expand high fidelity pcr system Roche Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78
    Roche high fidelity polymerase chain reaction pcr system polymerase
    IRF9 is required for efficient ISG induction and overexpression of IRF9 overcomes JAK-STAT inhbition by <t>ORF63.</t> (A) IRF9 expression levels were analyzed in THF-ISRE control cells and cells expressing shRNA V3LHS 322329 (shRNA1), V3LHS 322332 (shRNA2) or V2LHS 69847 (shRNA3) by SDS PAGE and western blot. (B) THF-ISRE cells were infected with AdORF63 at MOI 20 and AdTA at MOI 10 in the presence of the indicated amounts of Dox. THF-ISRE control and shRNA-expressing cells were infected with AdTA at MOI 30. At 48 hours p.i. all cells were lysed and ORF63 and IRF9 levels in the lysates were determined by SDS-PAGE and western blot using specific antibodies. GAPDH was used as a loading control. (C) RNA was isolated from THF-ISRE expressing IRF9-specific siRNAs that were stimulated for 4 or 8 hours. <t>RT-PCR</t> and qPCR were used to determine ISG54 expression in all cells. Data were normalized by the level of GAPDH mRNA expression in each sample and are shown as the relative fold induction. Shown are the means ± standard error of three replicates. One of two representative experiments is shown. (D) THF-ISRE cells expressing the IRF9-specific siRNAs were stimulated with 1000 U/ml uIFN for 4 or 8 hours and lysates were analyzed for ISG54 expression using SDS-PAGE and western blot.
    High Fidelity Polymerase Chain Reaction Pcr System Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 78/100, based on 803 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity polymerase chain reaction pcr system polymerase/product/Roche
    Average 78 stars, based on 803 article reviews
    Price from $9.99 to $1999.99
    high fidelity polymerase chain reaction pcr system polymerase - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    95
    Roche 10x pcr buffer
    IRF9 is required for efficient ISG induction and overexpression of IRF9 overcomes JAK-STAT inhbition by <t>ORF63.</t> (A) IRF9 expression levels were analyzed in THF-ISRE control cells and cells expressing shRNA V3LHS 322329 (shRNA1), V3LHS 322332 (shRNA2) or V2LHS 69847 (shRNA3) by SDS PAGE and western blot. (B) THF-ISRE cells were infected with AdORF63 at MOI 20 and AdTA at MOI 10 in the presence of the indicated amounts of Dox. THF-ISRE control and shRNA-expressing cells were infected with AdTA at MOI 30. At 48 hours p.i. all cells were lysed and ORF63 and IRF9 levels in the lysates were determined by SDS-PAGE and western blot using specific antibodies. GAPDH was used as a loading control. (C) RNA was isolated from THF-ISRE expressing IRF9-specific siRNAs that were stimulated for 4 or 8 hours. <t>RT-PCR</t> and qPCR were used to determine ISG54 expression in all cells. Data were normalized by the level of GAPDH mRNA expression in each sample and are shown as the relative fold induction. Shown are the means ± standard error of three replicates. One of two representative experiments is shown. (D) THF-ISRE cells expressing the IRF9-specific siRNAs were stimulated with 1000 U/ml uIFN for 4 or 8 hours and lysates were analyzed for ISG54 expression using SDS-PAGE and western blot.
    10x Pcr Buffer, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 230 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/10x pcr buffer/product/Roche
    Average 95 stars, based on 230 article reviews
    Price from $9.99 to $1999.99
    10x pcr buffer - by Bioz Stars, 2020-01
    95/100 stars
      Buy from Supplier

    79
    Roche j pcr amplification
    IRF9 is required for efficient ISG induction and overexpression of IRF9 overcomes JAK-STAT inhbition by <t>ORF63.</t> (A) IRF9 expression levels were analyzed in THF-ISRE control cells and cells expressing shRNA V3LHS 322329 (shRNA1), V3LHS 322332 (shRNA2) or V2LHS 69847 (shRNA3) by SDS PAGE and western blot. (B) THF-ISRE cells were infected with AdORF63 at MOI 20 and AdTA at MOI 10 in the presence of the indicated amounts of Dox. THF-ISRE control and shRNA-expressing cells were infected with AdTA at MOI 30. At 48 hours p.i. all cells were lysed and ORF63 and IRF9 levels in the lysates were determined by SDS-PAGE and western blot using specific antibodies. GAPDH was used as a loading control. (C) RNA was isolated from THF-ISRE expressing IRF9-specific siRNAs that were stimulated for 4 or 8 hours. <t>RT-PCR</t> and qPCR were used to determine ISG54 expression in all cells. Data were normalized by the level of GAPDH mRNA expression in each sample and are shown as the relative fold induction. Shown are the means ± standard error of three replicates. One of two representative experiments is shown. (D) THF-ISRE cells expressing the IRF9-specific siRNAs were stimulated with 1000 U/ml uIFN for 4 or 8 hours and lysates were analyzed for ISG54 expression using SDS-PAGE and western blot.
    J Pcr Amplification, supplied by Roche, used in various techniques. Bioz Stars score: 79/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/j pcr amplification/product/Roche
    Average 79 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    j pcr amplification - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    99
    Roche high fidelity pcr system
    IRF9 is required for efficient ISG induction and overexpression of IRF9 overcomes JAK-STAT inhbition by <t>ORF63.</t> (A) IRF9 expression levels were analyzed in THF-ISRE control cells and cells expressing shRNA V3LHS 322329 (shRNA1), V3LHS 322332 (shRNA2) or V2LHS 69847 (shRNA3) by SDS PAGE and western blot. (B) THF-ISRE cells were infected with AdORF63 at MOI 20 and AdTA at MOI 10 in the presence of the indicated amounts of Dox. THF-ISRE control and shRNA-expressing cells were infected with AdTA at MOI 30. At 48 hours p.i. all cells were lysed and ORF63 and IRF9 levels in the lysates were determined by SDS-PAGE and western blot using specific antibodies. GAPDH was used as a loading control. (C) RNA was isolated from THF-ISRE expressing IRF9-specific siRNAs that were stimulated for 4 or 8 hours. <t>RT-PCR</t> and qPCR were used to determine ISG54 expression in all cells. Data were normalized by the level of GAPDH mRNA expression in each sample and are shown as the relative fold induction. Shown are the means ± standard error of three replicates. One of two representative experiments is shown. (D) THF-ISRE cells expressing the IRF9-specific siRNAs were stimulated with 1000 U/ml uIFN for 4 or 8 hours and lysates were analyzed for ISG54 expression using SDS-PAGE and western blot.
    High Fidelity Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 841 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity pcr system/product/Roche
    Average 99 stars, based on 841 article reviews
    Price from $9.99 to $1999.99
    high fidelity pcr system - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    88
    Roche expand high fidelity pcr
    GC activates CREB in Nalm-6 cells. ( A ) Cell lysate obtained from DEX-treated <t>RCAN1</t> +/+ and RCAN1 Hyg/Puro cells was subjected to immunoblotting using anti-CREB and anti-pCREB (Ser133) antibodies. ( B ) RNA prepared from RCAN1 +/+ and RCAN1 Hyg/Puro cells treated with 10 −6 M DEX was subjected to quantitative <t>RT-PCR</t> using primer sets that hybridize to CREB target genes, AREG , CREM , and CFOS . *, p
    Expand High Fidelity Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 77 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr/product/Roche
    Average 88 stars, based on 77 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr - by Bioz Stars, 2020-01
    88/100 stars
      Buy from Supplier

    79
    Roche expanded high fidelity pcr
    GC activates CREB in Nalm-6 cells. ( A ) Cell lysate obtained from DEX-treated <t>RCAN1</t> +/+ and RCAN1 Hyg/Puro cells was subjected to immunoblotting using anti-CREB and anti-pCREB (Ser133) antibodies. ( B ) RNA prepared from RCAN1 +/+ and RCAN1 Hyg/Puro cells treated with 10 −6 M DEX was subjected to quantitative <t>RT-PCR</t> using primer sets that hybridize to CREB target genes, AREG , CREM , and CFOS . *, p
    Expanded High Fidelity Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 79/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expanded high fidelity pcr/product/Roche
    Average 79 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    expanded high fidelity pcr - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    97
    Roche high fidelity pcr kit
    GC activates CREB in Nalm-6 cells. ( A ) Cell lysate obtained from DEX-treated <t>RCAN1</t> +/+ and RCAN1 Hyg/Puro cells was subjected to immunoblotting using anti-CREB and anti-pCREB (Ser133) antibodies. ( B ) RNA prepared from RCAN1 +/+ and RCAN1 Hyg/Puro cells treated with 10 −6 M DEX was subjected to quantitative <t>RT-PCR</t> using primer sets that hybridize to CREB target genes, AREG , CREM , and CFOS . *, p
    High Fidelity Pcr Kit, supplied by Roche, used in various techniques. Bioz Stars score: 97/100, based on 186 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity pcr kit/product/Roche
    Average 97 stars, based on 186 article reviews
    Price from $9.99 to $1999.99
    high fidelity pcr kit - by Bioz Stars, 2020-01
    97/100 stars
      Buy from Supplier

    75
    Roche high fidelity pcr system kit
    GC activates CREB in Nalm-6 cells. ( A ) Cell lysate obtained from DEX-treated <t>RCAN1</t> +/+ and RCAN1 Hyg/Puro cells was subjected to immunoblotting using anti-CREB and anti-pCREB (Ser133) antibodies. ( B ) RNA prepared from RCAN1 +/+ and RCAN1 Hyg/Puro cells treated with 10 −6 M DEX was subjected to quantitative <t>RT-PCR</t> using primer sets that hybridize to CREB target genes, AREG , CREM , and CFOS . *, p
    High Fidelity Pcr System Kit, supplied by Roche, used in various techniques. Bioz Stars score: 75/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity pcr system kit/product/Roche
    Average 75 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    high fidelity pcr system kit - by Bioz Stars, 2020-01
    75/100 stars
      Buy from Supplier

    99
    Roche expand high fidelity pcr polymerase
    GC activates CREB in Nalm-6 cells. ( A ) Cell lysate obtained from DEX-treated <t>RCAN1</t> +/+ and RCAN1 Hyg/Puro cells was subjected to immunoblotting using anti-CREB and anti-pCREB (Ser133) antibodies. ( B ) RNA prepared from RCAN1 +/+ and RCAN1 Hyg/Puro cells treated with 10 −6 M DEX was subjected to quantitative <t>RT-PCR</t> using primer sets that hybridize to CREB target genes, AREG , CREM , and CFOS . *, p
    Expand High Fidelity Pcr Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 46 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr polymerase/product/Roche
    Average 99 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr polymerase - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    78
    Roche enzyme expand high fidelity pcr
    GC activates CREB in Nalm-6 cells. ( A ) Cell lysate obtained from DEX-treated <t>RCAN1</t> +/+ and RCAN1 Hyg/Puro cells was subjected to immunoblotting using anti-CREB and anti-pCREB (Ser133) antibodies. ( B ) RNA prepared from RCAN1 +/+ and RCAN1 Hyg/Puro cells treated with 10 −6 M DEX was subjected to quantitative <t>RT-PCR</t> using primer sets that hybridize to CREB target genes, AREG , CREM , and CFOS . *, p
    Enzyme Expand High Fidelity Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 78/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/enzyme expand high fidelity pcr/product/Roche
    Average 78 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    enzyme expand high fidelity pcr - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    99
    Roche expand high fidelity pcr kit
    GC activates CREB in Nalm-6 cells. ( A ) Cell lysate obtained from DEX-treated <t>RCAN1</t> +/+ and RCAN1 Hyg/Puro cells was subjected to immunoblotting using anti-CREB and anti-pCREB (Ser133) antibodies. ( B ) RNA prepared from RCAN1 +/+ and RCAN1 Hyg/Puro cells treated with 10 −6 M DEX was subjected to quantitative <t>RT-PCR</t> using primer sets that hybridize to CREB target genes, AREG , CREM , and CFOS . *, p
    Expand High Fidelity Pcr Kit, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 594 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr kit/product/Roche
    Average 99 stars, based on 594 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr kit - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    90
    Boehringer Mannheim expand high fidelity pcr system
    <t>PCR</t> amplification of fnr region from different <t>MG1655</t> isolates. The fnr region was amplified from the CGSC isolate of MG1655 (CGSC 6300; lane 1) and the isolate obtained from M. Singer and C. Gross (NCM3430; lane 2) (see Materials and Methods). The sizes of the molecular standards in lane 3 are noted to the right. The genes deleted in the CGSC isolate (b1332 to b1344) are, respectively, ynaJ (open reading frame conserved in E. coli and Salmonella enterica ), uspE ( ydaA ), fnr (Crp family activator of anaerobic respiratory gene transcription), ogt ( O -6-alkylguanine-DNA/cysteine-protein methyltransferase), abgT ( ydaH ; p ), abgB ( ydaI ; p ), abgA ( ydaJ ; p ), abgR ( ydaK ; p ), ydaL (open reading frame conserved in enterobacteria), ydaM (open reading frame conserved in E. coli ), ydaN (open reading frame conserved in enterobacteria), dbpA (ATP-dependent RNA helicase), and ydaO (open reading frame conserved in enterobacteria). The deletion is flanked by tns5_4 (b1331), which codes for IS 5 transposase, and ydaP (b1345), a rac prophage which codes for a putative prophage integrase.
    Expand High Fidelity Pcr System, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 986 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system/product/Boehringer Mannheim
    Average 90 stars, based on 986 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    88
    Roche expanded high fidelity pcr system
    <t>PCR</t> amplification of fnr region from different <t>MG1655</t> isolates. The fnr region was amplified from the CGSC isolate of MG1655 (CGSC 6300; lane 1) and the isolate obtained from M. Singer and C. Gross (NCM3430; lane 2) (see Materials and Methods). The sizes of the molecular standards in lane 3 are noted to the right. The genes deleted in the CGSC isolate (b1332 to b1344) are, respectively, ynaJ (open reading frame conserved in E. coli and Salmonella enterica ), uspE ( ydaA ), fnr (Crp family activator of anaerobic respiratory gene transcription), ogt ( O -6-alkylguanine-DNA/cysteine-protein methyltransferase), abgT ( ydaH ; p ), abgB ( ydaI ; p ), abgA ( ydaJ ; p ), abgR ( ydaK ; p ), ydaL (open reading frame conserved in enterobacteria), ydaM (open reading frame conserved in E. coli ), ydaN (open reading frame conserved in enterobacteria), dbpA (ATP-dependent RNA helicase), and ydaO (open reading frame conserved in enterobacteria). The deletion is flanked by tns5_4 (b1331), which codes for IS 5 transposase, and ydaP (b1345), a rac prophage which codes for a putative prophage integrase.
    Expanded High Fidelity Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 67 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expanded high fidelity pcr system/product/Roche
    Average 88 stars, based on 67 article reviews
    Price from $9.99 to $1999.99
    expanded high fidelity pcr system - by Bioz Stars, 2020-01
    88/100 stars
      Buy from Supplier

    79
    Roche expand high fidelity plus pcr
    <t>PCR</t> amplification of fnr region from different <t>MG1655</t> isolates. The fnr region was amplified from the CGSC isolate of MG1655 (CGSC 6300; lane 1) and the isolate obtained from M. Singer and C. Gross (NCM3430; lane 2) (see Materials and Methods). The sizes of the molecular standards in lane 3 are noted to the right. The genes deleted in the CGSC isolate (b1332 to b1344) are, respectively, ynaJ (open reading frame conserved in E. coli and Salmonella enterica ), uspE ( ydaA ), fnr (Crp family activator of anaerobic respiratory gene transcription), ogt ( O -6-alkylguanine-DNA/cysteine-protein methyltransferase), abgT ( ydaH ; p ), abgB ( ydaI ; p ), abgA ( ydaJ ; p ), abgR ( ydaK ; p ), ydaL (open reading frame conserved in enterobacteria), ydaM (open reading frame conserved in E. coli ), ydaN (open reading frame conserved in enterobacteria), dbpA (ATP-dependent RNA helicase), and ydaO (open reading frame conserved in enterobacteria). The deletion is flanked by tns5_4 (b1331), which codes for IS 5 transposase, and ydaP (b1345), a rac prophage which codes for a putative prophage integrase.
    Expand High Fidelity Plus Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 79/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity plus pcr/product/Roche
    Average 79 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity plus pcr - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    79
    Roche high fidelity hifi pcr system
    <t>PCR</t> amplification of fnr region from different <t>MG1655</t> isolates. The fnr region was amplified from the CGSC isolate of MG1655 (CGSC 6300; lane 1) and the isolate obtained from M. Singer and C. Gross (NCM3430; lane 2) (see Materials and Methods). The sizes of the molecular standards in lane 3 are noted to the right. The genes deleted in the CGSC isolate (b1332 to b1344) are, respectively, ynaJ (open reading frame conserved in E. coli and Salmonella enterica ), uspE ( ydaA ), fnr (Crp family activator of anaerobic respiratory gene transcription), ogt ( O -6-alkylguanine-DNA/cysteine-protein methyltransferase), abgT ( ydaH ; p ), abgB ( ydaI ; p ), abgA ( ydaJ ; p ), abgR ( ydaK ; p ), ydaL (open reading frame conserved in enterobacteria), ydaM (open reading frame conserved in E. coli ), ydaN (open reading frame conserved in enterobacteria), dbpA (ATP-dependent RNA helicase), and ydaO (open reading frame conserved in enterobacteria). The deletion is flanked by tns5_4 (b1331), which codes for IS 5 transposase, and ydaP (b1345), a rac prophage which codes for a putative prophage integrase.
    High Fidelity Hifi Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 79/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity hifi pcr system/product/Roche
    Average 79 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    high fidelity hifi pcr system - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    94
    Roche expand high fidelity pcr buffer
    <t>PCR</t> amplification of fnr region from different <t>MG1655</t> isolates. The fnr region was amplified from the CGSC isolate of MG1655 (CGSC 6300; lane 1) and the isolate obtained from M. Singer and C. Gross (NCM3430; lane 2) (see Materials and Methods). The sizes of the molecular standards in lane 3 are noted to the right. The genes deleted in the CGSC isolate (b1332 to b1344) are, respectively, ynaJ (open reading frame conserved in E. coli and Salmonella enterica ), uspE ( ydaA ), fnr (Crp family activator of anaerobic respiratory gene transcription), ogt ( O -6-alkylguanine-DNA/cysteine-protein methyltransferase), abgT ( ydaH ; p ), abgB ( ydaI ; p ), abgA ( ydaJ ; p ), abgR ( ydaK ; p ), ydaL (open reading frame conserved in enterobacteria), ydaM (open reading frame conserved in E. coli ), ydaN (open reading frame conserved in enterobacteria), dbpA (ATP-dependent RNA helicase), and ydaO (open reading frame conserved in enterobacteria). The deletion is flanked by tns5_4 (b1331), which codes for IS 5 transposase, and ydaP (b1345), a rac prophage which codes for a putative prophage integrase.
    Expand High Fidelity Pcr Buffer, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 69 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr buffer/product/Roche
    Average 94 stars, based on 69 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr buffer - by Bioz Stars, 2020-01
    94/100 stars
      Buy from Supplier

    80
    Roche high fidelity pcr reagents
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    High Fidelity Pcr Reagents, supplied by Roche, used in various techniques. Bioz Stars score: 80/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity pcr reagents/product/Roche
    Average 80 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    high fidelity pcr reagents - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    87
    Roche high fidelity plus pcr system
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    High Fidelity Plus Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 87/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity plus pcr system/product/Roche
    Average 87 stars, based on 45 article reviews
    Price from $9.99 to $1999.99
    high fidelity plus pcr system - by Bioz Stars, 2020-01
    87/100 stars
      Buy from Supplier

    99
    Roche expand high fidelity pcr system kit
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    Expand High Fidelity Pcr System Kit, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 167 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system kit/product/Roche
    Average 99 stars, based on 167 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system kit - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    Roche expand high fidelity plus pcr system
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    Expand High Fidelity Plus Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 385 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity plus pcr system/product/Roche
    Average 99 stars, based on 385 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity plus pcr system - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    79
    Roche expand high fidelity ehf pcr system
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    Expand High Fidelity Ehf Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 79/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity ehf pcr system/product/Roche
    Average 79 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity ehf pcr system - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    88
    Roche expanded high fidelity plus pcr system
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    Expanded High Fidelity Plus Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 48 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expanded high fidelity plus pcr system/product/Roche
    Average 88 stars, based on 48 article reviews
    Price from $9.99 to $1999.99
    expanded high fidelity plus pcr system - by Bioz Stars, 2020-01
    88/100 stars
      Buy from Supplier

    77
    Roche step expand high fidelity pcr system
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    Step Expand High Fidelity Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 77/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/step expand high fidelity pcr system/product/Roche
    Average 77 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    step expand high fidelity pcr system - by Bioz Stars, 2020-01
    77/100 stars
      Buy from Supplier

    80
    Roche expand high fidelity pcr system polymerase
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    Expand High Fidelity Pcr System Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 80/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system polymerase/product/Roche
    Average 80 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system polymerase - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    80
    Roche expand high fidelity pcr system protocol
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    Expand High Fidelity Pcr System Protocol, supplied by Roche, used in various techniques. Bioz Stars score: 80/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system protocol/product/Roche
    Average 80 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system protocol - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    79
    Roche long expand high fidelity pcr kit
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    Long Expand High Fidelity Pcr Kit, supplied by Roche, used in various techniques. Bioz Stars score: 79/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long expand high fidelity pcr kit/product/Roche
    Average 79 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    long expand high fidelity pcr kit - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    89
    Roche taq pwo expand high fidelity pcr system
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    Taq Pwo Expand High Fidelity Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 89/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq pwo expand high fidelity pcr system/product/Roche
    Average 89 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    taq pwo expand high fidelity pcr system - by Bioz Stars, 2020-01
    89/100 stars
      Buy from Supplier

    76
    Roche expand high fidelity pcr dna polymerase
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    Expand High Fidelity Pcr Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 76/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr dna polymerase/product/Roche
    Average 76 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr dna polymerase - by Bioz Stars, 2020-01
    76/100 stars
      Buy from Supplier

    79
    Roche pcr expand high fidelity taq polymerase
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    Pcr Expand High Fidelity Taq Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 79/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr expand high fidelity taq polymerase/product/Roche
    Average 79 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    pcr expand high fidelity taq polymerase - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    87
    Roche expand high fidelity pcr system dna polymerase
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    Expand High Fidelity Pcr System Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 87/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system dna polymerase/product/Roche
    Average 87 stars, based on 54 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system dna polymerase - by Bioz Stars, 2020-01
    87/100 stars
      Buy from Supplier

    79
    Roche expand high fidelity pcr master mix
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    Expand High Fidelity Pcr Master Mix, supplied by Roche, used in various techniques. Bioz Stars score: 79/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr master mix/product/Roche
    Average 79 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr master mix - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    93
    Roche high fidelity polymerase
    <t>PCR</t> amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C <t>p67</t> primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.
    High Fidelity Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 553 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity polymerase/product/Roche
    Average 93 stars, based on 553 article reviews
    Price from $9.99 to $1999.99
    high fidelity polymerase - by Bioz Stars, 2020-01
    93/100 stars
      Buy from Supplier

    Image Search Results


    IRF9 is required for efficient ISG induction and overexpression of IRF9 overcomes JAK-STAT inhbition by ORF63. (A) IRF9 expression levels were analyzed in THF-ISRE control cells and cells expressing shRNA V3LHS 322329 (shRNA1), V3LHS 322332 (shRNA2) or V2LHS 69847 (shRNA3) by SDS PAGE and western blot. (B) THF-ISRE cells were infected with AdORF63 at MOI 20 and AdTA at MOI 10 in the presence of the indicated amounts of Dox. THF-ISRE control and shRNA-expressing cells were infected with AdTA at MOI 30. At 48 hours p.i. all cells were lysed and ORF63 and IRF9 levels in the lysates were determined by SDS-PAGE and western blot using specific antibodies. GAPDH was used as a loading control. (C) RNA was isolated from THF-ISRE expressing IRF9-specific siRNAs that were stimulated for 4 or 8 hours. RT-PCR and qPCR were used to determine ISG54 expression in all cells. Data were normalized by the level of GAPDH mRNA expression in each sample and are shown as the relative fold induction. Shown are the means ± standard error of three replicates. One of two representative experiments is shown. (D) THF-ISRE cells expressing the IRF9-specific siRNAs were stimulated with 1000 U/ml uIFN for 4 or 8 hours and lysates were analyzed for ISG54 expression using SDS-PAGE and western blot.

    Journal: PLoS Pathogens

    Article Title: Varicella Viruses Inhibit Interferon-Stimulated JAK-STAT Signaling through Multiple Mechanisms

    doi: 10.1371/journal.ppat.1004901

    Figure Lengend Snippet: IRF9 is required for efficient ISG induction and overexpression of IRF9 overcomes JAK-STAT inhbition by ORF63. (A) IRF9 expression levels were analyzed in THF-ISRE control cells and cells expressing shRNA V3LHS 322329 (shRNA1), V3LHS 322332 (shRNA2) or V2LHS 69847 (shRNA3) by SDS PAGE and western blot. (B) THF-ISRE cells were infected with AdORF63 at MOI 20 and AdTA at MOI 10 in the presence of the indicated amounts of Dox. THF-ISRE control and shRNA-expressing cells were infected with AdTA at MOI 30. At 48 hours p.i. all cells were lysed and ORF63 and IRF9 levels in the lysates were determined by SDS-PAGE and western blot using specific antibodies. GAPDH was used as a loading control. (C) RNA was isolated from THF-ISRE expressing IRF9-specific siRNAs that were stimulated for 4 or 8 hours. RT-PCR and qPCR were used to determine ISG54 expression in all cells. Data were normalized by the level of GAPDH mRNA expression in each sample and are shown as the relative fold induction. Shown are the means ± standard error of three replicates. One of two representative experiments is shown. (D) THF-ISRE cells expressing the IRF9-specific siRNAs were stimulated with 1000 U/ml uIFN for 4 or 8 hours and lysates were analyzed for ISG54 expression using SDS-PAGE and western blot.

    Article Snippet: VZV ORF63 was amplified from DNA extracted from VZV.eGFP-infected MRC-5 cells using the Expand Expand High Fidelity PCR system (Roche) and the following primers: 5'-(AATAAAGGATCCGCCACCATGTTTTGCACCTCACCGGC)-3' (Fw) and 5'-(AATAAAGAATTCCTACACGCCATGGGGGGGCGGTATATC)-3' (Rev).

    Techniques: Over Expression, Expressing, shRNA, SDS Page, Western Blot, Infection, Isolation, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    GC activates CREB in Nalm-6 cells. ( A ) Cell lysate obtained from DEX-treated RCAN1 +/+ and RCAN1 Hyg/Puro cells was subjected to immunoblotting using anti-CREB and anti-pCREB (Ser133) antibodies. ( B ) RNA prepared from RCAN1 +/+ and RCAN1 Hyg/Puro cells treated with 10 −6 M DEX was subjected to quantitative RT-PCR using primer sets that hybridize to CREB target genes, AREG , CREM , and CFOS . *, p

    Journal: PLoS ONE

    Article Title: RCAN1 Is an Important Mediator of Glucocorticoid-Induced Apoptosis in Human Leukemic Cells

    doi: 10.1371/journal.pone.0049926

    Figure Lengend Snippet: GC activates CREB in Nalm-6 cells. ( A ) Cell lysate obtained from DEX-treated RCAN1 +/+ and RCAN1 Hyg/Puro cells was subjected to immunoblotting using anti-CREB and anti-pCREB (Ser133) antibodies. ( B ) RNA prepared from RCAN1 +/+ and RCAN1 Hyg/Puro cells treated with 10 −6 M DEX was subjected to quantitative RT-PCR using primer sets that hybridize to CREB target genes, AREG , CREM , and CFOS . *, p

    Article Snippet: In brief, for the human RCAN1 gene, 1.9-kb and 2.1-kb genomic DNA fragments were amplified by Expand high fidelity PCR systems (F. Hoffmann-La Roche, Ltd., Basel, Switzerland) with Nalm-6 genomic DNA as a template and used as a 5′-arm and a 3′-arm, respectively.

    Techniques: Quantitative RT-PCR

    RCAN1 disruption changed expression levels of BIM and Bxl-xL mRNAs. Total RNA was extracted from RCAN1 +/+ and RCAN1 Hyg/Puro cells, treated with 10 −6 M DEX for the period indicated, and subjected to quantitative real-time RT-PCR using primer sets hybridizing to each BIM isoform ( A ) (*, p

    Journal: PLoS ONE

    Article Title: RCAN1 Is an Important Mediator of Glucocorticoid-Induced Apoptosis in Human Leukemic Cells

    doi: 10.1371/journal.pone.0049926

    Figure Lengend Snippet: RCAN1 disruption changed expression levels of BIM and Bxl-xL mRNAs. Total RNA was extracted from RCAN1 +/+ and RCAN1 Hyg/Puro cells, treated with 10 −6 M DEX for the period indicated, and subjected to quantitative real-time RT-PCR using primer sets hybridizing to each BIM isoform ( A ) (*, p

    Article Snippet: In brief, for the human RCAN1 gene, 1.9-kb and 2.1-kb genomic DNA fragments were amplified by Expand high fidelity PCR systems (F. Hoffmann-La Roche, Ltd., Basel, Switzerland) with Nalm-6 genomic DNA as a template and used as a 5′-arm and a 3′-arm, respectively.

    Techniques: Expressing, Quantitative RT-PCR

    PCR amplification of fnr region from different MG1655 isolates. The fnr region was amplified from the CGSC isolate of MG1655 (CGSC 6300; lane 1) and the isolate obtained from M. Singer and C. Gross (NCM3430; lane 2) (see Materials and Methods). The sizes of the molecular standards in lane 3 are noted to the right. The genes deleted in the CGSC isolate (b1332 to b1344) are, respectively, ynaJ (open reading frame conserved in E. coli and Salmonella enterica ), uspE ( ydaA ), fnr (Crp family activator of anaerobic respiratory gene transcription), ogt ( O -6-alkylguanine-DNA/cysteine-protein methyltransferase), abgT ( ydaH ; p ), abgB ( ydaI ; p ), abgA ( ydaJ ; p ), abgR ( ydaK ; p ), ydaL (open reading frame conserved in enterobacteria), ydaM (open reading frame conserved in E. coli ), ydaN (open reading frame conserved in enterobacteria), dbpA (ATP-dependent RNA helicase), and ydaO (open reading frame conserved in enterobacteria). The deletion is flanked by tns5_4 (b1331), which codes for IS 5 transposase, and ydaP (b1345), a rac prophage which codes for a putative prophage integrase.

    Journal: Journal of Bacteriology

    Article Title: Physiological Studies of Escherichia coli Strain MG1655: Growth Defects and Apparent Cross-Regulation of Gene Expression

    doi: 10.1128/JB.185.18.5611-5626.2003

    Figure Lengend Snippet: PCR amplification of fnr region from different MG1655 isolates. The fnr region was amplified from the CGSC isolate of MG1655 (CGSC 6300; lane 1) and the isolate obtained from M. Singer and C. Gross (NCM3430; lane 2) (see Materials and Methods). The sizes of the molecular standards in lane 3 are noted to the right. The genes deleted in the CGSC isolate (b1332 to b1344) are, respectively, ynaJ (open reading frame conserved in E. coli and Salmonella enterica ), uspE ( ydaA ), fnr (Crp family activator of anaerobic respiratory gene transcription), ogt ( O -6-alkylguanine-DNA/cysteine-protein methyltransferase), abgT ( ydaH ; p ), abgB ( ydaI ; p ), abgA ( ydaJ ; p ), abgR ( ydaK ; p ), ydaL (open reading frame conserved in enterobacteria), ydaM (open reading frame conserved in E. coli ), ydaN (open reading frame conserved in enterobacteria), dbpA (ATP-dependent RNA helicase), and ydaO (open reading frame conserved in enterobacteria). The deletion is flanked by tns5_4 (b1331), which codes for IS 5 transposase, and ydaP (b1345), a rac prophage which codes for a putative prophage integrase.

    Article Snippet: Strain NCM3467 (Δ ycjT ::Kanr ) which carries a deletion of 686 bp of the ycjT gene (,2267 bp total; deletion starts 544 bp downstream of the translational start codon) and an insertion of a kanamycin resistance cassette, used for selection, was obtained from the recD strain NCM3426 (see Table ) by the following steps. (i) The ycjT gene with flanking sequences of the ycjS and ycjU genes was amplified from strain MG1655 (CGSC 6300) with primers ycjT1 (5′-ACTAAGCTTAGATCCTGCCCAGGCGTACC) and ycjT2 (5′-AGTTCTAGAGCCAGAAGGCCGATAACCGC) and the Expand high-fidelity PCR system (Boehringer Mannheim-Roche).

    Techniques: Polymerase Chain Reaction, Amplification

    PCR amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C p67 primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.

    Journal: International Journal for Parasitology: Parasites and Wildlife

    Article Title: The African buffalo parasite Theileria. sp. (buffalo) can infect and immortalize cattle leukocytes and encodes divergent orthologues of Theileria parva antigen genes

    doi: 10.1016/j.ijppaw.2015.08.006

    Figure Lengend Snippet: PCR amplification of genes encoding Theileria parva antigens from Marula schizont-infected leukocyte cultures. Panel A, p104 primers; Panel B PIM, primers; Panel C p67 primers. The order of the schizont-infected lymphocyte samples is (1) N6; (2). N13; (3). N18; (4). N20; (5). N33; (6). N36; (7). N38; (8). N43; (9). N50; (10). N55; (11). N69; (12). N76; (13). N77, (14). N79; (15). N86, (16). N88; (17). N99; (18). N100; (19). N102; (20). N103; (21). N106; (22). N107.

    Article Snippet: 2.8 PCR amplification and sequencing of parasite antigen genes For p104, p67, and PIM loci : PCR amplification was performed using Taq Expand™ high fidelity PCR reagents (Roche Diagnostics, Mannheim, Germany) in 100 μl reactions volumes containing 1X PCR buffer, 200 mM of each dNTP, 100 ng of each forward and reverse primer, 1.5 mM MgCl2 , 0.5 units of Expand High fidelity Taq DNA polymerase and 50 ng of DNA.

    Techniques: Polymerase Chain Reaction, Amplification, Infection