expand high fidelity pcr system Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Millipore expand high fidelity pcr system
    Mechanisms of <t>GILZ</t> downregulation upon TLR activation. (A,B) AMs pretreated with BAY-11-7082 (BAY82, 5 μM), BAY-11-7085 (BAY85, 5 μM), or the solvent control DMSO (0.1%) for 1 h, followed by treatment with LPS (100 ng/mL), Pam 3 CSK 4 (Pam, 1 μg/mL), Poly(I:C) (PIC, 10 μg/mL), or medium (Co) for 4 h. GILZ expression was determined by Western blot. Tubulin served as a loading control. (A) Representative blot. (B) GILZ signal intensities were quantified and normalized to tubulin values ( n = 7). Values for unstimulated DMSO controls were set as 100%. (C,D) After preincubation with BAY-11-7082 or BAY-11-7085 (5 μM, 1 h), solvent (0.1% DMSO) or medium only (Co), AMs were treated with LPS (100 ng/mL) for 2 h. GILZ and ZFP36 mRNA expression was determined by <t>qRT-PCR</t> using ACTB as a housekeeping gene ( n = 3, duplicates). (E) AMs were either left untreated (Co) or treated with LPS (100 ng/mL), Pam 3 CSK 4 (Pam, 1 μg/mL), or Poly(I:C) (PIC, 10 μg/mL) for 4 h. TTP levels were determined by Western blot using tubulin as a loading control. GILZ signal intensities were normalized to tubulin and are shown as a percentage of untreated cells ( n = 2, triplicates). (F) The number of miRNAs predicted to target GILZ, CXCL8, IL6 , and TNF was assessed via the microRNA Data Integration Portal (mirDIP, accession date 02/02/2018). (G) AMs were either left untreated (Co) or treated with Poly(I:C) (PIC, 10 μg/mL), aurintricarboxylic acid (ATA, 25 μM), or a combination of both for 8 h. GILZ expression was quantified by Western blot. Signal intensities were normalized to tubulin and expressed as a percentage of untreated cells ( n = 3). * p
    Expand High Fidelity Pcr System, supplied by Millipore, used in various techniques. Bioz Stars score: 96/100, based on 87 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system/product/Millipore
    Average 96 stars, based on 87 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system - by Bioz Stars, 2020-05
    96/100 stars
      Buy from Supplier

    85
    Roche expand high fidelity polymerase chain reaction pcr system
    (A) Schematic representation of <t>PCR</t> and sequence-based strategies used to further investigate genomic deletion or divergence . Two couples of primers were designed based on the genome sequence of T. whipplei Twist strain, including one (F1/R1) flanking the gene predicted absent/divergent by CGH analysis, and another (sF1/sR1) flanking the PCR amplicon spotted on the microarray represented by the hatched square. (B) PCR analysis of a putative TWT596 deletion on various T. whipplei strains . The amplicon size obtained using the primers TWT595F1 and TWT597R1 and T. whipplei Twist <t>DNA</t> as positive control was of 2040 nt. Lower size amplicons were obtained with Slow2, Endo5, Neuro1, DigADP11, Dig15 and DigNeuro18, indicating that the gene was deleted in these strains. The first lane corresponds to DNA size standard (1 kb DNA ladder, Invitrogen).
    Expand High Fidelity Polymerase Chain Reaction Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 61 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity polymerase chain reaction pcr system/product/Roche
    Average 85 stars, based on 61 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity polymerase chain reaction pcr system - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    85
    Roche high fidelity polymerase chain reaction pcr system polymerase
    (A) Schematic representation of <t>PCR</t> and sequence-based strategies used to further investigate genomic deletion or divergence . Two couples of primers were designed based on the genome sequence of T. whipplei Twist strain, including one (F1/R1) flanking the gene predicted absent/divergent by CGH analysis, and another (sF1/sR1) flanking the PCR amplicon spotted on the microarray represented by the hatched square. (B) PCR analysis of a putative TWT596 deletion on various T. whipplei strains . The amplicon size obtained using the primers TWT595F1 and TWT597R1 and T. whipplei Twist <t>DNA</t> as positive control was of 2040 nt. Lower size amplicons were obtained with Slow2, Endo5, Neuro1, DigADP11, Dig15 and DigNeuro18, indicating that the gene was deleted in these strains. The first lane corresponds to DNA size standard (1 kb DNA ladder, Invitrogen).
    High Fidelity Polymerase Chain Reaction Pcr System Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity polymerase chain reaction pcr system polymerase/product/Roche
    Average 85 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    high fidelity polymerase chain reaction pcr system polymerase - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    92
    Roche high fidelity pcr
    (A) Schematic representation of <t>PCR</t> and sequence-based strategies used to further investigate genomic deletion or divergence . Two couples of primers were designed based on the genome sequence of T. whipplei Twist strain, including one (F1/R1) flanking the gene predicted absent/divergent by CGH analysis, and another (sF1/sR1) flanking the PCR amplicon spotted on the microarray represented by the hatched square. (B) PCR analysis of a putative TWT596 deletion on various T. whipplei strains . The amplicon size obtained using the primers TWT595F1 and TWT597R1 and T. whipplei Twist <t>DNA</t> as positive control was of 2040 nt. Lower size amplicons were obtained with Slow2, Endo5, Neuro1, DigADP11, Dig15 and DigNeuro18, indicating that the gene was deleted in these strains. The first lane corresponds to DNA size standard (1 kb DNA ladder, Invitrogen).
    High Fidelity Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 181 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity pcr/product/Roche
    Average 92 stars, based on 181 article reviews
    Price from $9.99 to $1999.99
    high fidelity pcr - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    88
    GE Healthcare expand high fidelity pcr
    (A) Schematic representation of <t>PCR</t> and sequence-based strategies used to further investigate genomic deletion or divergence . Two couples of primers were designed based on the genome sequence of T. whipplei Twist strain, including one (F1/R1) flanking the gene predicted absent/divergent by CGH analysis, and another (sF1/sR1) flanking the PCR amplicon spotted on the microarray represented by the hatched square. (B) PCR analysis of a putative TWT596 deletion on various T. whipplei strains . The amplicon size obtained using the primers TWT595F1 and TWT597R1 and T. whipplei Twist <t>DNA</t> as positive control was of 2040 nt. Lower size amplicons were obtained with Slow2, Endo5, Neuro1, DigADP11, Dig15 and DigNeuro18, indicating that the gene was deleted in these strains. The first lane corresponds to DNA size standard (1 kb DNA ladder, Invitrogen).
    Expand High Fidelity Pcr, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 88/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr/product/GE Healthcare
    Average 88 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr - by Bioz Stars, 2020-05
    88/100 stars
      Buy from Supplier

    85
    Roche expanded high fidelity pcr
    (A) Schematic representation of <t>PCR</t> and sequence-based strategies used to further investigate genomic deletion or divergence . Two couples of primers were designed based on the genome sequence of T. whipplei Twist strain, including one (F1/R1) flanking the gene predicted absent/divergent by CGH analysis, and another (sF1/sR1) flanking the PCR amplicon spotted on the microarray represented by the hatched square. (B) PCR analysis of a putative TWT596 deletion on various T. whipplei strains . The amplicon size obtained using the primers TWT595F1 and TWT597R1 and T. whipplei Twist <t>DNA</t> as positive control was of 2040 nt. Lower size amplicons were obtained with Slow2, Endo5, Neuro1, DigADP11, Dig15 and DigNeuro18, indicating that the gene was deleted in these strains. The first lane corresponds to DNA size standard (1 kb DNA ladder, Invitrogen).
    Expanded High Fidelity Pcr, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expanded high fidelity pcr/product/Roche
    Average 85 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    expanded high fidelity pcr - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    92
    Roche expand high fidelity pcr system
    Transcript levels of cat in B. burgdorferi B31-A3 as measured by <t>QRT-PCR.</t> All values have been normalized to the internal control, flaB . Error bars represent standard deviation A. cat transcripts levels were measured in B. burgdorferi A3 harbouring cat reporter plasmids pMB313 (rpoSP 313 fragment), pMB92S (rposP 92S fragment) and pBCAT (vector control) at a cell density of 2 × 10 8 cells ml −1 . Fold changes are relative to the vector control strain. B. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) at varying cell densities. Fold changes are relative to the 2 × 10 7 spirochetes ml −1 culture. C. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) following an increase in growth temperature from 23°C to 34°C. Fold changes are relative to the inoculums used at t = 0 h.
    Expand High Fidelity Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 8133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system/product/Roche
    Average 92 stars, based on 8133 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    90
    Boehringer Mannheim expand high fidelity pcr kit
    Transcript levels of cat in B. burgdorferi B31-A3 as measured by <t>QRT-PCR.</t> All values have been normalized to the internal control, flaB . Error bars represent standard deviation A. cat transcripts levels were measured in B. burgdorferi A3 harbouring cat reporter plasmids pMB313 (rpoSP 313 fragment), pMB92S (rposP 92S fragment) and pBCAT (vector control) at a cell density of 2 × 10 8 cells ml −1 . Fold changes are relative to the vector control strain. B. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) at varying cell densities. Fold changes are relative to the 2 × 10 7 spirochetes ml −1 culture. C. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) following an increase in growth temperature from 23°C to 34°C. Fold changes are relative to the inoculums used at t = 0 h.
    Expand High Fidelity Pcr Kit, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 69 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr kit/product/Boehringer Mannheim
    Average 90 stars, based on 69 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr kit - by Bioz Stars, 2020-05
    90/100 stars
      Buy from Supplier

    92
    Boehringer Mannheim expand high fidelity pcr system
    <t>PCR</t> amplification of fnr region from different <t>MG1655</t> isolates. The fnr region was amplified from the CGSC isolate of MG1655 (CGSC 6300; lane 1) and the isolate obtained from M. Singer and C. Gross (NCM3430; lane 2) (see Materials and Methods). The sizes of the molecular standards in lane 3 are noted to the right. The genes deleted in the CGSC isolate (b1332 to b1344) are, respectively, ynaJ (open reading frame conserved in E. coli and Salmonella enterica ), uspE ( ydaA ), fnr (Crp family activator of anaerobic respiratory gene transcription), ogt ( O -6-alkylguanine-DNA/cysteine-protein methyltransferase), abgT ( ydaH ; p ), abgB ( ydaI ; p ), abgA ( ydaJ ; p ), abgR ( ydaK ; p ), ydaL (open reading frame conserved in enterobacteria), ydaM (open reading frame conserved in E. coli ), ydaN (open reading frame conserved in enterobacteria), dbpA (ATP-dependent RNA helicase), and ydaO (open reading frame conserved in enterobacteria). The deletion is flanked by tns5_4 (b1331), which codes for IS 5 transposase, and ydaP (b1345), a rac prophage which codes for a putative prophage integrase.
    Expand High Fidelity Pcr System, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 92/100, based on 991 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system/product/Boehringer Mannheim
    Average 92 stars, based on 991 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    92
    Thermo Fisher expand high fidelity pcr system
    <t>PCR</t> amplification of fnr region from different <t>MG1655</t> isolates. The fnr region was amplified from the CGSC isolate of MG1655 (CGSC 6300; lane 1) and the isolate obtained from M. Singer and C. Gross (NCM3430; lane 2) (see Materials and Methods). The sizes of the molecular standards in lane 3 are noted to the right. The genes deleted in the CGSC isolate (b1332 to b1344) are, respectively, ynaJ (open reading frame conserved in E. coli and Salmonella enterica ), uspE ( ydaA ), fnr (Crp family activator of anaerobic respiratory gene transcription), ogt ( O -6-alkylguanine-DNA/cysteine-protein methyltransferase), abgT ( ydaH ; p ), abgB ( ydaI ; p ), abgA ( ydaJ ; p ), abgR ( ydaK ; p ), ydaL (open reading frame conserved in enterobacteria), ydaM (open reading frame conserved in E. coli ), ydaN (open reading frame conserved in enterobacteria), dbpA (ATP-dependent RNA helicase), and ydaO (open reading frame conserved in enterobacteria). The deletion is flanked by tns5_4 (b1331), which codes for IS 5 transposase, and ydaP (b1345), a rac prophage which codes for a putative prophage integrase.
    Expand High Fidelity Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 52 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system/product/Thermo Fisher
    Average 92 stars, based on 52 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    92
    TaKaRa expand high fidelity pcr system
    Results of <t>PCR</t> amplification (a) Result of RNA isolation. Lane 1: 100 bp <t>DNA</t> ladder;Lane 2: total RNA. (b, c) Result of PCR using cDNA as template. (b) Lane 1: 100 bp DNA ladder; Lane 2: PCR product which indicates gene segments of about 200, 350,and 700 bp. (c) Lane 1: purified PCR product of about 700 bp; Lane 2: 100 bp DNA ladder
    Expand High Fidelity Pcr System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system/product/TaKaRa
    Average 92 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    88
    Boehringer Mannheim expand high fidelity pcr polymerase
    Results of <t>PCR</t> amplification (a) Result of RNA isolation. Lane 1: 100 bp <t>DNA</t> ladder;Lane 2: total RNA. (b, c) Result of PCR using cDNA as template. (b) Lane 1: 100 bp DNA ladder; Lane 2: PCR product which indicates gene segments of about 200, 350,and 700 bp. (c) Lane 1: purified PCR product of about 700 bp; Lane 2: 100 bp DNA ladder
    Expand High Fidelity Pcr Polymerase, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 88/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr polymerase/product/Boehringer Mannheim
    Average 88 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr polymerase - by Bioz Stars, 2020-05
    88/100 stars
      Buy from Supplier

    92
    Boehringer Ingelheim expand high fidelity pcr system
    Results of <t>PCR</t> amplification (a) Result of RNA isolation. Lane 1: 100 bp <t>DNA</t> ladder;Lane 2: total RNA. (b, c) Result of PCR using cDNA as template. (b) Lane 1: 100 bp DNA ladder; Lane 2: PCR product which indicates gene segments of about 200, 350,and 700 bp. (c) Lane 1: purified PCR product of about 700 bp; Lane 2: 100 bp DNA ladder
    Expand High Fidelity Pcr System, supplied by Boehringer Ingelheim, used in various techniques. Bioz Stars score: 92/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system/product/Boehringer Ingelheim
    Average 92 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    Image Search Results


    Mechanisms of GILZ downregulation upon TLR activation. (A,B) AMs pretreated with BAY-11-7082 (BAY82, 5 μM), BAY-11-7085 (BAY85, 5 μM), or the solvent control DMSO (0.1%) for 1 h, followed by treatment with LPS (100 ng/mL), Pam 3 CSK 4 (Pam, 1 μg/mL), Poly(I:C) (PIC, 10 μg/mL), or medium (Co) for 4 h. GILZ expression was determined by Western blot. Tubulin served as a loading control. (A) Representative blot. (B) GILZ signal intensities were quantified and normalized to tubulin values ( n = 7). Values for unstimulated DMSO controls were set as 100%. (C,D) After preincubation with BAY-11-7082 or BAY-11-7085 (5 μM, 1 h), solvent (0.1% DMSO) or medium only (Co), AMs were treated with LPS (100 ng/mL) for 2 h. GILZ and ZFP36 mRNA expression was determined by qRT-PCR using ACTB as a housekeeping gene ( n = 3, duplicates). (E) AMs were either left untreated (Co) or treated with LPS (100 ng/mL), Pam 3 CSK 4 (Pam, 1 μg/mL), or Poly(I:C) (PIC, 10 μg/mL) for 4 h. TTP levels were determined by Western blot using tubulin as a loading control. GILZ signal intensities were normalized to tubulin and are shown as a percentage of untreated cells ( n = 2, triplicates). (F) The number of miRNAs predicted to target GILZ, CXCL8, IL6 , and TNF was assessed via the microRNA Data Integration Portal (mirDIP, accession date 02/02/2018). (G) AMs were either left untreated (Co) or treated with Poly(I:C) (PIC, 10 μg/mL), aurintricarboxylic acid (ATA, 25 μM), or a combination of both for 8 h. GILZ expression was quantified by Western blot. Signal intensities were normalized to tubulin and expressed as a percentage of untreated cells ( n = 3). * p

    Journal: Frontiers in Immunology

    Article Title: Amplified Host Defense by Toll-Like Receptor-Mediated Downregulation of the Glucocorticoid-Induced Leucine Zipper (GILZ) in Macrophages

    doi: 10.3389/fimmu.2018.03111

    Figure Lengend Snippet: Mechanisms of GILZ downregulation upon TLR activation. (A,B) AMs pretreated with BAY-11-7082 (BAY82, 5 μM), BAY-11-7085 (BAY85, 5 μM), or the solvent control DMSO (0.1%) for 1 h, followed by treatment with LPS (100 ng/mL), Pam 3 CSK 4 (Pam, 1 μg/mL), Poly(I:C) (PIC, 10 μg/mL), or medium (Co) for 4 h. GILZ expression was determined by Western blot. Tubulin served as a loading control. (A) Representative blot. (B) GILZ signal intensities were quantified and normalized to tubulin values ( n = 7). Values for unstimulated DMSO controls were set as 100%. (C,D) After preincubation with BAY-11-7082 or BAY-11-7085 (5 μM, 1 h), solvent (0.1% DMSO) or medium only (Co), AMs were treated with LPS (100 ng/mL) for 2 h. GILZ and ZFP36 mRNA expression was determined by qRT-PCR using ACTB as a housekeeping gene ( n = 3, duplicates). (E) AMs were either left untreated (Co) or treated with LPS (100 ng/mL), Pam 3 CSK 4 (Pam, 1 μg/mL), or Poly(I:C) (PIC, 10 μg/mL) for 4 h. TTP levels were determined by Western blot using tubulin as a loading control. GILZ signal intensities were normalized to tubulin and are shown as a percentage of untreated cells ( n = 2, triplicates). (F) The number of miRNAs predicted to target GILZ, CXCL8, IL6 , and TNF was assessed via the microRNA Data Integration Portal (mirDIP, accession date 02/02/2018). (G) AMs were either left untreated (Co) or treated with Poly(I:C) (PIC, 10 μg/mL), aurintricarboxylic acid (ATA, 25 μM), or a combination of both for 8 h. GILZ expression was quantified by Western blot. Signal intensities were normalized to tubulin and expressed as a percentage of untreated cells ( n = 3). * p

    Article Snippet: Human GILZ 3′UTR cDNA was amplified using the Expand High fidelity PCR System (Sigma-Aldrich, # 11732641001) and the following primers: 5′-GCC TAC TAG TGC AGA GCC ACT AAA CTT G-3′ and 5′-AAT AGA GCT CAC TCT CAC AAA ACC CGC TAC-3′.

    Techniques: Activation Assay, Affinity Magnetic Separation, Expressing, Western Blot, Quantitative RT-PCR

    (A) Schematic representation of PCR and sequence-based strategies used to further investigate genomic deletion or divergence . Two couples of primers were designed based on the genome sequence of T. whipplei Twist strain, including one (F1/R1) flanking the gene predicted absent/divergent by CGH analysis, and another (sF1/sR1) flanking the PCR amplicon spotted on the microarray represented by the hatched square. (B) PCR analysis of a putative TWT596 deletion on various T. whipplei strains . The amplicon size obtained using the primers TWT595F1 and TWT597R1 and T. whipplei Twist DNA as positive control was of 2040 nt. Lower size amplicons were obtained with Slow2, Endo5, Neuro1, DigADP11, Dig15 and DigNeuro18, indicating that the gene was deleted in these strains. The first lane corresponds to DNA size standard (1 kb DNA ladder, Invitrogen).

    Journal: BMC Genomics

    Article Title: Comparative genomic analysis of Tropheryma whipplei strains reveals that diversity among clinical isolates is mainly related to the WiSP proteins

    doi: 10.1186/1471-2164-8-349

    Figure Lengend Snippet: (A) Schematic representation of PCR and sequence-based strategies used to further investigate genomic deletion or divergence . Two couples of primers were designed based on the genome sequence of T. whipplei Twist strain, including one (F1/R1) flanking the gene predicted absent/divergent by CGH analysis, and another (sF1/sR1) flanking the PCR amplicon spotted on the microarray represented by the hatched square. (B) PCR analysis of a putative TWT596 deletion on various T. whipplei strains . The amplicon size obtained using the primers TWT595F1 and TWT597R1 and T. whipplei Twist DNA as positive control was of 2040 nt. Lower size amplicons were obtained with Slow2, Endo5, Neuro1, DigADP11, Dig15 and DigNeuro18, indicating that the gene was deleted in these strains. The first lane corresponds to DNA size standard (1 kb DNA ladder, Invitrogen).

    Article Snippet: The reaction was performed with DNA from each strain using the Expand High Fidelity PCR (Roche, Penzberg, Germany) according to the manufacturer's protocol.

    Techniques: Polymerase Chain Reaction, Sequencing, Amplification, Microarray, Positive Control

    IRF9 is required for efficient ISG induction and overexpression of IRF9 overcomes JAK-STAT inhbition by ORF63. (A) IRF9 expression levels were analyzed in THF-ISRE control cells and cells expressing shRNA V3LHS 322329 (shRNA1), V3LHS 322332 (shRNA2) or V2LHS 69847 (shRNA3) by SDS PAGE and western blot. (B) THF-ISRE cells were infected with AdORF63 at MOI 20 and AdTA at MOI 10 in the presence of the indicated amounts of Dox. THF-ISRE control and shRNA-expressing cells were infected with AdTA at MOI 30. At 48 hours p.i. all cells were lysed and ORF63 and IRF9 levels in the lysates were determined by SDS-PAGE and western blot using specific antibodies. GAPDH was used as a loading control. (C) RNA was isolated from THF-ISRE expressing IRF9-specific siRNAs that were stimulated for 4 or 8 hours. RT-PCR and qPCR were used to determine ISG54 expression in all cells. Data were normalized by the level of GAPDH mRNA expression in each sample and are shown as the relative fold induction. Shown are the means ± standard error of three replicates. One of two representative experiments is shown. (D) THF-ISRE cells expressing the IRF9-specific siRNAs were stimulated with 1000 U/ml uIFN for 4 or 8 hours and lysates were analyzed for ISG54 expression using SDS-PAGE and western blot.

    Journal: PLoS Pathogens

    Article Title: Varicella Viruses Inhibit Interferon-Stimulated JAK-STAT Signaling through Multiple Mechanisms

    doi: 10.1371/journal.ppat.1004901

    Figure Lengend Snippet: IRF9 is required for efficient ISG induction and overexpression of IRF9 overcomes JAK-STAT inhbition by ORF63. (A) IRF9 expression levels were analyzed in THF-ISRE control cells and cells expressing shRNA V3LHS 322329 (shRNA1), V3LHS 322332 (shRNA2) or V2LHS 69847 (shRNA3) by SDS PAGE and western blot. (B) THF-ISRE cells were infected with AdORF63 at MOI 20 and AdTA at MOI 10 in the presence of the indicated amounts of Dox. THF-ISRE control and shRNA-expressing cells were infected with AdTA at MOI 30. At 48 hours p.i. all cells were lysed and ORF63 and IRF9 levels in the lysates were determined by SDS-PAGE and western blot using specific antibodies. GAPDH was used as a loading control. (C) RNA was isolated from THF-ISRE expressing IRF9-specific siRNAs that were stimulated for 4 or 8 hours. RT-PCR and qPCR were used to determine ISG54 expression in all cells. Data were normalized by the level of GAPDH mRNA expression in each sample and are shown as the relative fold induction. Shown are the means ± standard error of three replicates. One of two representative experiments is shown. (D) THF-ISRE cells expressing the IRF9-specific siRNAs were stimulated with 1000 U/ml uIFN for 4 or 8 hours and lysates were analyzed for ISG54 expression using SDS-PAGE and western blot.

    Article Snippet: VZV ORF63 was amplified from DNA extracted from VZV.eGFP-infected MRC-5 cells using the Expand Expand High Fidelity PCR system (Roche) and the following primers: 5'-(AATAAAGGATCCGCCACCATGTTTTGCACCTCACCGGC)-3' (Fw) and 5'-(AATAAAGAATTCCTACACGCCATGGGGGGGCGGTATATC)-3' (Rev).

    Techniques: Over Expression, Expressing, shRNA, SDS Page, Western Blot, Infection, Isolation, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    Characterization of the FirS iron-binding motif. The induction of ygiW (A) and firR (B) in response to Fe 2+ was measured by qRT-PCR. The ability of wild-type 2019, the Δ firS mutant KK009, KHS1 ( firS Y149G, R150T), KHS3 ( firS D148A), KHS4 ( firS E151G, D152S), and KHS5 ( firS + ) to respond to Fe 2+ was tested. Expression of each gene was measured by qRT-PCR and compared to the expression of each gene in cultures grown without the addition of exogenous FeCl 2 . The data presented are means and standard deviations from two experiments, each performed in triplicate.

    Journal: Journal of Bacteriology

    Article Title: Characterization of a Ferrous Iron-Responsive Two-Component System in Nontypeable Haemophilus influenzae

    doi: 10.1128/JB.01465-12

    Figure Lengend Snippet: Characterization of the FirS iron-binding motif. The induction of ygiW (A) and firR (B) in response to Fe 2+ was measured by qRT-PCR. The ability of wild-type 2019, the Δ firS mutant KK009, KHS1 ( firS Y149G, R150T), KHS3 ( firS D148A), KHS4 ( firS E151G, D152S), and KHS5 ( firS + ) to respond to Fe 2+ was tested. Expression of each gene was measured by qRT-PCR and compared to the expression of each gene in cultures grown without the addition of exogenous FeCl 2 . The data presented are means and standard deviations from two experiments, each performed in triplicate.

    Article Snippet: For probe synthesis, DNA fragments internal to each gene were amplified by PCR using primers 1709F8 and 1709R7 ( ygiW ) and 1708F3 and 1708R3 ( firR ) and the Expand high-fidelity PCR kit (Roche).

    Techniques: Binding Assay, Quantitative RT-PCR, Mutagenesis, Expressing

    Thermoresponsive induction of ygiW (A) and firR (B). Cultures of wild-type NTHI 2019, the Δ firR mutant (NB004), the Δ firS mutant (KK009), the complemented firR mutant ( firR + ; KHS2), and the complemented firS mutant ( firS + ; KHS5) were grown in sRPMI at 37°C to early log phase and shifted to 9°C for 30 min prior to RNA extraction. Expression of each gene was measured by qRT-PCR and compared to the expression of each gene when cultures were incubated at 37°C. The data presented are means and standard deviations from two experiments, each performed in triplicate.

    Journal: Journal of Bacteriology

    Article Title: Characterization of a Ferrous Iron-Responsive Two-Component System in Nontypeable Haemophilus influenzae

    doi: 10.1128/JB.01465-12

    Figure Lengend Snippet: Thermoresponsive induction of ygiW (A) and firR (B). Cultures of wild-type NTHI 2019, the Δ firR mutant (NB004), the Δ firS mutant (KK009), the complemented firR mutant ( firR + ; KHS2), and the complemented firS mutant ( firS + ; KHS5) were grown in sRPMI at 37°C to early log phase and shifted to 9°C for 30 min prior to RNA extraction. Expression of each gene was measured by qRT-PCR and compared to the expression of each gene when cultures were incubated at 37°C. The data presented are means and standard deviations from two experiments, each performed in triplicate.

    Article Snippet: For probe synthesis, DNA fragments internal to each gene were amplified by PCR using primers 1709F8 and 1709R7 ( ygiW ) and 1708F3 and 1708R3 ( firR ) and the Expand high-fidelity PCR kit (Roche).

    Techniques: Mutagenesis, RNA Extraction, Expressing, Quantitative RT-PCR, Incubation

    Characterization of firR mutants in Fe 2+ -responsive induction of ygiW . The expression of ygiW in wild-type 2019, NB004 (Δ firR ), JWJ154 ( firR D51A), and KHS2 ( firR + ) was measured by qRT-PCR. Expression of each gene was measured by qRT-PCR and compared to the expression of each gene in cultures grown without the addition of exogenous FeCl 2 . The data presented are means and standard deviations from two experiments, each performed in triplicate.

    Journal: Journal of Bacteriology

    Article Title: Characterization of a Ferrous Iron-Responsive Two-Component System in Nontypeable Haemophilus influenzae

    doi: 10.1128/JB.01465-12

    Figure Lengend Snippet: Characterization of firR mutants in Fe 2+ -responsive induction of ygiW . The expression of ygiW in wild-type 2019, NB004 (Δ firR ), JWJ154 ( firR D51A), and KHS2 ( firR + ) was measured by qRT-PCR. Expression of each gene was measured by qRT-PCR and compared to the expression of each gene in cultures grown without the addition of exogenous FeCl 2 . The data presented are means and standard deviations from two experiments, each performed in triplicate.

    Article Snippet: For probe synthesis, DNA fragments internal to each gene were amplified by PCR using primers 1709F8 and 1709R7 ( ygiW ) and 1708F3 and 1708R3 ( firR ) and the Expand high-fidelity PCR kit (Roche).

    Techniques: Expressing, Quantitative RT-PCR

    Gene targeting strategy and verification. (A) An outline of the murine tau gene (around exon 9–11) is shown, as well as the targeting construct and the modified murine tau gene which was generated by homologous recombination. The null allele, lacking exon 10, was generated by breeding mice harbouring the modified murine tau gene with pgk-CRE transgenic mice. (B) Identification of the recombined allele in genomic DNA of embryonic stem cell (ES) clones 33 and 55 by PCR-analyses. Bands of expected sizes, 3.0 kbp (with primers a and b) and 4.0 kbp (with primers c and d) were detected in these clones, but not in ES clones 32 and 54. (C) PCR analysis with primers flanking the deleted chromosomal region (primers e and f). Amplification of genomic DNA from E10+/− mouse (E10) resulted in two distinct bands, a 900 bp band from the endogenous tau gene and a 460 bp band from the null allele. There was only a 900 bp band from the endogenous tau gene in wild-type mouse (wt). Positive (+) and negative (neg) controls for the PCR reactions. Empty lanes (−).

    Journal: BMC Neuroscience

    Article Title: Lack of exon 10 in the murine tau gene results in mild sensorimotor defects with aging

    doi: 10.1186/1471-2202-14-148

    Figure Lengend Snippet: Gene targeting strategy and verification. (A) An outline of the murine tau gene (around exon 9–11) is shown, as well as the targeting construct and the modified murine tau gene which was generated by homologous recombination. The null allele, lacking exon 10, was generated by breeding mice harbouring the modified murine tau gene with pgk-CRE transgenic mice. (B) Identification of the recombined allele in genomic DNA of embryonic stem cell (ES) clones 33 and 55 by PCR-analyses. Bands of expected sizes, 3.0 kbp (with primers a and b) and 4.0 kbp (with primers c and d) were detected in these clones, but not in ES clones 32 and 54. (C) PCR analysis with primers flanking the deleted chromosomal region (primers e and f). Amplification of genomic DNA from E10+/− mouse (E10) resulted in two distinct bands, a 900 bp band from the endogenous tau gene and a 460 bp band from the null allele. There was only a 900 bp band from the endogenous tau gene in wild-type mouse (wt). Positive (+) and negative (neg) controls for the PCR reactions. Empty lanes (−).

    Article Snippet: Gene targeting A 2.2-kbp genomic fragment in intron 9 of the murine tau gene was amplified with genomic DNA from R1 embryonic stem (ES) cells as template using high-fidelity Expand PCR system (Roche, Basel, Switzerland).

    Techniques: Construct, Modification, Generated, Homologous Recombination, Mouse Assay, Transgenic Assay, Polymerase Chain Reaction, Clone Assay, Amplification

    Transcript levels of cat in B. burgdorferi B31-A3 as measured by QRT-PCR. All values have been normalized to the internal control, flaB . Error bars represent standard deviation A. cat transcripts levels were measured in B. burgdorferi A3 harbouring cat reporter plasmids pMB313 (rpoSP 313 fragment), pMB92S (rposP 92S fragment) and pBCAT (vector control) at a cell density of 2 × 10 8 cells ml −1 . Fold changes are relative to the vector control strain. B. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) at varying cell densities. Fold changes are relative to the 2 × 10 7 spirochetes ml −1 culture. C. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) following an increase in growth temperature from 23°C to 34°C. Fold changes are relative to the inoculums used at t = 0 h.

    Journal: Molecular Microbiology

    Article Title: Insights into the complex regulation of rpoS in Borrelia burgdorferi

    doi: 10.1111/j.1365-2958.2007.05813.x

    Figure Lengend Snippet: Transcript levels of cat in B. burgdorferi B31-A3 as measured by QRT-PCR. All values have been normalized to the internal control, flaB . Error bars represent standard deviation A. cat transcripts levels were measured in B. burgdorferi A3 harbouring cat reporter plasmids pMB313 (rpoSP 313 fragment), pMB92S (rposP 92S fragment) and pBCAT (vector control) at a cell density of 2 × 10 8 cells ml −1 . Fold changes are relative to the vector control strain. B. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) at varying cell densities. Fold changes are relative to the 2 × 10 7 spirochetes ml −1 culture. C. cat transcripts levels were measured in B. burgdorferi B31-A3 harbouring cat reporter plasmids pMB313 (hatched bars) and pMB92S (black bars) following an increase in growth temperature from 23°C to 34°C. Fold changes are relative to the inoculums used at t = 0 h.

    Article Snippet: Polymerase chain reaction, RT-PCR, QRT-PCR and DNA mobility-shift assays Polymerase chain reactions were performed using the Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN) as per the manufacturer's instructions.

    Techniques: Quantitative RT-PCR, Standard Deviation, Plasmid Preparation

    Quantitative RT-PCR analysis of rpoS and ospC transcripts and immunoblot analysis of RpoS and OspC as cell density increases RNA was extracted from B. burgdorferi strains B31-A3 (grey bars), A3 ntrA (black bars) and A3 hk2 (white bars) as spirochete density increased and transcripts were quantified using specific primers and probes with the Taqman system. Values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS as cell density increased. Fold changes are expressed relative to the initial inoculum. B. QRT-PCR analysis of ospC as cell density increased. Fold changes are expressed relative to the initial inoculum. C. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 ntrA relative to B31-A3. Fold changes are expressed compared with B31-A3 at corresponding cell densities. D. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 hk2 relative to B31-A3. Fold changes are expressed compared to the B31-A3 at corresponding cell densities. E. Immunoblot analysis of RpoS and OspC levels in B. burgdorferi strains B31-A3, A3 ntrA and A3 hk2 as cell density increased. Whole-cell lysates of B. burgdorferi strains equivalent to approximately 8 × 10 7 −1 × 10 8 cells were separated on 12% Tris-glycine gels, immobilized on nitrocellulose membranes and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples. Cell densities are indicated at the top of each lane, and positive controls for the A3 ntrA samples are indicated by a plus sign (+).

    Journal: Molecular Microbiology

    Article Title: Insights into the complex regulation of rpoS in Borrelia burgdorferi

    doi: 10.1111/j.1365-2958.2007.05813.x

    Figure Lengend Snippet: Quantitative RT-PCR analysis of rpoS and ospC transcripts and immunoblot analysis of RpoS and OspC as cell density increases RNA was extracted from B. burgdorferi strains B31-A3 (grey bars), A3 ntrA (black bars) and A3 hk2 (white bars) as spirochete density increased and transcripts were quantified using specific primers and probes with the Taqman system. Values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS as cell density increased. Fold changes are expressed relative to the initial inoculum. B. QRT-PCR analysis of ospC as cell density increased. Fold changes are expressed relative to the initial inoculum. C. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 ntrA relative to B31-A3. Fold changes are expressed compared with B31-A3 at corresponding cell densities. D. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 hk2 relative to B31-A3. Fold changes are expressed compared to the B31-A3 at corresponding cell densities. E. Immunoblot analysis of RpoS and OspC levels in B. burgdorferi strains B31-A3, A3 ntrA and A3 hk2 as cell density increased. Whole-cell lysates of B. burgdorferi strains equivalent to approximately 8 × 10 7 −1 × 10 8 cells were separated on 12% Tris-glycine gels, immobilized on nitrocellulose membranes and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples. Cell densities are indicated at the top of each lane, and positive controls for the A3 ntrA samples are indicated by a plus sign (+).

    Article Snippet: Polymerase chain reaction, RT-PCR, QRT-PCR and DNA mobility-shift assays Polymerase chain reactions were performed using the Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN) as per the manufacturer's instructions.

    Techniques: Quantitative RT-PCR, Standard Deviation

    Transcript levels of cat in B. burgdorferi A3 ntrA and A3 hk2 as measured by QRT-PCR. cat transcripts levels were measured in B. burgdorferi A3 hk2 and A3 ntrA harbouring plasmids pMB313 (hatched bars) and pMB92S (black bars). Fold changes are relative to strains harbouring pBCAT. All values have been normalized to the internal control, flaB . Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation.

    Journal: Molecular Microbiology

    Article Title: Insights into the complex regulation of rpoS in Borrelia burgdorferi

    doi: 10.1111/j.1365-2958.2007.05813.x

    Figure Lengend Snippet: Transcript levels of cat in B. burgdorferi A3 ntrA and A3 hk2 as measured by QRT-PCR. cat transcripts levels were measured in B. burgdorferi A3 hk2 and A3 ntrA harbouring plasmids pMB313 (hatched bars) and pMB92S (black bars). Fold changes are relative to strains harbouring pBCAT. All values have been normalized to the internal control, flaB . Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation.

    Article Snippet: Polymerase chain reaction, RT-PCR, QRT-PCR and DNA mobility-shift assays Polymerase chain reactions were performed using the Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN) as per the manufacturer's instructions.

    Techniques: Quantitative RT-PCR, Standard Deviation

    Construction of a B. burgdorferi hk2 mutant A. Schematic representation for inactivation of hk2 in B31-A3. hk2 and rrp2 are represented by black arrows as labelled. A DNA fragment harbouring hk2 was PCR amplified using hk2-BF and hk2-BR primers and insertionally disrupted at a unique SphI site with a kanamycin cassette (grey arrow) as described in the Experimental procedures section. Primers are denoted by short black arrows. B. Agarose gel patterns of PCR products for B31-A3 (lane 2) and A3 hk2 (lane 3) using the hk2-BF and hk2-BR primer pair. Disruption of hk2 by the kanamycin cassette resulted in an increased size PCR product (compare lanes 2 and 3). PCR products for the hk2-BF and kan5′ primer pair (lane 4), and the hk2-BR and kan3′ primer pair (lane 5), confirmed the orientation of the kanamycin cassette with respect to hk2 and rrp2 as diagrammed in panel A. RT-PCR analysis with the rrp2-RTF and rrp2-RTR primer pair confirmed the presence of rrp2 transcript in both B31-A3 (lane 6) and A3 hk2 (lane 7). Lane 1 contains DNA markers with the sizes indicated to the left. C. Immunoblot analysis of B31-A3, A3 ntrA and A3 hk2 grown to high cell density (2 × 10 8 cells ml −1 + 24 h). Whole-cell lysates of B. burgdorferi strains equivalent to ∼10 8 cells were separated on a 12% Tris-glycine gel, immobilized on a nitrocellulose membrane and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples.

    Journal: Molecular Microbiology

    Article Title: Insights into the complex regulation of rpoS in Borrelia burgdorferi

    doi: 10.1111/j.1365-2958.2007.05813.x

    Figure Lengend Snippet: Construction of a B. burgdorferi hk2 mutant A. Schematic representation for inactivation of hk2 in B31-A3. hk2 and rrp2 are represented by black arrows as labelled. A DNA fragment harbouring hk2 was PCR amplified using hk2-BF and hk2-BR primers and insertionally disrupted at a unique SphI site with a kanamycin cassette (grey arrow) as described in the Experimental procedures section. Primers are denoted by short black arrows. B. Agarose gel patterns of PCR products for B31-A3 (lane 2) and A3 hk2 (lane 3) using the hk2-BF and hk2-BR primer pair. Disruption of hk2 by the kanamycin cassette resulted in an increased size PCR product (compare lanes 2 and 3). PCR products for the hk2-BF and kan5′ primer pair (lane 4), and the hk2-BR and kan3′ primer pair (lane 5), confirmed the orientation of the kanamycin cassette with respect to hk2 and rrp2 as diagrammed in panel A. RT-PCR analysis with the rrp2-RTF and rrp2-RTR primer pair confirmed the presence of rrp2 transcript in both B31-A3 (lane 6) and A3 hk2 (lane 7). Lane 1 contains DNA markers with the sizes indicated to the left. C. Immunoblot analysis of B31-A3, A3 ntrA and A3 hk2 grown to high cell density (2 × 10 8 cells ml −1 + 24 h). Whole-cell lysates of B. burgdorferi strains equivalent to ∼10 8 cells were separated on a 12% Tris-glycine gel, immobilized on a nitrocellulose membrane and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples.

    Article Snippet: Polymerase chain reaction, RT-PCR, QRT-PCR and DNA mobility-shift assays Polymerase chain reactions were performed using the Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN) as per the manufacturer's instructions.

    Techniques: Mutagenesis, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction

    Quantitative RT-PCR analysis of rpoS and ospC transcripts and immunoblot analysis of RpoS and OspC following an increase in growth temperature from 23°C to 34°C. RNA was extracted from B. burgdorferi strains B31-A3 (grey bars), A3 ntrA (black bars) and A3 hk2 (white bars) grown at 23°C and following a temperature shift to 34°C, and transcripts were quantified using specific primers and probes with the Taqman system. Values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS following a temperature shift. Fold changes are expressed relative to spirochetes grown at 23°C. B. QRT-PCR analysis of ospC following a temperature shift. Fold changes are expressed relative to spirochetes grown at 23°C. C. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 ntrA relative to B31-A3. Fold changes are expressed compared with the B31-A3 at corresponding time points. D. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 hk2 relative to B31-A3. Fold changes are expressed compared with the B31-A3 at corresponding time points. E. Growth curves of B31-A3 (grey triangles), A3 ntrA (black diamonds) and A3 hk2 (open circles) following a temperature shift from 23°C to 34°C. F. Immunoblot analysis of RpoS and OspC levels in B. burgdorferi strains B31-A3, A3 ntrA and A3 hk2 following an increase in growth temperature from 23°C to 34°C. Whole-cell lysates of B. burgdorferi strains equivalent to approximately 8 × 10 7 −1 × 10 8 cells were separated on 12% Tris-glycine gels, immobilized on nitrocellulose membranes and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples. Time points are indicated at the top of each lane, and positive controls for the A3 ntrA samples are indicated by a plus sign (+).

    Journal: Molecular Microbiology

    Article Title: Insights into the complex regulation of rpoS in Borrelia burgdorferi

    doi: 10.1111/j.1365-2958.2007.05813.x

    Figure Lengend Snippet: Quantitative RT-PCR analysis of rpoS and ospC transcripts and immunoblot analysis of RpoS and OspC following an increase in growth temperature from 23°C to 34°C. RNA was extracted from B. burgdorferi strains B31-A3 (grey bars), A3 ntrA (black bars) and A3 hk2 (white bars) grown at 23°C and following a temperature shift to 34°C, and transcripts were quantified using specific primers and probes with the Taqman system. Values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS following a temperature shift. Fold changes are expressed relative to spirochetes grown at 23°C. B. QRT-PCR analysis of ospC following a temperature shift. Fold changes are expressed relative to spirochetes grown at 23°C. C. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 ntrA relative to B31-A3. Fold changes are expressed compared with the B31-A3 at corresponding time points. D. QRT-PCR analysis of rpoS (hatched bars) and ospC (black bars) transcripts in A3 hk2 relative to B31-A3. Fold changes are expressed compared with the B31-A3 at corresponding time points. E. Growth curves of B31-A3 (grey triangles), A3 ntrA (black diamonds) and A3 hk2 (open circles) following a temperature shift from 23°C to 34°C. F. Immunoblot analysis of RpoS and OspC levels in B. burgdorferi strains B31-A3, A3 ntrA and A3 hk2 following an increase in growth temperature from 23°C to 34°C. Whole-cell lysates of B. burgdorferi strains equivalent to approximately 8 × 10 7 −1 × 10 8 cells were separated on 12% Tris-glycine gels, immobilized on nitrocellulose membranes and probed with antiserum specific for the antigens indicated on the left. FlaB serves as a loading control to demonstrate equivalent protein amounts between samples. Time points are indicated at the top of each lane, and positive controls for the A3 ntrA samples are indicated by a plus sign (+).

    Article Snippet: Polymerase chain reaction, RT-PCR, QRT-PCR and DNA mobility-shift assays Polymerase chain reactions were performed using the Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN) as per the manufacturer's instructions.

    Techniques: Quantitative RT-PCR, Standard Deviation

    Quantitative RT-PCR analysis of rpoS and ospC transcripts following an increase in growth temperature from 23°C to 34°C. RNA was extracted from B. burgdorferi strains B31-A3 (low-passage, white bars) and B31-A (high-passage, black bars) grown at 23°C, and at various time points following a temperature shift to 34°C. Levels of transcripts were measured with specific primer/probe sets using Taqman, and values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Fold changes are expressed relative to spirochetes grown at 23°C. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS following a temperature shift. B. QRT-PCR analysis of ospC following a temperature shift. C. Growth curves of B31-A3 (white squares) and B31-A (black triangles) following a temperature shift from 23 to 34°C.

    Journal: Molecular Microbiology

    Article Title: Insights into the complex regulation of rpoS in Borrelia burgdorferi

    doi: 10.1111/j.1365-2958.2007.05813.x

    Figure Lengend Snippet: Quantitative RT-PCR analysis of rpoS and ospC transcripts following an increase in growth temperature from 23°C to 34°C. RNA was extracted from B. burgdorferi strains B31-A3 (low-passage, white bars) and B31-A (high-passage, black bars) grown at 23°C, and at various time points following a temperature shift to 34°C. Levels of transcripts were measured with specific primer/probe sets using Taqman, and values have been normalized to the internal control, flaB. Data presented represents averages of three assays performed in quadruplicate. Fold changes are expressed relative to spirochetes grown at 23°C. Error bars represent standard deviation. A. QRT-PCR analysis of rpoS following a temperature shift. B. QRT-PCR analysis of ospC following a temperature shift. C. Growth curves of B31-A3 (white squares) and B31-A (black triangles) following a temperature shift from 23 to 34°C.

    Article Snippet: Polymerase chain reaction, RT-PCR, QRT-PCR and DNA mobility-shift assays Polymerase chain reactions were performed using the Expand High Fidelity PCR System (Roche Applied Science, Indianapolis, IN) as per the manufacturer's instructions.

    Techniques: Quantitative RT-PCR, Standard Deviation

    PCR amplification of fnr region from different MG1655 isolates. The fnr region was amplified from the CGSC isolate of MG1655 (CGSC 6300; lane 1) and the isolate obtained from M. Singer and C. Gross (NCM3430; lane 2) (see Materials and Methods). The sizes of the molecular standards in lane 3 are noted to the right. The genes deleted in the CGSC isolate (b1332 to b1344) are, respectively, ynaJ (open reading frame conserved in E. coli and Salmonella enterica ), uspE ( ydaA ), fnr (Crp family activator of anaerobic respiratory gene transcription), ogt ( O -6-alkylguanine-DNA/cysteine-protein methyltransferase), abgT ( ydaH ; p ), abgB ( ydaI ; p ), abgA ( ydaJ ; p ), abgR ( ydaK ; p ), ydaL (open reading frame conserved in enterobacteria), ydaM (open reading frame conserved in E. coli ), ydaN (open reading frame conserved in enterobacteria), dbpA (ATP-dependent RNA helicase), and ydaO (open reading frame conserved in enterobacteria). The deletion is flanked by tns5_4 (b1331), which codes for IS 5 transposase, and ydaP (b1345), a rac prophage which codes for a putative prophage integrase.

    Journal: Journal of Bacteriology

    Article Title: Physiological Studies of Escherichia coli Strain MG1655: Growth Defects and Apparent Cross-Regulation of Gene Expression

    doi: 10.1128/JB.185.18.5611-5626.2003

    Figure Lengend Snippet: PCR amplification of fnr region from different MG1655 isolates. The fnr region was amplified from the CGSC isolate of MG1655 (CGSC 6300; lane 1) and the isolate obtained from M. Singer and C. Gross (NCM3430; lane 2) (see Materials and Methods). The sizes of the molecular standards in lane 3 are noted to the right. The genes deleted in the CGSC isolate (b1332 to b1344) are, respectively, ynaJ (open reading frame conserved in E. coli and Salmonella enterica ), uspE ( ydaA ), fnr (Crp family activator of anaerobic respiratory gene transcription), ogt ( O -6-alkylguanine-DNA/cysteine-protein methyltransferase), abgT ( ydaH ; p ), abgB ( ydaI ; p ), abgA ( ydaJ ; p ), abgR ( ydaK ; p ), ydaL (open reading frame conserved in enterobacteria), ydaM (open reading frame conserved in E. coli ), ydaN (open reading frame conserved in enterobacteria), dbpA (ATP-dependent RNA helicase), and ydaO (open reading frame conserved in enterobacteria). The deletion is flanked by tns5_4 (b1331), which codes for IS 5 transposase, and ydaP (b1345), a rac prophage which codes for a putative prophage integrase.

    Article Snippet: Strain NCM3467 (Δ ycjT ::Kanr ) which carries a deletion of 686 bp of the ycjT gene (,2267 bp total; deletion starts 544 bp downstream of the translational start codon) and an insertion of a kanamycin resistance cassette, used for selection, was obtained from the recD strain NCM3426 (see Table ) by the following steps. (i) The ycjT gene with flanking sequences of the ycjS and ycjU genes was amplified from strain MG1655 (CGSC 6300) with primers ycjT1 (5′-ACTAAGCTTAGATCCTGCCCAGGCGTACC) and ycjT2 (5′-AGTTCTAGAGCCAGAAGGCCGATAACCGC) and the Expand high-fidelity PCR system (Boehringer Mannheim-Roche).

    Techniques: Polymerase Chain Reaction, Amplification

    Results of PCR amplification (a) Result of RNA isolation. Lane 1: 100 bp DNA ladder;Lane 2: total RNA. (b, c) Result of PCR using cDNA as template. (b) Lane 1: 100 bp DNA ladder; Lane 2: PCR product which indicates gene segments of about 200, 350,and 700 bp. (c) Lane 1: purified PCR product of about 700 bp; Lane 2: 100 bp DNA ladder

    Journal: Journal of Zhejiang University. Science. B

    Article Title: Developing antibodies from cholinesterase derived from prokaryotic expression and testing their feasibility for detecting immunogen content in Daphnia magna *

    doi: 10.1631/jzus.B1500008

    Figure Lengend Snippet: Results of PCR amplification (a) Result of RNA isolation. Lane 1: 100 bp DNA ladder;Lane 2: total RNA. (b, c) Result of PCR using cDNA as template. (b) Lane 1: 100 bp DNA ladder; Lane 2: PCR product which indicates gene segments of about 200, 350,and 700 bp. (c) Lane 1: purified PCR product of about 700 bp; Lane 2: 100 bp DNA ladder

    Article Snippet: The pMD19-T vector, PET-29a(+) plasmid, Expand High Fidelity PCR system, HisTALON™ Gravity Columns Purification Kit, DNA Recovery Kit, and all of the restriction enzymes were purchased from TaKaRa (Dalian, China).

    Techniques: Polymerase Chain Reaction, Amplification, Isolation, Purification

    Identification of the recombinant plasmid pET-29a(+)- ChE by PCR (a) and by restriction enzyme EcoR I and Sal I (b) (a) Lanes 1 and 2: result of PCR amplification using trans-fected cells as template; Lane 3: 100 bp DNA Ladder.(b) Lane 1: digested pET-29a(+)- ChE by EcoR I and Sal I;Lane 2: 250 bp DNA ladder marker

    Journal: Journal of Zhejiang University. Science. B

    Article Title: Developing antibodies from cholinesterase derived from prokaryotic expression and testing their feasibility for detecting immunogen content in Daphnia magna *

    doi: 10.1631/jzus.B1500008

    Figure Lengend Snippet: Identification of the recombinant plasmid pET-29a(+)- ChE by PCR (a) and by restriction enzyme EcoR I and Sal I (b) (a) Lanes 1 and 2: result of PCR amplification using trans-fected cells as template; Lane 3: 100 bp DNA Ladder.(b) Lane 1: digested pET-29a(+)- ChE by EcoR I and Sal I;Lane 2: 250 bp DNA ladder marker

    Article Snippet: The pMD19-T vector, PET-29a(+) plasmid, Expand High Fidelity PCR system, HisTALON™ Gravity Columns Purification Kit, DNA Recovery Kit, and all of the restriction enzymes were purchased from TaKaRa (Dalian, China).

    Techniques: Recombinant, Plasmid Preparation, Positron Emission Tomography, Polymerase Chain Reaction, Amplification, Marker