ezh2 Search Results


90
Addgene inc pbabe ezh2
Pbabe Ezh2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pbabe ezh2/product/Addgene inc
Average 90 stars, based on 1 article reviews
pbabe ezh2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

96
Proteintech rabbit anti ezh2
Rabbit Anti Ezh2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti ezh2/product/Proteintech
Average 96 stars, based on 1 article reviews
rabbit anti ezh2 - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

90
OriGene ezh2 39utr luciferase plasmid
Figure 1. Loss of the let-7 family inversely correlated with increased expression of <t>EZH2</t> in PCa tissue specimens compared to adjacent normal prostate tissues. (A) Microarray profiling was done for assessing the expression of miRNA using total RNA extracted from three PCa tissue specimens and matched adjacent normal prostate tissues. The results showed that let-7a, let-7b, let-7c and let-7d was highly expressed in prostate tissues and their expression was lost in human PCa tissue specimens (* p,0.05, ** p,0.01). (B) The results from real time-RT-PCR confirmed that the levels of let-7b, let-7c and let-7d were significantly down-regulated in tumors with higher Gleason grade. (7a: let-7a; N: normal; TG6: tumor tissues from patients with Gleason grade 6. n = 39 for normal, n = 44 for TG6, n = 52 for TG7, n = 33 for TG8, 9). (C) A significant up-regulation of the expression of EZH2 was observed in PCa tissue specimens with Gleason grade 7 (n = 46) and higher (n = 33), but not in PCa specimens with Gleason grade 6 (n = 39). (D) EZH2 levels were inversely correlated with let-7b and let-7c expressions in tumor specimens with Gleason grade 7. doi:10.1371/journal.pone.0033729.g001
Ezh2 39utr Luciferase Plasmid, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ezh2 39utr luciferase plasmid/product/OriGene
Average 90 stars, based on 1 article reviews
ezh2 39utr luciferase plasmid - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

91
OriGene myc ddk
Figure 1. Loss of the let-7 family inversely correlated with increased expression of <t>EZH2</t> in PCa tissue specimens compared to adjacent normal prostate tissues. (A) Microarray profiling was done for assessing the expression of miRNA using total RNA extracted from three PCa tissue specimens and matched adjacent normal prostate tissues. The results showed that let-7a, let-7b, let-7c and let-7d was highly expressed in prostate tissues and their expression was lost in human PCa tissue specimens (* p,0.05, ** p,0.01). (B) The results from real time-RT-PCR confirmed that the levels of let-7b, let-7c and let-7d were significantly down-regulated in tumors with higher Gleason grade. (7a: let-7a; N: normal; TG6: tumor tissues from patients with Gleason grade 6. n = 39 for normal, n = 44 for TG6, n = 52 for TG7, n = 33 for TG8, 9). (C) A significant up-regulation of the expression of EZH2 was observed in PCa tissue specimens with Gleason grade 7 (n = 46) and higher (n = 33), but not in PCa specimens with Gleason grade 6 (n = 39). (D) EZH2 levels were inversely correlated with let-7b and let-7c expressions in tumor specimens with Gleason grade 7. doi:10.1371/journal.pone.0033729.g001
Myc Ddk, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/myc ddk/product/OriGene
Average 91 stars, based on 1 article reviews
myc ddk - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

90
OriGene human dnmt1and ezh2
Fig. 4 UA suppressed the expression of SP1. Overexpression of SP1 reversed the effect of UA on DNMT1 and <t>EZH2</t> protein expression. a, H1299 and A549 cells were exposed to increased concentration of UA for 24 h, followed by measuring the protein expression of SP1 by Western blot. The bar graphs represent the mean ± SD of SP1/GAPDH of three independent experiments. b, H1299 and A549 cells were treated with SP600125 (20 μM) for 2 h before exposure of the cells to UA (30 μM) for an additional 24 h. Afterwards, the expression of phosphorylation of SAPK/JNK and SP1 protein were detected by Western blot. c-e, H1299 and A549 cells were transfected with control (pcDNA3.1) and SP1 overexpression vector (pcDNA3.1SP1/flu) for 24 h before exposing the cells to UA for an additional 24 h. Afterwards, SP1, EZH2 (c) and DNMT1 protein expression (d), and phosphorylation of JNK (e) were determined using Western blot. Values in bar graphs were given as the mean ± SD from three independent experiments performed in triplicate. *Indicates significant difference as compared to the untreated control group (P < 0.05). **Indicates significant difference from UA treated alone (P < 0.01)
Human Dnmt1and Ezh2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human dnmt1and ezh2/product/OriGene
Average 90 stars, based on 1 article reviews
human dnmt1and ezh2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
OriGene mouse monoclonal anti ezh2 antibody
Fig. 4 UA suppressed the expression of SP1. Overexpression of SP1 reversed the effect of UA on DNMT1 and <t>EZH2</t> protein expression. a, H1299 and A549 cells were exposed to increased concentration of UA for 24 h, followed by measuring the protein expression of SP1 by Western blot. The bar graphs represent the mean ± SD of SP1/GAPDH of three independent experiments. b, H1299 and A549 cells were treated with SP600125 (20 μM) for 2 h before exposure of the cells to UA (30 μM) for an additional 24 h. Afterwards, the expression of phosphorylation of SAPK/JNK and SP1 protein were detected by Western blot. c-e, H1299 and A549 cells were transfected with control (pcDNA3.1) and SP1 overexpression vector (pcDNA3.1SP1/flu) for 24 h before exposing the cells to UA for an additional 24 h. Afterwards, SP1, EZH2 (c) and DNMT1 protein expression (d), and phosphorylation of JNK (e) were determined using Western blot. Values in bar graphs were given as the mean ± SD from three independent experiments performed in triplicate. *Indicates significant difference as compared to the untreated control group (P < 0.05). **Indicates significant difference from UA treated alone (P < 0.01)
Mouse Monoclonal Anti Ezh2 Antibody, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse monoclonal anti ezh2 antibody/product/OriGene
Average 93 stars, based on 1 article reviews
mouse monoclonal anti ezh2 antibody - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Cyagen Biosciences mouse ezh2 locus
Figure 3. SETD2 Loss Aggravates PCa Progression through <t>EZH2</t> Upregulation (A) Volcano plots showing the differentially expressed genes between the indicated organoids generated from 3-month-old mice. The represented genes are listed. (B) Heatmap summarizing the qRT-PCR results in organoids generated from 3-month-old mice. The expression was normalized to the mean level of each gene in Pten+/ cells. (C) IHC for the indicated proteins in 6-month-old mice prostates. Scale bar, 50 mm. (D) IB analysis of C4-2 cells in control and SETD2 KD cells with CHX treatment as indicated, and the graph represents the quantification of EZH2 protein levels relative to b-actin level from three independent experiments. Gray dot line indicates the half-life of EZH2 levels in control cells. Data are presented as mean ± SEM and analyzed by two-way ANOVA followed by multiple comparison. **p < 0.01. (E) Heatmap of H3K27me3 signal from 2 kb of transcription start site (TSS) to +2 kb of the transcription end site (TES) of 13,412 genes harboring H3K27me3 peaks in the indicated organoids generated from 3-month-old mice. (F) RNA sequencing and ChIP-seq tracks for H3K27me3 at Cdkn2a and Sox7 gene locus. (G) Heatmap of IHC score (by Pearson’s) between SETD2 and EZH2 in PCa specimens.
Mouse Ezh2 Locus, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse ezh2 locus/product/Cyagen Biosciences
Average 93 stars, based on 1 article reviews
mouse ezh2 locus - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

91
OriGene ezh2
Inhibitors of histone PTMs
Ezh2, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ezh2/product/OriGene
Average 91 stars, based on 1 article reviews
ezh2 - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

92
Taconic Biosciences ezh2
FIGURE 1 Combined FGFR and <t>EZH2</t> inhibition reveals strong synergy in BAP1-deficient mesothelioma. A, 3D synergy plots visualizing the synergy
Ezh2, supplied by Taconic Biosciences, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ezh2/product/Taconic Biosciences
Average 92 stars, based on 1 article reviews
ezh2 - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

93
Addgene inc pcdna3 3myc
FIGURE 1 Combined FGFR and <t>EZH2</t> inhibition reveals strong synergy in BAP1-deficient mesothelioma. A, 3D synergy plots visualizing the synergy
Pcdna3 3myc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcdna3 3myc/product/Addgene inc
Average 93 stars, based on 1 article reviews
pcdna3 3myc - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
OriGene human recombinant ezh2 protein
FIGURE 1 Combined FGFR and <t>EZH2</t> inhibition reveals strong synergy in BAP1-deficient mesothelioma. A, 3D synergy plots visualizing the synergy
Human Recombinant Ezh2 Protein, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human recombinant ezh2 protein/product/OriGene
Average 93 stars, based on 1 article reviews
human recombinant ezh2 protein - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Addgene inc mscv ires ezh2 gfp
FIGURE 1 Combined FGFR and <t>EZH2</t> inhibition reveals strong synergy in BAP1-deficient mesothelioma. A, 3D synergy plots visualizing the synergy
Mscv Ires Ezh2 Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mscv ires ezh2 gfp/product/Addgene inc
Average 93 stars, based on 1 article reviews
mscv ires ezh2 gfp - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

Image Search Results


Figure 1. Loss of the let-7 family inversely correlated with increased expression of EZH2 in PCa tissue specimens compared to adjacent normal prostate tissues. (A) Microarray profiling was done for assessing the expression of miRNA using total RNA extracted from three PCa tissue specimens and matched adjacent normal prostate tissues. The results showed that let-7a, let-7b, let-7c and let-7d was highly expressed in prostate tissues and their expression was lost in human PCa tissue specimens (* p,0.05, ** p,0.01). (B) The results from real time-RT-PCR confirmed that the levels of let-7b, let-7c and let-7d were significantly down-regulated in tumors with higher Gleason grade. (7a: let-7a; N: normal; TG6: tumor tissues from patients with Gleason grade 6. n = 39 for normal, n = 44 for TG6, n = 52 for TG7, n = 33 for TG8, 9). (C) A significant up-regulation of the expression of EZH2 was observed in PCa tissue specimens with Gleason grade 7 (n = 46) and higher (n = 33), but not in PCa specimens with Gleason grade 6 (n = 39). (D) EZH2 levels were inversely correlated with let-7b and let-7c expressions in tumor specimens with Gleason grade 7. doi:10.1371/journal.pone.0033729.g001

Journal: PloS one

Article Title: Loss of let-7 up-regulates EZH2 in prostate cancer consistent with the acquisition of cancer stem cell signatures that are attenuated by BR-DIM.

doi: 10.1371/journal.pone.0033729

Figure Lengend Snippet: Figure 1. Loss of the let-7 family inversely correlated with increased expression of EZH2 in PCa tissue specimens compared to adjacent normal prostate tissues. (A) Microarray profiling was done for assessing the expression of miRNA using total RNA extracted from three PCa tissue specimens and matched adjacent normal prostate tissues. The results showed that let-7a, let-7b, let-7c and let-7d was highly expressed in prostate tissues and their expression was lost in human PCa tissue specimens (* p,0.05, ** p,0.01). (B) The results from real time-RT-PCR confirmed that the levels of let-7b, let-7c and let-7d were significantly down-regulated in tumors with higher Gleason grade. (7a: let-7a; N: normal; TG6: tumor tissues from patients with Gleason grade 6. n = 39 for normal, n = 44 for TG6, n = 52 for TG7, n = 33 for TG8, 9). (C) A significant up-regulation of the expression of EZH2 was observed in PCa tissue specimens with Gleason grade 7 (n = 46) and higher (n = 33), but not in PCa specimens with Gleason grade 6 (n = 39). (D) EZH2 levels were inversely correlated with let-7b and let-7c expressions in tumor specimens with Gleason grade 7. doi:10.1371/journal.pone.0033729.g001

Article Snippet: Luciferase activity assay PC3 PDGF-D cells with lower levels of let-7 were seeded at a density of 66103 cells/well in a 96-well plate and incubated for 24 h. The cells were co-transfected with EZH2 39UTR luciferase plasmid (Origene, Rockville, MD) or Renilla luciferase plasmid and control miRNA, let-7a, let-7b, let-7c, and let-7d precursors using DharmaFECT duo transfection reagent (DHARMACON, Lafayette, CO).

Techniques: Expressing, Microarray, Quantitative RT-PCR

Figure 2. Let-7 regulated EZH2 expression, and inhibited clonogenic growth capacity of PCa cell lines. (A) Expression of EZH2 was found to be higher in PCa cell lines compared with immortalized prostate epithelial cell lines: PZ-HPV-7 and RWPE-1 (upper panel) and transfection of let-7 precursors inhibited EZH2 expression in PC3 and PC3 PDGF-D cells 3 days after transfection (middle and lower panel). (B) let-7 family members repressed EZH2 39UTR luciferase activity in PC3 PDGF-D cells (lower levels of let-7 family in these cells) co-transfected with let-7 and EZH2 39UTR luciferase plasmid. (C) let-7 binding sites in the 39UTR of EZH2 mRNA were shown. (D) Transfection of let-7 precursors significantly reduced clonogenic growth capacity of PC3 PDGF-D cells (Con: control, 7a: pre-let-7a, ** p,0.01). doi:10.1371/journal.pone.0033729.g002

Journal: PloS one

Article Title: Loss of let-7 up-regulates EZH2 in prostate cancer consistent with the acquisition of cancer stem cell signatures that are attenuated by BR-DIM.

doi: 10.1371/journal.pone.0033729

Figure Lengend Snippet: Figure 2. Let-7 regulated EZH2 expression, and inhibited clonogenic growth capacity of PCa cell lines. (A) Expression of EZH2 was found to be higher in PCa cell lines compared with immortalized prostate epithelial cell lines: PZ-HPV-7 and RWPE-1 (upper panel) and transfection of let-7 precursors inhibited EZH2 expression in PC3 and PC3 PDGF-D cells 3 days after transfection (middle and lower panel). (B) let-7 family members repressed EZH2 39UTR luciferase activity in PC3 PDGF-D cells (lower levels of let-7 family in these cells) co-transfected with let-7 and EZH2 39UTR luciferase plasmid. (C) let-7 binding sites in the 39UTR of EZH2 mRNA were shown. (D) Transfection of let-7 precursors significantly reduced clonogenic growth capacity of PC3 PDGF-D cells (Con: control, 7a: pre-let-7a, ** p,0.01). doi:10.1371/journal.pone.0033729.g002

Article Snippet: Luciferase activity assay PC3 PDGF-D cells with lower levels of let-7 were seeded at a density of 66103 cells/well in a 96-well plate and incubated for 24 h. The cells were co-transfected with EZH2 39UTR luciferase plasmid (Origene, Rockville, MD) or Renilla luciferase plasmid and control miRNA, let-7a, let-7b, let-7c, and let-7d precursors using DharmaFECT duo transfection reagent (DHARMACON, Lafayette, CO).

Techniques: Expressing, Transfection, Luciferase, Activity Assay, Plasmid Preparation, Binding Assay, Control

Figure 3. BR-DIM treatment increased let-7 and consequently reduced EZH2 expression. (A) Total RNA was isolated from LNCaP, C4-2B and PC3 cells treated with 25 mM BR-DIM for 24 h and the results from real time RT-PCR showing that the expression of let-7 was increased following BR-DIM treatment compared to untreated control (c: DMSO control). (B) Levels of EZH2 mRNA were repressed by BR-DIM treatment in a dose dependent meaner. (C and D) The cell lysates were prepared from cells treated with BR-DIM for 48 h and Western blot showing the protein levels of EZH2, which was down-regulated by BR-DIM treatment (PC3 PD: PC3 PDGF-D cells, *, p,0.05; **, p,0.01). doi:10.1371/journal.pone.0033729.g003

Journal: PloS one

Article Title: Loss of let-7 up-regulates EZH2 in prostate cancer consistent with the acquisition of cancer stem cell signatures that are attenuated by BR-DIM.

doi: 10.1371/journal.pone.0033729

Figure Lengend Snippet: Figure 3. BR-DIM treatment increased let-7 and consequently reduced EZH2 expression. (A) Total RNA was isolated from LNCaP, C4-2B and PC3 cells treated with 25 mM BR-DIM for 24 h and the results from real time RT-PCR showing that the expression of let-7 was increased following BR-DIM treatment compared to untreated control (c: DMSO control). (B) Levels of EZH2 mRNA were repressed by BR-DIM treatment in a dose dependent meaner. (C and D) The cell lysates were prepared from cells treated with BR-DIM for 48 h and Western blot showing the protein levels of EZH2, which was down-regulated by BR-DIM treatment (PC3 PD: PC3 PDGF-D cells, *, p,0.05; **, p,0.01). doi:10.1371/journal.pone.0033729.g003

Article Snippet: Luciferase activity assay PC3 PDGF-D cells with lower levels of let-7 were seeded at a density of 66103 cells/well in a 96-well plate and incubated for 24 h. The cells were co-transfected with EZH2 39UTR luciferase plasmid (Origene, Rockville, MD) or Renilla luciferase plasmid and control miRNA, let-7a, let-7b, let-7c, and let-7d precursors using DharmaFECT duo transfection reagent (DHARMACON, Lafayette, CO).

Techniques: Expressing, Isolation, Quantitative RT-PCR, Control, Western Blot

Figure 4. BR-DIM intervention in PCa patients resulted in the increased expression of let-7 family and consequently inhibited EZH2 expression in tumor tissues. RNA was obtained from BR-DIM intervention clinical trial samples where BR-DIM was given to patients for 2–4 weeks prior to surgery. RNA was also obtained from formalin-fixed paraffin-embedded (FFPE) tissue specimens of PCa patients with matched tumor Gleason grade, tumor stage and patient age as control group. The expression of miRNAs and mRNA was assessed using real time RT-PCR. Relative miRNA and mRNA levels were normalized to RNU1A1 and beta-actin, respectively. (A) BR-DIM intervention led to the increased trend in levels of Let-7a expression. (B and C) let-7b, let-7c and let-7d were significantly up-regulated by BR-DIM intervention. (D) EZH2 expression was down-regulated by BR- DIM intervention. doi:10.1371/journal.pone.0033729.g004

Journal: PloS one

Article Title: Loss of let-7 up-regulates EZH2 in prostate cancer consistent with the acquisition of cancer stem cell signatures that are attenuated by BR-DIM.

doi: 10.1371/journal.pone.0033729

Figure Lengend Snippet: Figure 4. BR-DIM intervention in PCa patients resulted in the increased expression of let-7 family and consequently inhibited EZH2 expression in tumor tissues. RNA was obtained from BR-DIM intervention clinical trial samples where BR-DIM was given to patients for 2–4 weeks prior to surgery. RNA was also obtained from formalin-fixed paraffin-embedded (FFPE) tissue specimens of PCa patients with matched tumor Gleason grade, tumor stage and patient age as control group. The expression of miRNAs and mRNA was assessed using real time RT-PCR. Relative miRNA and mRNA levels were normalized to RNU1A1 and beta-actin, respectively. (A) BR-DIM intervention led to the increased trend in levels of Let-7a expression. (B and C) let-7b, let-7c and let-7d were significantly up-regulated by BR-DIM intervention. (D) EZH2 expression was down-regulated by BR- DIM intervention. doi:10.1371/journal.pone.0033729.g004

Article Snippet: Luciferase activity assay PC3 PDGF-D cells with lower levels of let-7 were seeded at a density of 66103 cells/well in a 96-well plate and incubated for 24 h. The cells were co-transfected with EZH2 39UTR luciferase plasmid (Origene, Rockville, MD) or Renilla luciferase plasmid and control miRNA, let-7a, let-7b, let-7c, and let-7d precursors using DharmaFECT duo transfection reagent (DHARMACON, Lafayette, CO).

Techniques: Expressing, Formalin-fixed Paraffin-Embedded, Control, Quantitative RT-PCR

Fig. 4 UA suppressed the expression of SP1. Overexpression of SP1 reversed the effect of UA on DNMT1 and EZH2 protein expression. a, H1299 and A549 cells were exposed to increased concentration of UA for 24 h, followed by measuring the protein expression of SP1 by Western blot. The bar graphs represent the mean ± SD of SP1/GAPDH of three independent experiments. b, H1299 and A549 cells were treated with SP600125 (20 μM) for 2 h before exposure of the cells to UA (30 μM) for an additional 24 h. Afterwards, the expression of phosphorylation of SAPK/JNK and SP1 protein were detected by Western blot. c-e, H1299 and A549 cells were transfected with control (pcDNA3.1) and SP1 overexpression vector (pcDNA3.1SP1/flu) for 24 h before exposing the cells to UA for an additional 24 h. Afterwards, SP1, EZH2 (c) and DNMT1 protein expression (d), and phosphorylation of JNK (e) were determined using Western blot. Values in bar graphs were given as the mean ± SD from three independent experiments performed in triplicate. *Indicates significant difference as compared to the untreated control group (P < 0.05). **Indicates significant difference from UA treated alone (P < 0.01)

Journal: Journal of experimental & clinical cancer research : CR

Article Title: Activation of SAPK/JNK mediated the inhibition and reciprocal interaction of DNA methyltransferase 1 and EZH2 by ursolic acid in human lung cancer cells.

doi: 10.1186/s13046-015-0215-9

Figure Lengend Snippet: Fig. 4 UA suppressed the expression of SP1. Overexpression of SP1 reversed the effect of UA on DNMT1 and EZH2 protein expression. a, H1299 and A549 cells were exposed to increased concentration of UA for 24 h, followed by measuring the protein expression of SP1 by Western blot. The bar graphs represent the mean ± SD of SP1/GAPDH of three independent experiments. b, H1299 and A549 cells were treated with SP600125 (20 μM) for 2 h before exposure of the cells to UA (30 μM) for an additional 24 h. Afterwards, the expression of phosphorylation of SAPK/JNK and SP1 protein were detected by Western blot. c-e, H1299 and A549 cells were transfected with control (pcDNA3.1) and SP1 overexpression vector (pcDNA3.1SP1/flu) for 24 h before exposing the cells to UA for an additional 24 h. Afterwards, SP1, EZH2 (c) and DNMT1 protein expression (d), and phosphorylation of JNK (e) were determined using Western blot. Values in bar graphs were given as the mean ± SD from three independent experiments performed in triplicate. *Indicates significant difference as compared to the untreated control group (P < 0.05). **Indicates significant difference from UA treated alone (P < 0.01)

Article Snippet: After resuspending the cells, the desired control (pCMV6) or expression constructs containing Myc/FLAG-tagged ORFs of human DNMT1and EZH2 were obtained from OriGene Technologies, Inc. (Rockville, MD, USA), or control (pcDNA3.1) and SP1 overexpression vector (pcDNA3.1SP1/flu, kindly provided by Dr. Thomas E. Eling (NIEHS, Research Triangle Park, NC, USA) [24] at a final concentration of 5–10 μg/mL were added, and the electroporation plate were put in the MXcell plate chamber in Gene Pulser II Electroporation System (Bio-Rad, Hercules, CA, USA).

Techniques: Expressing, Over Expression, Concentration Assay, Western Blot, Phospho-proteomics, Transfection, Control, Plasmid Preparation

Fig. 5 Exogenous expression of DNMT1 2 reversed the effect of UA on EZH protein expression and cell growth. a-b, H1299 and A549 cells were transfected with the control (pCMV6) or expression constructs of DNMT1 for 24 h before exposing the cells to UA for an additional 24 h. Afterwards, EZH2 and DNMT1 protein expression (a) and cell viability (b) were determined using Western blot and MTT assays. c, H1299 and A549 cells were transfected with the control (pCMV6) or expression constructs of EZH2 for 24 h before exposing the cells to UA for an additional 24 h. Afterwards, EZH2 and DNMT1 protein were determined using Western blot. d, H1299 and A549 cells were transfected with the control (pCMV6) or expression constructs of DNMT1 for 24 h before exposing the cells to UA for an additional 24 h. Afterwards, DNMT1, phosphor-SAPK/JNK were determined using Western blot. Values in bar graphs were given as the mean ± SD from three independent experiments performed in triplicate. *Indicates significant difference as compared to the untreated control group (P < 0.05). **Indicates significant difference from UA treated alone (P < 0.01). e, The diagram shows that UA inhibits NSCLC growth through SAPK/JNK-mediated inhibition of SP1; this in turn results in inhibition of DNMT1 and EZH2. Overexpression of DNMT1 diminishes UA-reduced EZH2 protein expression. The negative feedback regulation of SAPK/JNK signaling by SP1 and DNMT1 attenuates, while the reciprocal interaction of EZH2 and DNMT1 contributes the overall effect of UA in inhibition of lung cancer cell growth

Journal: Journal of experimental & clinical cancer research : CR

Article Title: Activation of SAPK/JNK mediated the inhibition and reciprocal interaction of DNA methyltransferase 1 and EZH2 by ursolic acid in human lung cancer cells.

doi: 10.1186/s13046-015-0215-9

Figure Lengend Snippet: Fig. 5 Exogenous expression of DNMT1 2 reversed the effect of UA on EZH protein expression and cell growth. a-b, H1299 and A549 cells were transfected with the control (pCMV6) or expression constructs of DNMT1 for 24 h before exposing the cells to UA for an additional 24 h. Afterwards, EZH2 and DNMT1 protein expression (a) and cell viability (b) were determined using Western blot and MTT assays. c, H1299 and A549 cells were transfected with the control (pCMV6) or expression constructs of EZH2 for 24 h before exposing the cells to UA for an additional 24 h. Afterwards, EZH2 and DNMT1 protein were determined using Western blot. d, H1299 and A549 cells were transfected with the control (pCMV6) or expression constructs of DNMT1 for 24 h before exposing the cells to UA for an additional 24 h. Afterwards, DNMT1, phosphor-SAPK/JNK were determined using Western blot. Values in bar graphs were given as the mean ± SD from three independent experiments performed in triplicate. *Indicates significant difference as compared to the untreated control group (P < 0.05). **Indicates significant difference from UA treated alone (P < 0.01). e, The diagram shows that UA inhibits NSCLC growth through SAPK/JNK-mediated inhibition of SP1; this in turn results in inhibition of DNMT1 and EZH2. Overexpression of DNMT1 diminishes UA-reduced EZH2 protein expression. The negative feedback regulation of SAPK/JNK signaling by SP1 and DNMT1 attenuates, while the reciprocal interaction of EZH2 and DNMT1 contributes the overall effect of UA in inhibition of lung cancer cell growth

Article Snippet: After resuspending the cells, the desired control (pCMV6) or expression constructs containing Myc/FLAG-tagged ORFs of human DNMT1and EZH2 were obtained from OriGene Technologies, Inc. (Rockville, MD, USA), or control (pcDNA3.1) and SP1 overexpression vector (pcDNA3.1SP1/flu, kindly provided by Dr. Thomas E. Eling (NIEHS, Research Triangle Park, NC, USA) [24] at a final concentration of 5–10 μg/mL were added, and the electroporation plate were put in the MXcell plate chamber in Gene Pulser II Electroporation System (Bio-Rad, Hercules, CA, USA).

Techniques: Expressing, Transfection, Control, Construct, Western Blot, Inhibition, Over Expression

Figure 3. SETD2 Loss Aggravates PCa Progression through EZH2 Upregulation (A) Volcano plots showing the differentially expressed genes between the indicated organoids generated from 3-month-old mice. The represented genes are listed. (B) Heatmap summarizing the qRT-PCR results in organoids generated from 3-month-old mice. The expression was normalized to the mean level of each gene in Pten+/ cells. (C) IHC for the indicated proteins in 6-month-old mice prostates. Scale bar, 50 mm. (D) IB analysis of C4-2 cells in control and SETD2 KD cells with CHX treatment as indicated, and the graph represents the quantification of EZH2 protein levels relative to b-actin level from three independent experiments. Gray dot line indicates the half-life of EZH2 levels in control cells. Data are presented as mean ± SEM and analyzed by two-way ANOVA followed by multiple comparison. **p < 0.01. (E) Heatmap of H3K27me3 signal from 2 kb of transcription start site (TSS) to +2 kb of the transcription end site (TES) of 13,412 genes harboring H3K27me3 peaks in the indicated organoids generated from 3-month-old mice. (F) RNA sequencing and ChIP-seq tracks for H3K27me3 at Cdkn2a and Sox7 gene locus. (G) Heatmap of IHC score (by Pearson’s) between SETD2 and EZH2 in PCa specimens.

Journal: Cancer cell

Article Title: SETD2 Restricts Prostate Cancer Metastasis by Integrating EZH2 and AMPK Signaling Pathways.

doi: 10.1016/j.ccell.2020.05.022

Figure Lengend Snippet: Figure 3. SETD2 Loss Aggravates PCa Progression through EZH2 Upregulation (A) Volcano plots showing the differentially expressed genes between the indicated organoids generated from 3-month-old mice. The represented genes are listed. (B) Heatmap summarizing the qRT-PCR results in organoids generated from 3-month-old mice. The expression was normalized to the mean level of each gene in Pten+/ cells. (C) IHC for the indicated proteins in 6-month-old mice prostates. Scale bar, 50 mm. (D) IB analysis of C4-2 cells in control and SETD2 KD cells with CHX treatment as indicated, and the graph represents the quantification of EZH2 protein levels relative to b-actin level from three independent experiments. Gray dot line indicates the half-life of EZH2 levels in control cells. Data are presented as mean ± SEM and analyzed by two-way ANOVA followed by multiple comparison. **p < 0.01. (E) Heatmap of H3K27me3 signal from 2 kb of transcription start site (TSS) to +2 kb of the transcription end site (TES) of 13,412 genes harboring H3K27me3 peaks in the indicated organoids generated from 3-month-old mice. (F) RNA sequencing and ChIP-seq tracks for H3K27me3 at Cdkn2a and Sox7 gene locus. (G) Heatmap of IHC score (by Pearson’s) between SETD2 and EZH2 in PCa specimens.

Article Snippet: To create a C57BL/6 mouse model with point mutation (K735R) at mouse Ezh2 locus by CRISPR/Cas9-mediated genome engineering (CyagenBiosciences), EZH2K735R (AAG toCGC) specific sgRNA oligos were designed by the CRISPRwebsite (http://crispr.mit. edu/) targeting sequence at K735 locus (5’-GTTCGATGCCCACATACTTC-3’) and oligo donor sequence (5’-GTTGGATAGGTTGTCACTTCTTGTTCATATTGTTTCAGATACAGCCAGG CTGATGCCCTGCGCTATGTGGGCATCGAACGAGAAATGGAAATCCCTTGACATCTACTACCTCTTCCCCTTCTC-3’).

Techniques: Generated, Quantitative RT-PCR, Expressing, Control, Comparison, RNA Sequencing, ChIP-sequencing

Figure 4. SETD2-Mediated K735me1 Promotes EZH2 Degradation in a Smurf2-Dependent Manner (A) IB analysis of whole-cell lysates (WCLs) and immunoprecipitation (IP) of 293T cells transfected with the indicated plasmids. (B) IB analysis of WCLs and IP of C4-2 and LNCaP cells. (C) IB analysis of EZH2-K735me1 by in vitro methylation assay. (D) IHC for K735me1 and EZH2 in the 3-month-old mouse prostates. Scale bar, 50 mm. (E) IB analysis of K735me1 in IP of organoid cells generated from 3-month-old mice with or without 20 mM MG132 treatment for 8 h. (F) Quantification of methylated and unmethylated EZH2-K735 peptides by MS analysis in C4-2 cells with or without 20 mM MG132 for 8 h. Data are presented as the mean ± SEM of three independent experiments, and p values were calculated by two-tailed Student’s t test. **p < 0.01. (G) IB analysis of the indicated protein in WT and C4-2K735R cells. (H and I) IB (H) and tumor volume (I) arising from WT and C4-2K735R cells with or without SETD2-F2 overexpression (n = 6). Data are presented as mean ± SEM, two-way ANOVA followed by multiple comparison. **p < 0.01. (J) IB analysis of WCLs of WT, SETD2 KD, and C4-2K735R cells with or without Smurf2 overexpression. (K) IB analysis of WCLs and anti-EZH2 IP of the indicated cells with or without SETD2-F2 overexpression. See also Figure S4.

Journal: Cancer cell

Article Title: SETD2 Restricts Prostate Cancer Metastasis by Integrating EZH2 and AMPK Signaling Pathways.

doi: 10.1016/j.ccell.2020.05.022

Figure Lengend Snippet: Figure 4. SETD2-Mediated K735me1 Promotes EZH2 Degradation in a Smurf2-Dependent Manner (A) IB analysis of whole-cell lysates (WCLs) and immunoprecipitation (IP) of 293T cells transfected with the indicated plasmids. (B) IB analysis of WCLs and IP of C4-2 and LNCaP cells. (C) IB analysis of EZH2-K735me1 by in vitro methylation assay. (D) IHC for K735me1 and EZH2 in the 3-month-old mouse prostates. Scale bar, 50 mm. (E) IB analysis of K735me1 in IP of organoid cells generated from 3-month-old mice with or without 20 mM MG132 treatment for 8 h. (F) Quantification of methylated and unmethylated EZH2-K735 peptides by MS analysis in C4-2 cells with or without 20 mM MG132 for 8 h. Data are presented as the mean ± SEM of three independent experiments, and p values were calculated by two-tailed Student’s t test. **p < 0.01. (G) IB analysis of the indicated protein in WT and C4-2K735R cells. (H and I) IB (H) and tumor volume (I) arising from WT and C4-2K735R cells with or without SETD2-F2 overexpression (n = 6). Data are presented as mean ± SEM, two-way ANOVA followed by multiple comparison. **p < 0.01. (J) IB analysis of WCLs of WT, SETD2 KD, and C4-2K735R cells with or without Smurf2 overexpression. (K) IB analysis of WCLs and anti-EZH2 IP of the indicated cells with or without SETD2-F2 overexpression. See also Figure S4.

Article Snippet: To create a C57BL/6 mouse model with point mutation (K735R) at mouse Ezh2 locus by CRISPR/Cas9-mediated genome engineering (CyagenBiosciences), EZH2K735R (AAG toCGC) specific sgRNA oligos were designed by the CRISPRwebsite (http://crispr.mit. edu/) targeting sequence at K735 locus (5’-GTTCGATGCCCACATACTTC-3’) and oligo donor sequence (5’-GTTGGATAGGTTGTCACTTCTTGTTCATATTGTTTCAGATACAGCCAGG CTGATGCCCTGCGCTATGTGGGCATCGAACGAGAAATGGAAATCCCTTGACATCTACTACCTCTTCCCCTTCTC-3’).

Techniques: Immunoprecipitation, Transfection, In Vitro, Methylation, Generated, Two Tailed Test, Over Expression, Comparison

Figure 5. Methylation-Deficient Ezh2 Promotes PCa Metastasis in Mice (A) IHC for K735me1 and EZH2 in ventral prostate sections as indicated. Scale bar, 50 mm. (B) H&E staining of mouse prostates at 8–10 months of age. Scale bar, 100 mm. Quantification of histological grade is shown (n = 10). Data are presented as mean ± SEM, c2 test. **p < 0.01. (C) IHC staining as indicated in 4-month-old prostatic sections. Scale bar, 100 mm. Quantification of histological grade is shown (n = 6). The results are presented as the mean ± SEM, c2 test. **p < 0.01. (D) IHC staining for AR and CK8 in lymph nodes and lungs from 4-month-old mice. Scale bar, 100 mm. (E) IB analysis of the indicated protein in the organoid cells with or without Setd2 KD or overexpression (CRISPRa/dCas9-based induction).

Journal: Cancer cell

Article Title: SETD2 Restricts Prostate Cancer Metastasis by Integrating EZH2 and AMPK Signaling Pathways.

doi: 10.1016/j.ccell.2020.05.022

Figure Lengend Snippet: Figure 5. Methylation-Deficient Ezh2 Promotes PCa Metastasis in Mice (A) IHC for K735me1 and EZH2 in ventral prostate sections as indicated. Scale bar, 50 mm. (B) H&E staining of mouse prostates at 8–10 months of age. Scale bar, 100 mm. Quantification of histological grade is shown (n = 10). Data are presented as mean ± SEM, c2 test. **p < 0.01. (C) IHC staining as indicated in 4-month-old prostatic sections. Scale bar, 100 mm. Quantification of histological grade is shown (n = 6). The results are presented as the mean ± SEM, c2 test. **p < 0.01. (D) IHC staining for AR and CK8 in lymph nodes and lungs from 4-month-old mice. Scale bar, 100 mm. (E) IB analysis of the indicated protein in the organoid cells with or without Setd2 KD or overexpression (CRISPRa/dCas9-based induction).

Article Snippet: To create a C57BL/6 mouse model with point mutation (K735R) at mouse Ezh2 locus by CRISPR/Cas9-mediated genome engineering (CyagenBiosciences), EZH2K735R (AAG toCGC) specific sgRNA oligos were designed by the CRISPRwebsite (http://crispr.mit. edu/) targeting sequence at K735 locus (5’-GTTCGATGCCCACATACTTC-3’) and oligo donor sequence (5’-GTTGGATAGGTTGTCACTTCTTGTTCATATTGTTTCAGATACAGCCAGG CTGATGCCCTGCGCTATGTGGGCATCGAACGAGAAATGGAAATCCCTTGACATCTACTACCTCTTCCCCTTCTC-3’).

Techniques: Methylation, Staining, Immunohistochemistry, Over Expression

Figure 6. SETD2-R1523H Variants Potentiate Tumorigenesis via EZH2 (A) List of the most significant missense mutation sites in SETD2. The number among all SETD2 missense mutation tumors is shown. p values were calculated by recurrent mutations analysis as reported previously (Chang et al., 2016; Makohon-Moore et al., 2017). (B) Summary of the regions mediating SETD2 interaction with EZH2. (C) IB analysis of the IP in 293T cells transfected with the indicated plasmids. (D) GST pull-down assay of the interaction between the indicated protein. (E) IB analysis of C4-2 cells stably transfected with the indicated plasmids.

Journal: Cancer cell

Article Title: SETD2 Restricts Prostate Cancer Metastasis by Integrating EZH2 and AMPK Signaling Pathways.

doi: 10.1016/j.ccell.2020.05.022

Figure Lengend Snippet: Figure 6. SETD2-R1523H Variants Potentiate Tumorigenesis via EZH2 (A) List of the most significant missense mutation sites in SETD2. The number among all SETD2 missense mutation tumors is shown. p values were calculated by recurrent mutations analysis as reported previously (Chang et al., 2016; Makohon-Moore et al., 2017). (B) Summary of the regions mediating SETD2 interaction with EZH2. (C) IB analysis of the IP in 293T cells transfected with the indicated plasmids. (D) GST pull-down assay of the interaction between the indicated protein. (E) IB analysis of C4-2 cells stably transfected with the indicated plasmids.

Article Snippet: To create a C57BL/6 mouse model with point mutation (K735R) at mouse Ezh2 locus by CRISPR/Cas9-mediated genome engineering (CyagenBiosciences), EZH2K735R (AAG toCGC) specific sgRNA oligos were designed by the CRISPRwebsite (http://crispr.mit. edu/) targeting sequence at K735 locus (5’-GTTCGATGCCCACATACTTC-3’) and oligo donor sequence (5’-GTTGGATAGGTTGTCACTTCTTGTTCATATTGTTTCAGATACAGCCAGG CTGATGCCCTGCGCTATGTGGGCATCGAACGAGAAATGGAAATCCCTTGACATCTACTACCTCTTCCCCTTCTC-3’).

Techniques: Mutagenesis, Transfection, Pull Down Assay, Stable Transfection

Figure 7. AMPK-FOXO3 Axis-Mediated SETD2 Expression Modulates EZH2-K735me1 (A) Heatmap showing SETD2mRNA levels after 12 h treatment with the indicated compound in C4-2 cells. The expression was normalized to the mean level of each gene in the vehicle treatment group. (B and C) IB analysis of C4-2 cells treated with 1 mM AICAR for 24 h with or without AMPK KD (B) or FOXO3 KD (C). (D) Heatmap summary of the correlations (by Pearson’s) of the indicated protein in localized and metastatic tumors. The log2(relative intensity) derived from each band intensity normalized to the average of indicated protein across all samples. (E) IB analysis of organoid cells generated from 2-month-old indicated mice with or without metformin treatment for 7 days. (F) Representative images and quantification of the volume for the subcutaneous organoids (n = 5, data are presented as mean ± SEM and analyzed by two-tailed Student’s t test, *p < 0.05, **p < 0.01). Mice were treated with vehicle or metformin (100 mg/kg/day) every 2 days for 6 weeks. (G) Volume of tumors derived from PDXs treated with metformin (100 mg/kg/day) or vehicle every 2 days for 4–6 weeks (n = 6, two-way ANOVA followed by multiple comparison, *p < 0.05, **p < 0.01). Data are presented as mean ± SEM. Scale bar, 1 cm. See also Figure S7 and Table S6.

Journal: Cancer cell

Article Title: SETD2 Restricts Prostate Cancer Metastasis by Integrating EZH2 and AMPK Signaling Pathways.

doi: 10.1016/j.ccell.2020.05.022

Figure Lengend Snippet: Figure 7. AMPK-FOXO3 Axis-Mediated SETD2 Expression Modulates EZH2-K735me1 (A) Heatmap showing SETD2mRNA levels after 12 h treatment with the indicated compound in C4-2 cells. The expression was normalized to the mean level of each gene in the vehicle treatment group. (B and C) IB analysis of C4-2 cells treated with 1 mM AICAR for 24 h with or without AMPK KD (B) or FOXO3 KD (C). (D) Heatmap summary of the correlations (by Pearson’s) of the indicated protein in localized and metastatic tumors. The log2(relative intensity) derived from each band intensity normalized to the average of indicated protein across all samples. (E) IB analysis of organoid cells generated from 2-month-old indicated mice with or without metformin treatment for 7 days. (F) Representative images and quantification of the volume for the subcutaneous organoids (n = 5, data are presented as mean ± SEM and analyzed by two-tailed Student’s t test, *p < 0.05, **p < 0.01). Mice were treated with vehicle or metformin (100 mg/kg/day) every 2 days for 6 weeks. (G) Volume of tumors derived from PDXs treated with metformin (100 mg/kg/day) or vehicle every 2 days for 4–6 weeks (n = 6, two-way ANOVA followed by multiple comparison, *p < 0.05, **p < 0.01). Data are presented as mean ± SEM. Scale bar, 1 cm. See also Figure S7 and Table S6.

Article Snippet: To create a C57BL/6 mouse model with point mutation (K735R) at mouse Ezh2 locus by CRISPR/Cas9-mediated genome engineering (CyagenBiosciences), EZH2K735R (AAG toCGC) specific sgRNA oligos were designed by the CRISPRwebsite (http://crispr.mit. edu/) targeting sequence at K735 locus (5’-GTTCGATGCCCACATACTTC-3’) and oligo donor sequence (5’-GTTGGATAGGTTGTCACTTCTTGTTCATATTGTTTCAGATACAGCCAGG CTGATGCCCTGCGCTATGTGGGCATCGAACGAGAAATGGAAATCCCTTGACATCTACTACCTCTTCCCCTTCTC-3’).

Techniques: Expressing, Derivative Assay, Generated, Two Tailed Test, Comparison

Inhibitors of histone PTMs

Journal: Epigenetics & Chromatin

Article Title: The pattern of histone H3 epigenetic posttranslational modifications is regulated by the VRK1 chromatin kinase

doi: 10.1186/s13072-023-00494-7

Figure Lengend Snippet: Inhibitors of histone PTMs

Article Snippet: EZH2 , pCMV6 , Myc-DDK , Mammalian , Origene, #RC202054.

Techniques: Concentration Assay

Plasmids

Journal: Epigenetics & Chromatin

Article Title: The pattern of histone H3 epigenetic posttranslational modifications is regulated by the VRK1 chromatin kinase

doi: 10.1186/s13072-023-00494-7

Figure Lengend Snippet: Plasmids

Article Snippet: EZH2 , pCMV6 , Myc-DDK , Mammalian , Origene, #RC202054.

Techniques: Plasmid Preparation, Expressing

FIGURE 1 Combined FGFR and EZH2 inhibition reveals strong synergy in BAP1-deficient mesothelioma. A, 3D synergy plots visualizing the synergy

Journal: Cancer Research Communications

Article Title: Combined Inhibition of EZH2 and FGFR is Synergistic in BAP1-deficient Malignant Mesothelioma

doi: 10.1158/2767-9764.crc-23-0276

Figure Lengend Snippet: FIGURE 1 Combined FGFR and EZH2 inhibition reveals strong synergy in BAP1-deficient mesothelioma. A, 3D synergy plots visualizing the synergy

Article Snippet: Knockdown of Bap1 and Ezh2 by Inducible Short Hairpin RNA For BAP knockdown experiments in cell line MP41, we used doxycycline (dox)-inducible FH1-tUTG-RNAi vectors (Taconic Artemis) targeting the following sequence: 5′-GAGUUCAUCUGCACCUUUA-3′.

Techniques: Inhibition

FIGURE 2 EZH2 inhibition results in upregulation of FGFR pathways. A, GO-term analysis on differentially expressed genes between BNC cell lines (n = 2) that were treated with GSK126 or untreated. B, KEGG pathway enrichment analysis on samples mentioned in A. C, Long-term clonogenicity

Journal: Cancer Research Communications

Article Title: Combined Inhibition of EZH2 and FGFR is Synergistic in BAP1-deficient Malignant Mesothelioma

doi: 10.1158/2767-9764.crc-23-0276

Figure Lengend Snippet: FIGURE 2 EZH2 inhibition results in upregulation of FGFR pathways. A, GO-term analysis on differentially expressed genes between BNC cell lines (n = 2) that were treated with GSK126 or untreated. B, KEGG pathway enrichment analysis on samples mentioned in A. C, Long-term clonogenicity

Article Snippet: Knockdown of Bap1 and Ezh2 by Inducible Short Hairpin RNA For BAP knockdown experiments in cell line MP41, we used doxycycline (dox)-inducible FH1-tUTG-RNAi vectors (Taconic Artemis) targeting the following sequence: 5′-GAGUUCAUCUGCACCUUUA-3′.

Techniques: Inhibition

FIGURE 5 EZH2 and FGFR combination prolong survival of autochthonous BNC mouse models. A, Schematic representation of the experimental

Journal: Cancer Research Communications

Article Title: Combined Inhibition of EZH2 and FGFR is Synergistic in BAP1-deficient Malignant Mesothelioma

doi: 10.1158/2767-9764.crc-23-0276

Figure Lengend Snippet: FIGURE 5 EZH2 and FGFR combination prolong survival of autochthonous BNC mouse models. A, Schematic representation of the experimental

Article Snippet: Knockdown of Bap1 and Ezh2 by Inducible Short Hairpin RNA For BAP knockdown experiments in cell line MP41, we used doxycycline (dox)-inducible FH1-tUTG-RNAi vectors (Taconic Artemis) targeting the following sequence: 5′-GAGUUCAUCUGCACCUUUA-3′.

Techniques: