluorescein fam labeled probe/product/Thermo Fisher
    Average 94 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    carboxyfluorescein fam labeled probe - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    89
    Thermo Fisher fam labeled mgb probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labeled Mgb Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled mgb probes/product/Thermo Fisher
    Average 89 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    fam labeled mgb probes - by Bioz Stars, 2020-04
    89/100 stars
      Buy from Supplier

    86
    Thermo Fisher fam labeled taqman tamra probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labeled Taqman Tamra Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled taqman tamra probes/product/Thermo Fisher
    Average 86 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    fam labeled taqman tamra probes - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    93
    Thermo Fisher taqman fam labeled primer probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Taqman Fam Labeled Primer Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman fam labeled primer probes/product/Thermo Fisher
    Average 93 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    taqman fam labeled primer probes - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    89
    Thermo Fisher fam labeled taqman hydrolysis probes
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labeled Taqman Hydrolysis Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled taqman hydrolysis probes/product/Thermo Fisher
    Average 89 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    fam labeled taqman hydrolysis probes - by Bioz Stars, 2020-04
    89/100 stars
      Buy from Supplier

    85
    PrimerDesign Inc fam labeled fluorogenic probe cgcgatctcggctcactgcaacctccatcg
    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a <t>FAM-labeled</t> human CXCR4 <t>Taqman</t> expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P
    Fam Labeled Fluorogenic Probe Cgcgatctcggctcactgcaacctccatcg, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled fluorogenic probe cgcgatctcggctcactgcaacctccatcg/product/PrimerDesign Inc
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    fam labeled fluorogenic probe cgcgatctcggctcactgcaacctccatcg - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    91
    Thermo Fisher taqman fam labeled specific probes
    Beneficial effects of 8 weeks of exercise training in SAMP8 senescent mice . ( A ) Mean wheel revolutions/week register in exercised SAMR1 and SAMP8 mice; (B) Body weight (g) mean during exercise intervention in sedentary and exercised groups from both SAMR1 and SAMP8 strains. (C) Triglyceride plasma levels (mg/dL). (D) Cholesterol plasma levels (mg/dL). (E) IGF1 plasma levels (ng/mL). (F–H) Gene expression of Bdnf (F) , Trkb (G) , and Neuritin (H) . Gene expression was measured by real-time PCR analysis from hippocampal mRNA using <t>TaqMan</t> <t>FAM-labeled</t> specific probes and expressed relative to TBP ( n = 3–4/group for IGF1 and n = 5–8/group for all other measures). Mean ± standard error are represented; Two-Way ANOVA results are indicated as ** p
    Taqman Fam Labeled Specific Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman fam labeled specific probes/product/Thermo Fisher
    Average 91 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    taqman fam labeled specific probes - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    92
    GenePharma Company fam labeled mir 451 probe
    Beneficial effects of 8 weeks of exercise training in SAMP8 senescent mice . ( A ) Mean wheel revolutions/week register in exercised SAMR1 and SAMP8 mice; (B) Body weight (g) mean during exercise intervention in sedentary and exercised groups from both SAMR1 and SAMP8 strains. (C) Triglyceride plasma levels (mg/dL). (D) Cholesterol plasma levels (mg/dL). (E) IGF1 plasma levels (ng/mL). (F–H) Gene expression of Bdnf (F) , Trkb (G) , and Neuritin (H) . Gene expression was measured by real-time PCR analysis from hippocampal mRNA using <t>TaqMan</t> <t>FAM-labeled</t> specific probes and expressed relative to TBP ( n = 3–4/group for IGF1 and n = 5–8/group for all other measures). Mean ± standard error are represented; Two-Way ANOVA results are indicated as ** p
    Fam Labeled Mir 451 Probe, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 92/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fam labeled mir 451 probe/product/GenePharma Company
    Average 92 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    fam labeled mir 451 probe - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Image Search Results


    FISH detection of H. pylori 26695 strain (ATCC 700392) using FAM- HP_LNA/2OMe_PO and HP_LNA/2OMe_PS probes. FISH analysis was performed by epifluorescent microscopy in smears, using either 50% (vol/vol) formamide and 4 M urea as denaturing agents in the hybridization buffer. Smears without probe were used as negative control (Control) (a). (2B) Average fluorescence intensity from each probe in 4 M urea and 50% formamide (v/v) buffers; fluorescent signal intensity is expressed in arbitrary fluorescent units (AFU) and was quantified using the by ImageJ software. All images were acquired at equal exposure conditions. Original magnification: 1000x.

    Journal: PLoS ONE

    Article Title: Hybridization-Based Detection of Helicobacter pylori at Human Body Temperature Using Advanced Locked Nucleic Acid (LNA) Probes

    doi: 10.1371/journal.pone.0081230

    Figure Lengend Snippet: FISH detection of H. pylori 26695 strain (ATCC 700392) using FAM- HP_LNA/2OMe_PO and HP_LNA/2OMe_PS probes. FISH analysis was performed by epifluorescent microscopy in smears, using either 50% (vol/vol) formamide and 4 M urea as denaturing agents in the hybridization buffer. Smears without probe were used as negative control (Control) (a). (2B) Average fluorescence intensity from each probe in 4 M urea and 50% formamide (v/v) buffers; fluorescent signal intensity is expressed in arbitrary fluorescent units (AFU) and was quantified using the by ImageJ software. All images were acquired at equal exposure conditions. Original magnification: 1000x.

    Article Snippet: Imaging flow cytometry and data analysis H. pylori bacterial cell suspensions stained with FAM-labeled LNA probes, and the respective unstained negative controls, were analysed in an ImageStreamX® (Amnis Corporation, Seattle WA, USA) imaging flow cytometer equipped with two lasers (488 nm and 785 nm), a 40x magnification objective of 0.75 N.A, and one CDD camera.

    Techniques: Fluorescence In Situ Hybridization, Microscopy, Hybridization, Negative Control, Fluorescence, Software

    FISH detection of H.pylori by imaging flow cytometry. FAM labeled 2OMe/LNA probes were analysed in 50% (v/v) formamide buffer and in 4M buffer. A) Representative histograms of the green fluorescence intensity of FAM-labeled HP_LNA/2OMe_PO, HP_LNA/2OMe_PS probes and controls. B) Quantification of the mean fluorescence intensity of each probe in two independent experiments obtained by flow cytometry. C) Representative images of individual H. pylori with different morphologies. The population identified as individual H. pylori bacterium by FISH analysis was manually examined and individual cell events were identified. Individual bacterial cells, shown by Brightfield images (BF, left column) and green fluorescence images (SG, right column).

    Journal: PLoS ONE

    Article Title: Hybridization-Based Detection of Helicobacter pylori at Human Body Temperature Using Advanced Locked Nucleic Acid (LNA) Probes

    doi: 10.1371/journal.pone.0081230

    Figure Lengend Snippet: FISH detection of H.pylori by imaging flow cytometry. FAM labeled 2OMe/LNA probes were analysed in 50% (v/v) formamide buffer and in 4M buffer. A) Representative histograms of the green fluorescence intensity of FAM-labeled HP_LNA/2OMe_PO, HP_LNA/2OMe_PS probes and controls. B) Quantification of the mean fluorescence intensity of each probe in two independent experiments obtained by flow cytometry. C) Representative images of individual H. pylori with different morphologies. The population identified as individual H. pylori bacterium by FISH analysis was manually examined and individual cell events were identified. Individual bacterial cells, shown by Brightfield images (BF, left column) and green fluorescence images (SG, right column).

    Article Snippet: Imaging flow cytometry and data analysis H. pylori bacterial cell suspensions stained with FAM-labeled LNA probes, and the respective unstained negative controls, were analysed in an ImageStreamX® (Amnis Corporation, Seattle WA, USA) imaging flow cytometer equipped with two lasers (488 nm and 785 nm), a 40x magnification objective of 0.75 N.A, and one CDD camera.

    Techniques: Fluorescence In Situ Hybridization, Imaging, Flow Cytometry, Cytometry, Labeling, Fluorescence

    TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a FAM-labeled human CXCR4 Taqman expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P

    Journal: Carcinogenesis

    Article Title: Posttranscriptional control of the chemokine receptor CXCR4 expression in cancer cells

    doi: 10.1093/carcin/bgu080

    Figure Lengend Snippet: TTP regulation of CXCR4 mRNA and protein. ( A ) Quantitative PCR (qPCR) quantification of CXCR4 mRNA associated with TTP protein. MDA-MB-231 cells were transfected with TTP or C124R expression plasmids for 24h. Cells were lysed, and TTP and C124R proteins were immunoprecipitated using anti-TTP or normal IgG control antibody. Quantification of associated CXCR4 mRNA was performed by qPCR using a FAM-labeled human CXCR4 Taqman expression probe and normalized to a VIC-labeled GAPDH probe. Data are from one experiment representative of two independent experiments * P

    Article Snippet: Quantitative PCR was performed as multiplex reactions in a C1000 Touch thermal cycler (Bio-Rad, Hercules, CA) using FAM-labeled TaqMan probes (Applied Biosystems, Foster City, CA) for uPA (PLAU), HuR (ELAV1), enhanced green fluorescent protein (EGFP) or human and mouse CXCR4.

    Techniques: Real-time Polymerase Chain Reaction, Multiple Displacement Amplification, Transfection, Expressing, Immunoprecipitation, Labeling

    Egfl7 is repressed in endothelial cells under inflammatory conditions in vivo . A , left panel , in situ hybridization detection of Egfl7 transcripts in endothelial cell nuclei of adult mouse lungs ( blue staining , arrows ). Right panel and inset , CD31 immunostaining ( brown , arrows ) and hematoxylin counterstaining of a parallel section of the same area. Bar , 25 μm. B , expression levels of CD31 and Egfl7 transcripts in CD31 − cells ( white bars ) and CD31 + cells ( black bars ) isolated from mouse lungs using immunoaffinity and measured by duplex RT-qPCR using a mouse CD31-FAM or a mouse Egfl7-FAM TaqMan probe mixed with a mouse β-actin-VIC probe (see “Experimental Procedures”). The results are plotted as quantities relative to CD31 − controls values set to 1. RQ , relative quantities. C , LPS (5 mg/kg, +) or LPS-free PBS (−) was instilled in mice nostrils, and animals were sacrificed at the onset of treatment (0 h) or after 10 or 24 h; the lungs were dissected and processed for total RNA isolation. Expression levels of ICAM-1, VCAM-1, E-selectin, and Egfl7 were measured by duplex RT-qPCR using the indicated FAM-labeled TaqMan probe for the mouse transcript of interest and a mouse β-actin-VIC-labeled TaqMan probe and expressed as 2 −ΔΔ C T quantities relative to t = 0 h values set to 1. *, p

    Journal: The Journal of Biological Chemistry

    Article Title: Endothelial Cell Activation Is Regulated by Epidermal Growth Factor-like Domain 7 (Egfl7) during Inflammation *

    doi: 10.1074/jbc.M116.731331

    Figure Lengend Snippet: Egfl7 is repressed in endothelial cells under inflammatory conditions in vivo . A , left panel , in situ hybridization detection of Egfl7 transcripts in endothelial cell nuclei of adult mouse lungs ( blue staining , arrows ). Right panel and inset , CD31 immunostaining ( brown , arrows ) and hematoxylin counterstaining of a parallel section of the same area. Bar , 25 μm. B , expression levels of CD31 and Egfl7 transcripts in CD31 − cells ( white bars ) and CD31 + cells ( black bars ) isolated from mouse lungs using immunoaffinity and measured by duplex RT-qPCR using a mouse CD31-FAM or a mouse Egfl7-FAM TaqMan probe mixed with a mouse β-actin-VIC probe (see “Experimental Procedures”). The results are plotted as quantities relative to CD31 − controls values set to 1. RQ , relative quantities. C , LPS (5 mg/kg, +) or LPS-free PBS (−) was instilled in mice nostrils, and animals were sacrificed at the onset of treatment (0 h) or after 10 or 24 h; the lungs were dissected and processed for total RNA isolation. Expression levels of ICAM-1, VCAM-1, E-selectin, and Egfl7 were measured by duplex RT-qPCR using the indicated FAM-labeled TaqMan probe for the mouse transcript of interest and a mouse β-actin-VIC-labeled TaqMan probe and expressed as 2 −ΔΔ C T quantities relative to t = 0 h values set to 1. *, p

    Article Snippet: All qPCR were performed in duplex PCR mixing cDNA with both the TaqMan FAM-labeled probe of the tested gene (Life Technologies) and a β-actin- or a β2-microglobulin-VIC-labeled probe and processed for qPCR in a StepOne machine.

    Techniques: In Vivo, In Situ Hybridization, Staining, Immunostaining, Expressing, Isolation, Quantitative RT-PCR, Mouse Assay, Labeling

    Beneficial effects of 8 weeks of exercise training in SAMP8 senescent mice . ( A ) Mean wheel revolutions/week register in exercised SAMR1 and SAMP8 mice; (B) Body weight (g) mean during exercise intervention in sedentary and exercised groups from both SAMR1 and SAMP8 strains. (C) Triglyceride plasma levels (mg/dL). (D) Cholesterol plasma levels (mg/dL). (E) IGF1 plasma levels (ng/mL). (F–H) Gene expression of Bdnf (F) , Trkb (G) , and Neuritin (H) . Gene expression was measured by real-time PCR analysis from hippocampal mRNA using TaqMan FAM-labeled specific probes and expressed relative to TBP ( n = 3–4/group for IGF1 and n = 5–8/group for all other measures). Mean ± standard error are represented; Two-Way ANOVA results are indicated as ** p

    Journal: Frontiers in Aging Neuroscience

    Article Title: Epigenetic alterations in hippocampus of SAMP8 senescent mice and modulation by voluntary physical exercise

    doi: 10.3389/fnagi.2014.00051

    Figure Lengend Snippet: Beneficial effects of 8 weeks of exercise training in SAMP8 senescent mice . ( A ) Mean wheel revolutions/week register in exercised SAMR1 and SAMP8 mice; (B) Body weight (g) mean during exercise intervention in sedentary and exercised groups from both SAMR1 and SAMP8 strains. (C) Triglyceride plasma levels (mg/dL). (D) Cholesterol plasma levels (mg/dL). (E) IGF1 plasma levels (ng/mL). (F–H) Gene expression of Bdnf (F) , Trkb (G) , and Neuritin (H) . Gene expression was measured by real-time PCR analysis from hippocampal mRNA using TaqMan FAM-labeled specific probes and expressed relative to TBP ( n = 3–4/group for IGF1 and n = 5–8/group for all other measures). Mean ± standard error are represented; Two-Way ANOVA results are indicated as ** p

    Article Snippet: Gene expression was measured in an ABI Prism 7900HT Real Time PCR system using TaqMan FAM-labeled specific probes (Applied Biosystems).

    Techniques: Mouse Assay, Expressing, Real-time Polymerase Chain Reaction, Labeling

    Histone acetylation regulatory genes and global histone modifications in hippocampus of sedentary and exercised 8 months-old SAMR1 and SAMP8 mice . Gene expression was measured by real-time PCR analysis from hippocampal mRNA using TaqMan FAM-labeled specific probes and expressed relative to TBP ( n = 5–8/group). (A) Histone acetyltransferase P-300 . (B) Sirtuin1 . (C–G) Histone deacetylase 1–6, respectively . Means ± standard error are represented; Two-Way ANOVA results are indicated as * p

    Journal: Frontiers in Aging Neuroscience

    Article Title: Epigenetic alterations in hippocampus of SAMP8 senescent mice and modulation by voluntary physical exercise

    doi: 10.3389/fnagi.2014.00051

    Figure Lengend Snippet: Histone acetylation regulatory genes and global histone modifications in hippocampus of sedentary and exercised 8 months-old SAMR1 and SAMP8 mice . Gene expression was measured by real-time PCR analysis from hippocampal mRNA using TaqMan FAM-labeled specific probes and expressed relative to TBP ( n = 5–8/group). (A) Histone acetyltransferase P-300 . (B) Sirtuin1 . (C–G) Histone deacetylase 1–6, respectively . Means ± standard error are represented; Two-Way ANOVA results are indicated as * p

    Article Snippet: Gene expression was measured in an ABI Prism 7900HT Real Time PCR system using TaqMan FAM-labeled specific probes (Applied Biosystems).

    Techniques: Mouse Assay, Expressing, Real-time Polymerase Chain Reaction, Labeling, Histone Deacetylase Assay