exonuclease iii Promega Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher superscript iii reverse transcriptase
    Next-generation sequencing (NGS) analysis of RNAs present within wild-type or HA(−)virions. a SDS-PAGE of purified wild-type and HA(−) virions treated with or without dithiothreitol (DTT) followed by Oriole staining. MW molecular weight marker. b Read coverage over the influenza virus genome. RNAs were extracted from purified virions and subjected to NGS analysis. Read sets from the wild-type and HA(−) viruses were mapped onto the influenza A virus genome and 18S and 28S rRNA sequences. Coverage depth is indicated as a ratio (coverage depth per nucleotide/total nucleotides read). The read sets of wild-type and HA(−) viruses are shown in the upper and lower columns, respectively. Nucleotide positions are indicated in the cRNA-sense for each <t>vRNA.</t> c An equal amount (5 ng) of RNA was subjected to northern blot analysis. The HA, NA, and NS vRNAs, 18S rRNA, and <t>three</t> different 28S rRNA (representing nucleotide positions 1081–2042, 3541–4679, and 1081–4679) specific riboprobes were used for detection. Intracellular RNAs from uninfected MDCK cells were used as a control. d Purified wild-type virions, HA(−) virions, and cell lysates were subjected to western blot analysis using anti-RPS3, anti-RPS5, and anti-RPSL7 antibodies and an anti-whole influenza virion polyclonal antibody
    Superscript Iii Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 90401 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 90401 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    Promega rq1 rnase free dnase
    Nuclear IQGAP1 participates in RNPs together with a large number of RNA-processing factors in gastric cancer cell lines. (A) Network of protein interactions generated from the proteins that were pulled down by anti-IQGAP1 from nuclear extracts of NUGC4 cells classified as spliceosomal components. The network was generated using the igraph R package. Colours represent classes of spliceosomal components according to SpliceosomeDB ( Cvitkovic and Jurica, 2013 ). Vertices are scaled according to P values and ordered according to known spliceosomal complexes. (B) Validation of representative IQGAP1-interacting partners presented in ( A ). Anti-IQGAP1 or control IgG pull down from nuclear extracts of NUGC4 and MKN45 cells were immunoprobed against IQGAP1, hnRNPA1, hnRNPA2/B1, hnRNPC1/C2, hnRNPL and DHX9/RHA. The immunoprecipitated proteins were compared to 1/70 th of the input used in the pull down. Where indicated, <t>RNase</t> A was added in the pull down for 30 min. Numbers indicate MW in kDa. (C) Subcellular distribution of hnRNPM and IQGAP1. MKN45 and NUGC4 cells were subjected to subcellular fractionation as described in Online Methods. Equal amounts of the resulting cytosolic and soluble nuclear fractions as well as the insoluble nuclear material were analysed by Western blot for the presence of IQGAP1, hnRNPM, hnRNPA2/B1 and SRSF1. Lamin b1 and β-actin were used as fractionation and loading controls, respectively. Numbers indicate MW in kDa. (D) Subnuclear distribution of hnRNPM and IQGAP1. Soluble and High Molecular Weight (HMW) nuclear extracts from MKN45 cells were prepared as described in Online Methods. Protein complexes from the HMW fraction were released after treatment with <t>DNase</t> (D) or RNase (R). Equal amounts of all fractions were analyzed by Western blot for the presence of IQGAP1, hnRNPM, hnRNPK/J, hnRNPC1/C2 and SF3B3. Numbers indicate MW in kDa.
    Rq1 Rnase Free Dnase, supplied by Promega, used in various techniques. Bioz Stars score: 94/100, based on 16584 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rq1 rnase free dnase/product/Promega
    Average 94 stars, based on 16584 article reviews
    Price from $9.99 to $1999.99
    rq1 rnase free dnase - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript iii
    Analysis of ribosome assembly in L20-interacting <t>RNA</t> recombinant strains. Primer extension analysis of 16S rRNA ( A ) and 23S rRNA ( B ) from L20-interacting RNA recombinant strains grown to log phase in 2XYT at 37°C ( left ) and 15°C ( right ). Asterisks (*) indicate regions in which mutant recombinant strain rRNA processing differs from that of the wild-type recombinant strain. Primer extension analysis was conducted with RNA extracted from <t>three</t> or more independent biological replicates of each strain grown to log phase at both 37°C and 15°C. Representative gels are shown. ( C ) Ribosome sedimentation profiles of L20-interacting RNA recombinant strains grown at 15°C. Cells were grown in 2XYT at 15°C with shaking (225 rpm) until an OD 600 ∼ 0.3–0.4 was reached. Ribosomal subunit sedimentation profiles were resolved by 10%–55% (w/v) sucrose density gradients. Arrows indicate peaks that are present in the profiles of the regulatory mutant recombinant strains, but not in those of the control strains.
    Superscript Iii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 55876 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii/product/Thermo Fisher
    Average 99 stars, based on 55876 article reviews
    Price from $9.99 to $1999.99
    superscript iii - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher trizol reagent
    NRIP is involved in the CUL-DDB1 E3 ligase mechanism by interacting with DDB1 and associating with the DDB1-CUL4 complex through its DxR motif A . NRIP is involved in the CUL4A-DDB1 complex. His-MBP and His-MBP-NRIP were expressed from bacteria and purified using Ni-NTA beads. The beads conjugated with recombinant proteins were incubated with the lysates of HeLa cells and the co-purified proteins were separated by SDS-PAGE and analyzed by Coomassie blue staining (upper panel) or western blotting (lower panel) using the antibodies indicated. B . The interaction between NRIP and DDB1. Calcium phosphate was used to transfect 293T cells with NRIP-FLAG and HA-DDB1 plasmids. Cell lysates were collected 48 h after transfection and immunoprecipitated with anti-FLAG or anti-HA antibodies for detection of NRIP or DDB1, respectively. C . A schematic depiction of the protein DxR motif of NRIP. Aspartic acids at 173 and 223 in the regions bounded by amino acid residues 166 to 179 and 216 to 229 were replaced by alanine using site-directed mutagenesis and named NRIP-DM. D . NRIP-DM lost DDB1 binding. 293T cells were cotransfected with the wild-type NRIP or NRIP-DM mutant with HA-DDB1, cell lysates were extracted and immunoprecipitated with anti-HA antibodies for detection of DDB1 and immunoblotted with anti-FLAG for detection of NRIP and NRIP-DM. E . NRIP-DM interacted with AR. After cotransfection of 293T cells with FLAG-tagged NRIP-DM and AR, cell extracts were subjected to immunoprecipitation with anti-FLAG or anti-AR antibodies and the immunoprecipitated proteins analyzed by western blotting using anti-AR or anti-FLAG antibodies, reciprocally. The loading of the cell extracts represents 10% of the input used for immunoprecipitation to assess comparable protein levels. F . AR protein stabilization was independent of NRIP and DDB1 interaction. LNCap cells were transfected with NRIP-FLAG, NRIP-DM-FLAG, and GFP, respectively. After 24 h, cells were treated with 10 nM DHT for 24 h. Proteins and RNAs were extracted by RIPA and <t>Trizol</t> reagent, respectively. The protein expression of NRIP and AR was detected by western blot analysis with anti-FLAG and anti-AR primary antibodies. The expression of PSA was detected by <t>RT-PCR.</t> GAPDH was used as a loading control.
    Trizol Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 635164 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trizol reagent/product/Thermo Fisher
    Average 99 stars, based on 635164 article reviews
    Price from $9.99 to $1999.99
    trizol reagent - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher total rna
    Changes in expression levels of mRNAs in <t>BMMs</t> by treatment with R848. Mouse BMMs were cultured in the presence or absence of R848 (100 nM) for 24 h, then total <t>RNA</t> was extracted from the BMMs. The expression levels of mRNAs (TLR7, IL-12,
    Total Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 475535 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/total rna/product/Thermo Fisher
    Average 99 stars, based on 475535 article reviews
    Price from $9.99 to $1999.99
    total rna - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    Promega dnase i
    DdrC protects DNA against degradation by nucleases. Protection of supercoiled pBR322 plasmid (3.5 nM) from <t>DNase</t> I activity (0.1 U) (panel a), linear pBR322 (3.5 nM) from Exonuclease III activity (200 U) (panel b) and phiX174 ssDNA (5.9 nM) from Mung Bean Nuclease activity (1 U) (panel c) by 7 μM, 7 μM, and 2 μM DdrC, respectively. Lanes C: DNA controls without protein. Lanes 1: DNA incubation with nuclease alone. Lanes 2: DNA incubation with DdrC alone. Lanes 3: DNA pre-incubated with DdrC 15 min at 4°C before addition of nuclease. Lanes 4: Reaction products corresponding to lane 3 were further treated with Proteinase K/SDS. Panel a, lane 5: DdrC and DNase I were simultaneously incubated with supercoiled DNA before treatment with Proteinase K/SDS.
    Dnase I, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 14080 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i/product/Promega
    Average 92 stars, based on 14080 article reviews
    Price from $9.99 to $1999.99
    dnase i - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    99
    Qiagen rneasy mini kit
    DdrC protects DNA against degradation by nucleases. Protection of supercoiled pBR322 plasmid (3.5 nM) from <t>DNase</t> I activity (0.1 U) (panel a), linear pBR322 (3.5 nM) from Exonuclease III activity (200 U) (panel b) and phiX174 ssDNA (5.9 nM) from Mung Bean Nuclease activity (1 U) (panel c) by 7 μM, 7 μM, and 2 μM DdrC, respectively. Lanes C: DNA controls without protein. Lanes 1: DNA incubation with nuclease alone. Lanes 2: DNA incubation with DdrC alone. Lanes 3: DNA pre-incubated with DdrC 15 min at 4°C before addition of nuclease. Lanes 4: Reaction products corresponding to lane 3 were further treated with Proteinase K/SDS. Panel a, lane 5: DdrC and DNase I were simultaneously incubated with supercoiled DNA before treatment with Proteinase K/SDS.
    Rneasy Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 343576 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy mini kit/product/Qiagen
    Average 99 stars, based on 343576 article reviews
    Price from $9.99 to $1999.99
    rneasy mini kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    Promega rnase free dnase
    DdrC protects DNA against degradation by nucleases. Protection of supercoiled pBR322 plasmid (3.5 nM) from <t>DNase</t> I activity (0.1 U) (panel a), linear pBR322 (3.5 nM) from Exonuclease III activity (200 U) (panel b) and phiX174 ssDNA (5.9 nM) from Mung Bean Nuclease activity (1 U) (panel c) by 7 μM, 7 μM, and 2 μM DdrC, respectively. Lanes C: DNA controls without protein. Lanes 1: DNA incubation with nuclease alone. Lanes 2: DNA incubation with DdrC alone. Lanes 3: DNA pre-incubated with DdrC 15 min at 4°C before addition of nuclease. Lanes 4: Reaction products corresponding to lane 3 were further treated with Proteinase K/SDS. Panel a, lane 5: DdrC and DNase I were simultaneously incubated with supercoiled DNA before treatment with Proteinase K/SDS.
    Rnase Free Dnase, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 8780 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free dnase/product/Promega
    Average 92 stars, based on 8780 article reviews
    Price from $9.99 to $1999.99
    rnase free dnase - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Promega dnase
    qRT-PCR to determine the relative amount of other RNAs compared with L1 <t>RNA</t> in L1 RNPs. ( A ) Total RNA was isolated from RNPs after transfecting FL-O1F by Trizol extraction and treated with <t>DNAse.</t> cDNA was synthesized using an oligo-dT (12 Ts) primer and
    Dnase, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 8981 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase/product/Promega
    Average 92 stars, based on 8981 article reviews
    Price from $9.99 to $1999.99
    dnase - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    93
    Promega exonuclease iii
    Deletion of the 20q-TERRA locus decreases telomere length and protection in U2OS cells. ( a ) Q-FISH images obtained from metaphases spreads from U2OS cells WT and KO for the Chr20q-TERRA locus (clones A4, B4 and C4). (Left graphs) Frequency graphs of telomere length (a.u.) distribution measured in WT and in the 20q-KO cells (clones A4, B4 and C4) from <t>three</t> independent experiments. The mean telomere length and the number of telomeres and metaphases analyzed is shown. The red lines are arbitrary lines placed in the exact same position in each frequency graph to visualize differences between the 20q-KO clones and the WT controls (right graphs) The mean telomere length, the percentage of short telomeres and the quantification of signal-free ends per metaphase are also represented. Short telomeres are considered those in the 10% percentile of the total telomere length distribution. Total number of metaphases used for the statistical analysis is indicated. Scale bar, 10 μm and (zoom) 1 μm. ( b ) WT and 20q-KO cells were analyzed for T-SCE events with G-rich (green) and C-rich (red) PNA probes. The fraction of chromosome ends with T-SCE obtained from three different experiments was quantified and graphed as the mean values±s.e.m., n =30 metaphases. The number of metaphases analyzed is shown. Only events in which interchange of both colours were quantified (see examples of no-T-SCE and T-SCE). The quantification was carried out by counting the number of events in the same chromosome or in different chromosomes and then normalizing it by the total number of chromosomes observed in each metaphase. Scale bar, 1 μm. ( c ) Quantification of <t>DNA-containing</t> double minute chromosomes (TDMs) in WT and 20q-KO cells from three different experiments (mean values±s.e.m., n =30 metaphases). An example of TDMs is shown. One-way Anova with Dunnett's post test was used for all statistical analysis (* P
    Exonuclease Iii, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 596 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/exonuclease iii/product/Promega
    Average 93 stars, based on 596 article reviews
    Price from $9.99 to $1999.99
    exonuclease iii - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    99
    Qiagen rneasy kit
    Deletion of the 20q-TERRA locus decreases telomere length and protection in U2OS cells. ( a ) Q-FISH images obtained from metaphases spreads from U2OS cells WT and KO for the Chr20q-TERRA locus (clones A4, B4 and C4). (Left graphs) Frequency graphs of telomere length (a.u.) distribution measured in WT and in the 20q-KO cells (clones A4, B4 and C4) from <t>three</t> independent experiments. The mean telomere length and the number of telomeres and metaphases analyzed is shown. The red lines are arbitrary lines placed in the exact same position in each frequency graph to visualize differences between the 20q-KO clones and the WT controls (right graphs) The mean telomere length, the percentage of short telomeres and the quantification of signal-free ends per metaphase are also represented. Short telomeres are considered those in the 10% percentile of the total telomere length distribution. Total number of metaphases used for the statistical analysis is indicated. Scale bar, 10 μm and (zoom) 1 μm. ( b ) WT and 20q-KO cells were analyzed for T-SCE events with G-rich (green) and C-rich (red) PNA probes. The fraction of chromosome ends with T-SCE obtained from three different experiments was quantified and graphed as the mean values±s.e.m., n =30 metaphases. The number of metaphases analyzed is shown. Only events in which interchange of both colours were quantified (see examples of no-T-SCE and T-SCE). The quantification was carried out by counting the number of events in the same chromosome or in different chromosomes and then normalizing it by the total number of chromosomes observed in each metaphase. Scale bar, 1 μm. ( c ) Quantification of <t>DNA-containing</t> double minute chromosomes (TDMs) in WT and 20q-KO cells from three different experiments (mean values±s.e.m., n =30 metaphases). An example of TDMs is shown. One-way Anova with Dunnett's post test was used for all statistical analysis (* P
    Rneasy Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 110557 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy kit/product/Qiagen
    Average 99 stars, based on 110557 article reviews
    Price from $9.99 to $1999.99
    rneasy kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript iv reverse transcriptase
    Deletion of the 20q-TERRA locus decreases telomere length and protection in U2OS cells. ( a ) Q-FISH images obtained from metaphases spreads from U2OS cells WT and KO for the Chr20q-TERRA locus (clones A4, B4 and C4). (Left graphs) Frequency graphs of telomere length (a.u.) distribution measured in WT and in the 20q-KO cells (clones A4, B4 and C4) from <t>three</t> independent experiments. The mean telomere length and the number of telomeres and metaphases analyzed is shown. The red lines are arbitrary lines placed in the exact same position in each frequency graph to visualize differences between the 20q-KO clones and the WT controls (right graphs) The mean telomere length, the percentage of short telomeres and the quantification of signal-free ends per metaphase are also represented. Short telomeres are considered those in the 10% percentile of the total telomere length distribution. Total number of metaphases used for the statistical analysis is indicated. Scale bar, 10 μm and (zoom) 1 μm. ( b ) WT and 20q-KO cells were analyzed for T-SCE events with G-rich (green) and C-rich (red) PNA probes. The fraction of chromosome ends with T-SCE obtained from three different experiments was quantified and graphed as the mean values±s.e.m., n =30 metaphases. The number of metaphases analyzed is shown. Only events in which interchange of both colours were quantified (see examples of no-T-SCE and T-SCE). The quantification was carried out by counting the number of events in the same chromosome or in different chromosomes and then normalizing it by the total number of chromosomes observed in each metaphase. Scale bar, 1 μm. ( c ) Quantification of <t>DNA-containing</t> double minute chromosomes (TDMs) in WT and 20q-KO cells from three different experiments (mean values±s.e.m., n =30 metaphases). An example of TDMs is shown. One-way Anova with Dunnett's post test was used for all statistical analysis (* P
    Superscript Iv Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 3076 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iv reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 3076 article reviews
    Price from $9.99 to $1999.99
    superscript iv reverse transcriptase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher oligo
    Deletion of the 20q-TERRA locus decreases telomere length and protection in U2OS cells. ( a ) Q-FISH images obtained from metaphases spreads from U2OS cells WT and KO for the Chr20q-TERRA locus (clones A4, B4 and C4). (Left graphs) Frequency graphs of telomere length (a.u.) distribution measured in WT and in the 20q-KO cells (clones A4, B4 and C4) from <t>three</t> independent experiments. The mean telomere length and the number of telomeres and metaphases analyzed is shown. The red lines are arbitrary lines placed in the exact same position in each frequency graph to visualize differences between the 20q-KO clones and the WT controls (right graphs) The mean telomere length, the percentage of short telomeres and the quantification of signal-free ends per metaphase are also represented. Short telomeres are considered those in the 10% percentile of the total telomere length distribution. Total number of metaphases used for the statistical analysis is indicated. Scale bar, 10 μm and (zoom) 1 μm. ( b ) WT and 20q-KO cells were analyzed for T-SCE events with G-rich (green) and C-rich (red) PNA probes. The fraction of chromosome ends with T-SCE obtained from three different experiments was quantified and graphed as the mean values±s.e.m., n =30 metaphases. The number of metaphases analyzed is shown. Only events in which interchange of both colours were quantified (see examples of no-T-SCE and T-SCE). The quantification was carried out by counting the number of events in the same chromosome or in different chromosomes and then normalizing it by the total number of chromosomes observed in each metaphase. Scale bar, 1 μm. ( c ) Quantification of <t>DNA-containing</t> double minute chromosomes (TDMs) in WT and 20q-KO cells from three different experiments (mean values±s.e.m., n =30 metaphases). An example of TDMs is shown. One-way Anova with Dunnett's post test was used for all statistical analysis (* P
    Oligo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 33521 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligo/product/Thermo Fisher
    Average 99 stars, based on 33521 article reviews
    Price from $9.99 to $1999.99
    oligo - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    93
    Promega rnasin
    RT–PCR amplification of nifH mRNA from wood-fed P. nigrolineatus GI tract regions. After dissection, RNA was extracted from fore (lane 2), hind (lane 3) and midgut (lane 4) regions, as described in the materials and methods section. RNA (3 μg) was first treated with <t>DNaseI</t> in the presence of <t>RNasin</t> and RT–PCR was carried out using the Superscript III One-Step Platinum Taq high fidelity kit (see Methods). Complementary DNA synthesis was followed by amplification with nifH32 and nifH623 primers and a second round amplification using nifH1 and nifH2 primers as described in the materials and methods section. Reaction products were separated on a 1.5% agarose gel. RNA preparations treated with DNase in the absence of RT and amplifications without DNase and RT treatments are shown. M is a 100 bp ladder; lane 1 is a negative control that did not contain RNA.
    Rnasin, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 22066 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnasin/product/Promega
    Average 93 stars, based on 22066 article reviews
    Price from $9.99 to $1999.99
    rnasin - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript iii kit
    Transcript accumulation of KASI and RAM2 genes. ( A ) Transcript accumulation of DIS , DIS-LIKE, KASI and RAM2 in control (mock) and R. irregularis colonized (AM) roots and in different organs of L. japonicus assessed by <t>qRT-PCR.</t> Expression values were normalized to those of the constitutively expressed gene EF1α ( DIS , DIS-LIKE, KASI) and Ubiquitin10 ( RAM2) . Black circles represent <t>three</t> biological replicates. Different letters indicate significant differences (ANOVA; posthoc Tukey; n = 15; p≤0.05, F 4,14 ( KASI ) = 1.191, F 4,14 ( DIS ) = 8.412, F 4,14 ( DIS-LIKE ) = 4.563; p≤0.001, F 4,14 = 67.41 ( RAM2) ). AM plants were inoculated with R. irregularis. Control and AM plants were harvested 5 wpi. ( B ) Arbuscule phenotype in wild type and dis-like-5 mutant roots after 5 wpi with R. irregularis as indicated by acid ink staining. White arrow heads indicate arbuscules. DOI: http://dx.doi.org/10.7554/eLife.29107.018
    Superscript Iii Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 10244 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii kit/product/Thermo Fisher
    Average 99 stars, based on 10244 article reviews
    Price from $9.99 to $1999.99
    superscript iii kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Promega random primers
    Transcript accumulation of KASI and RAM2 genes. ( A ) Transcript accumulation of DIS , DIS-LIKE, KASI and RAM2 in control (mock) and R. irregularis colonized (AM) roots and in different organs of L. japonicus assessed by <t>qRT-PCR.</t> Expression values were normalized to those of the constitutively expressed gene EF1α ( DIS , DIS-LIKE, KASI) and Ubiquitin10 ( RAM2) . Black circles represent <t>three</t> biological replicates. Different letters indicate significant differences (ANOVA; posthoc Tukey; n = 15; p≤0.05, F 4,14 ( KASI ) = 1.191, F 4,14 ( DIS ) = 8.412, F 4,14 ( DIS-LIKE ) = 4.563; p≤0.001, F 4,14 = 67.41 ( RAM2) ). AM plants were inoculated with R. irregularis. Control and AM plants were harvested 5 wpi. ( B ) Arbuscule phenotype in wild type and dis-like-5 mutant roots after 5 wpi with R. irregularis as indicated by acid ink staining. White arrow heads indicate arbuscules. DOI: http://dx.doi.org/10.7554/eLife.29107.018
    Random Primers, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 6514 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/random primers/product/Promega
    Average 99 stars, based on 6514 article reviews
    Price from $9.99 to $1999.99
    random primers - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher rt pcr
    Transcript accumulation of KASI and RAM2 genes. ( A ) Transcript accumulation of DIS , DIS-LIKE, KASI and RAM2 in control (mock) and R. irregularis colonized (AM) roots and in different organs of L. japonicus assessed by <t>qRT-PCR.</t> Expression values were normalized to those of the constitutively expressed gene EF1α ( DIS , DIS-LIKE, KASI) and Ubiquitin10 ( RAM2) . Black circles represent <t>three</t> biological replicates. Different letters indicate significant differences (ANOVA; posthoc Tukey; n = 15; p≤0.05, F 4,14 ( KASI ) = 1.191, F 4,14 ( DIS ) = 8.412, F 4,14 ( DIS-LIKE ) = 4.563; p≤0.001, F 4,14 = 67.41 ( RAM2) ). AM plants were inoculated with R. irregularis. Control and AM plants were harvested 5 wpi. ( B ) Arbuscule phenotype in wild type and dis-like-5 mutant roots after 5 wpi with R. irregularis as indicated by acid ink staining. White arrow heads indicate arbuscules. DOI: http://dx.doi.org/10.7554/eLife.29107.018
    Rt Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 46664 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rt pcr/product/Thermo Fisher
    Average 99 stars, based on 46664 article reviews
    Price from $9.99 to $1999.99
    rt pcr - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher first strand cdna synthesis
    Small hairpin <t>RNA</t> (shRNA) sequence selection. HEK-293 cells were collected 48 h post transfection, and RNA and protein were extracted. Aldehyde dehydrogenase (ALDH2) <t>cDNA</t> was co-transfected with five different shRNA plasmids (lanes 1–5); scramble and GFP plasmids co-transfection were used as ALDH2 expression control (lanes 6–7). GFP transfection (lane 8) and non-transfected cells (lane9). (A) Semi-quantitative reverse transcription polymerase chain reaction (RT-PCR). ALDH2 expression was determined using primers designed to amplify a 1,460 bp product. Integrity of RNA was determined by amplifying a 425 bp region of the human GAPDH gene and is shown in the bottom panel . (B) Western blot of ALDH2 (56 kDa) and β-actin (42 kDa, bottom panel ) in the HEK-293 cells treated as described above.
    First Strand Cdna Synthesis, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 38206 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/first strand cdna synthesis/product/Thermo Fisher
    Average 99 stars, based on 38206 article reviews
    Price from $9.99 to $1999.99
    first strand cdna synthesis - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Next-generation sequencing (NGS) analysis of RNAs present within wild-type or HA(−)virions. a SDS-PAGE of purified wild-type and HA(−) virions treated with or without dithiothreitol (DTT) followed by Oriole staining. MW molecular weight marker. b Read coverage over the influenza virus genome. RNAs were extracted from purified virions and subjected to NGS analysis. Read sets from the wild-type and HA(−) viruses were mapped onto the influenza A virus genome and 18S and 28S rRNA sequences. Coverage depth is indicated as a ratio (coverage depth per nucleotide/total nucleotides read). The read sets of wild-type and HA(−) viruses are shown in the upper and lower columns, respectively. Nucleotide positions are indicated in the cRNA-sense for each vRNA. c An equal amount (5 ng) of RNA was subjected to northern blot analysis. The HA, NA, and NS vRNAs, 18S rRNA, and three different 28S rRNA (representing nucleotide positions 1081–2042, 3541–4679, and 1081–4679) specific riboprobes were used for detection. Intracellular RNAs from uninfected MDCK cells were used as a control. d Purified wild-type virions, HA(−) virions, and cell lysates were subjected to western blot analysis using anti-RPS3, anti-RPS5, and anti-RPSL7 antibodies and an anti-whole influenza virion polyclonal antibody

    Journal: Nature Communications

    Article Title: Importance of the 1+7 configuration of ribonucleoprotein complexes for influenza A virus genome packaging

    doi: 10.1038/s41467-017-02517-w

    Figure Lengend Snippet: Next-generation sequencing (NGS) analysis of RNAs present within wild-type or HA(−)virions. a SDS-PAGE of purified wild-type and HA(−) virions treated with or without dithiothreitol (DTT) followed by Oriole staining. MW molecular weight marker. b Read coverage over the influenza virus genome. RNAs were extracted from purified virions and subjected to NGS analysis. Read sets from the wild-type and HA(−) viruses were mapped onto the influenza A virus genome and 18S and 28S rRNA sequences. Coverage depth is indicated as a ratio (coverage depth per nucleotide/total nucleotides read). The read sets of wild-type and HA(−) viruses are shown in the upper and lower columns, respectively. Nucleotide positions are indicated in the cRNA-sense for each vRNA. c An equal amount (5 ng) of RNA was subjected to northern blot analysis. The HA, NA, and NS vRNAs, 18S rRNA, and three different 28S rRNA (representing nucleotide positions 1081–2042, 3541–4679, and 1081–4679) specific riboprobes were used for detection. Intracellular RNAs from uninfected MDCK cells were used as a control. d Purified wild-type virions, HA(−) virions, and cell lysates were subjected to western blot analysis using anti-RPS3, anti-RPS5, and anti-RPSL7 antibodies and an anti-whole influenza virion polyclonal antibody

    Article Snippet: Each vRNA was reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen, Eugene, OR) with a universal primer (a mixture of two primers, AGCAAAAGCAGG and AGCGAAAGCAGG) for all vRNA segments and then PCR-amplified using GoTaq Green Master Mix (Promega, Madison, WI) with strand-specific primers for either the HA (forward primer, AGCAAAAGCAGGGGAAAATAAAAAC; reverse primer, AGTAGAAACAAGGGTGTTTTTCCTT) or NP vRNA segment (forward primer, AGCAAAAGCAGGGTAGATAATCACTC; reverse primer, AGTAGAAACAAGGGTATTTTTCTTT).

    Techniques: Next-Generation Sequencing, SDS Page, Purification, Staining, Molecular Weight, Marker, Northern Blot, Western Blot

    Nuclear IQGAP1 participates in RNPs together with a large number of RNA-processing factors in gastric cancer cell lines. (A) Network of protein interactions generated from the proteins that were pulled down by anti-IQGAP1 from nuclear extracts of NUGC4 cells classified as spliceosomal components. The network was generated using the igraph R package. Colours represent classes of spliceosomal components according to SpliceosomeDB ( Cvitkovic and Jurica, 2013 ). Vertices are scaled according to P values and ordered according to known spliceosomal complexes. (B) Validation of representative IQGAP1-interacting partners presented in ( A ). Anti-IQGAP1 or control IgG pull down from nuclear extracts of NUGC4 and MKN45 cells were immunoprobed against IQGAP1, hnRNPA1, hnRNPA2/B1, hnRNPC1/C2, hnRNPL and DHX9/RHA. The immunoprecipitated proteins were compared to 1/70 th of the input used in the pull down. Where indicated, RNase A was added in the pull down for 30 min. Numbers indicate MW in kDa. (C) Subcellular distribution of hnRNPM and IQGAP1. MKN45 and NUGC4 cells were subjected to subcellular fractionation as described in Online Methods. Equal amounts of the resulting cytosolic and soluble nuclear fractions as well as the insoluble nuclear material were analysed by Western blot for the presence of IQGAP1, hnRNPM, hnRNPA2/B1 and SRSF1. Lamin b1 and β-actin were used as fractionation and loading controls, respectively. Numbers indicate MW in kDa. (D) Subnuclear distribution of hnRNPM and IQGAP1. Soluble and High Molecular Weight (HMW) nuclear extracts from MKN45 cells were prepared as described in Online Methods. Protein complexes from the HMW fraction were released after treatment with DNase (D) or RNase (R). Equal amounts of all fractions were analyzed by Western blot for the presence of IQGAP1, hnRNPM, hnRNPK/J, hnRNPC1/C2 and SF3B3. Numbers indicate MW in kDa.

    Journal: bioRxiv

    Article Title: Nuclear IQGAP1 promotes gastric cancer cell growth by altering the splicing of a cell-cycle regulon in co-operation with hnRNPM

    doi: 10.1101/2020.05.11.089656

    Figure Lengend Snippet: Nuclear IQGAP1 participates in RNPs together with a large number of RNA-processing factors in gastric cancer cell lines. (A) Network of protein interactions generated from the proteins that were pulled down by anti-IQGAP1 from nuclear extracts of NUGC4 cells classified as spliceosomal components. The network was generated using the igraph R package. Colours represent classes of spliceosomal components according to SpliceosomeDB ( Cvitkovic and Jurica, 2013 ). Vertices are scaled according to P values and ordered according to known spliceosomal complexes. (B) Validation of representative IQGAP1-interacting partners presented in ( A ). Anti-IQGAP1 or control IgG pull down from nuclear extracts of NUGC4 and MKN45 cells were immunoprobed against IQGAP1, hnRNPA1, hnRNPA2/B1, hnRNPC1/C2, hnRNPL and DHX9/RHA. The immunoprecipitated proteins were compared to 1/70 th of the input used in the pull down. Where indicated, RNase A was added in the pull down for 30 min. Numbers indicate MW in kDa. (C) Subcellular distribution of hnRNPM and IQGAP1. MKN45 and NUGC4 cells were subjected to subcellular fractionation as described in Online Methods. Equal amounts of the resulting cytosolic and soluble nuclear fractions as well as the insoluble nuclear material were analysed by Western blot for the presence of IQGAP1, hnRNPM, hnRNPA2/B1 and SRSF1. Lamin b1 and β-actin were used as fractionation and loading controls, respectively. Numbers indicate MW in kDa. (D) Subnuclear distribution of hnRNPM and IQGAP1. Soluble and High Molecular Weight (HMW) nuclear extracts from MKN45 cells were prepared as described in Online Methods. Protein complexes from the HMW fraction were released after treatment with DNase (D) or RNase (R). Equal amounts of all fractions were analyzed by Western blot for the presence of IQGAP1, hnRNPM, hnRNPK/J, hnRNPC1/C2 and SF3B3. Numbers indicate MW in kDa.

    Article Snippet: DNA was removed with RQ1 RNase-free DNase (Promega, WI) or DNase I (RNase-free, New England Biolabs, Inc, MA), followed by phenol extraction.

    Techniques: Generated, Immunoprecipitation, Fractionation, Western Blot, Molecular Weight

    Expression analysis of ghr-miR482/miR482.2. A) Northern blot detection of ghr-miR482/482.2 in leaves collected from V. dahliae -infected and mock-treated cotton plants at one day-post-inoculation (1 dpi). Oligos antisense to ghr-miR482a and ghr-miR482e.2 were used together as probes. The values underneath the image are the relative signal intensity of ghr-miR482a/482e.2, which were determined using the MultiGauge V2.0 (Fuji Film) and normalized based on U6. V.d: V. dahliae -infected. B to H) Stem-loop qRT-PCR analysis of the expression level of individual members of the ghr-miR482 family. RQ1 DNase treated total RNA isolated from leaves and roots of 1-dpi plants was analysed using ghr-miR482/miR482.2 member specific stem-loop RT and PCR primers. Expression level was normalized to reference gene Histone 3. Error bars represent standard deviation of the expression ratio. * and ** denote significant relative to the corresponding mock-infected control at p

    Journal: PLoS ONE

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton

    doi: 10.1371/journal.pone.0084390

    Figure Lengend Snippet: Expression analysis of ghr-miR482/miR482.2. A) Northern blot detection of ghr-miR482/482.2 in leaves collected from V. dahliae -infected and mock-treated cotton plants at one day-post-inoculation (1 dpi). Oligos antisense to ghr-miR482a and ghr-miR482e.2 were used together as probes. The values underneath the image are the relative signal intensity of ghr-miR482a/482e.2, which were determined using the MultiGauge V2.0 (Fuji Film) and normalized based on U6. V.d: V. dahliae -infected. B to H) Stem-loop qRT-PCR analysis of the expression level of individual members of the ghr-miR482 family. RQ1 DNase treated total RNA isolated from leaves and roots of 1-dpi plants was analysed using ghr-miR482/miR482.2 member specific stem-loop RT and PCR primers. Expression level was normalized to reference gene Histone 3. Error bars represent standard deviation of the expression ratio. * and ** denote significant relative to the corresponding mock-infected control at p

    Article Snippet: Briefly, reverse transcription was performed using 1 µg of RQ1 DNase (Promega) treated total RNA, random primer or stem-loop RT primer, and SuperScript III reverse transcriptase (Invitrogen).

    Techniques: Expressing, Northern Blot, Infection, Quantitative RT-PCR, Isolation, Polymerase Chain Reaction, Standard Deviation

    Analysis of ribosome assembly in L20-interacting RNA recombinant strains. Primer extension analysis of 16S rRNA ( A ) and 23S rRNA ( B ) from L20-interacting RNA recombinant strains grown to log phase in 2XYT at 37°C ( left ) and 15°C ( right ). Asterisks (*) indicate regions in which mutant recombinant strain rRNA processing differs from that of the wild-type recombinant strain. Primer extension analysis was conducted with RNA extracted from three or more independent biological replicates of each strain grown to log phase at both 37°C and 15°C. Representative gels are shown. ( C ) Ribosome sedimentation profiles of L20-interacting RNA recombinant strains grown at 15°C. Cells were grown in 2XYT at 15°C with shaking (225 rpm) until an OD 600 ∼ 0.3–0.4 was reached. Ribosomal subunit sedimentation profiles were resolved by 10%–55% (w/v) sucrose density gradients. Arrows indicate peaks that are present in the profiles of the regulatory mutant recombinant strains, but not in those of the control strains.

    Journal: RNA

    Article Title: Fitness advantages conferred by the L20-interacting RNA cis-regulator of ribosomal protein synthesis in Bacillus subtilis

    doi: 10.1261/rna.065011.117

    Figure Lengend Snippet: Analysis of ribosome assembly in L20-interacting RNA recombinant strains. Primer extension analysis of 16S rRNA ( A ) and 23S rRNA ( B ) from L20-interacting RNA recombinant strains grown to log phase in 2XYT at 37°C ( left ) and 15°C ( right ). Asterisks (*) indicate regions in which mutant recombinant strain rRNA processing differs from that of the wild-type recombinant strain. Primer extension analysis was conducted with RNA extracted from three or more independent biological replicates of each strain grown to log phase at both 37°C and 15°C. Representative gels are shown. ( C ) Ribosome sedimentation profiles of L20-interacting RNA recombinant strains grown at 15°C. Cells were grown in 2XYT at 15°C with shaking (225 rpm) until an OD 600 ∼ 0.3–0.4 was reached. Ribosomal subunit sedimentation profiles were resolved by 10%–55% (w/v) sucrose density gradients. Arrows indicate peaks that are present in the profiles of the regulatory mutant recombinant strains, but not in those of the control strains.

    Article Snippet: Reverse transcription was performed using the DNase-treated RNA, random hexamer, and SuperScript III according to the manufacturer's protocol (Invitrogen). qPCR was conducted with the resulting cDNA using an ABI 7500 Fast Real-Time PCR system and SYBR green detection (ThermoFisher Scientific). infC operon transcript expression was quantified using primers targeting the rplT coding region and expression of nifU was used as an internal normalization control ( ; ).

    Techniques: Recombinant, Mutagenesis, Sedimentation

    Construction and growth of L20-interacting RNA native locus recombinant strains. ( A ) L20-interacting RNA recombinant strain design. The second infC operon promoter (P infC 2 ), L20-interacting regulatory RNA sequence, and two ∼500 bp regions flanking the promoter and regulatory RNA locus were PCR-amplified from B. subtilis 168 genomic DNA. A PCR product in which an erythromycin resistance cassette ( erm ) was introduced immediately upstream of the second infC operon promoter was generated, subcloned, and transformed into B. subtilis 168. Integration of the PCR constructs at the infC locus via double-crossover homologous recombination replaced the native L20-interacting RNA with a wild-type or mutant recombinant version. Growth curves for each recombinant strain in 2XYT at 37°C ( B ) and 15°C ( C ). Growth assays were performed three or more times for each strain. Representative curves are shown. ( D ) Doubling times (min) of L20-interacting RNA recombinant strains grown in 2XYT at 37°C and 15°C. Values were calculated from log phase OD 600 values and are the mean of three or more independent experimental replicates; ± indicates the standard error of the mean across biological replicates. Numbers in parentheses denote mutant recombinant strain doubling time relative to that of the wild-type recombinant (WT) strain at the corresponding temperature. Asterisks (*) indicate mutant recombinant strains that grew significantly slower than the wild-type recombinant at the corresponding temperature. Daggers (†) indicate mutant recombinant strains that grew significantly faster than the wild-type recombinant at the corresponding temperature ( P

    Journal: RNA

    Article Title: Fitness advantages conferred by the L20-interacting RNA cis-regulator of ribosomal protein synthesis in Bacillus subtilis

    doi: 10.1261/rna.065011.117

    Figure Lengend Snippet: Construction and growth of L20-interacting RNA native locus recombinant strains. ( A ) L20-interacting RNA recombinant strain design. The second infC operon promoter (P infC 2 ), L20-interacting regulatory RNA sequence, and two ∼500 bp regions flanking the promoter and regulatory RNA locus were PCR-amplified from B. subtilis 168 genomic DNA. A PCR product in which an erythromycin resistance cassette ( erm ) was introduced immediately upstream of the second infC operon promoter was generated, subcloned, and transformed into B. subtilis 168. Integration of the PCR constructs at the infC locus via double-crossover homologous recombination replaced the native L20-interacting RNA with a wild-type or mutant recombinant version. Growth curves for each recombinant strain in 2XYT at 37°C ( B ) and 15°C ( C ). Growth assays were performed three or more times for each strain. Representative curves are shown. ( D ) Doubling times (min) of L20-interacting RNA recombinant strains grown in 2XYT at 37°C and 15°C. Values were calculated from log phase OD 600 values and are the mean of three or more independent experimental replicates; ± indicates the standard error of the mean across biological replicates. Numbers in parentheses denote mutant recombinant strain doubling time relative to that of the wild-type recombinant (WT) strain at the corresponding temperature. Asterisks (*) indicate mutant recombinant strains that grew significantly slower than the wild-type recombinant at the corresponding temperature. Daggers (†) indicate mutant recombinant strains that grew significantly faster than the wild-type recombinant at the corresponding temperature ( P

    Article Snippet: Reverse transcription was performed using the DNase-treated RNA, random hexamer, and SuperScript III according to the manufacturer's protocol (Invitrogen). qPCR was conducted with the resulting cDNA using an ABI 7500 Fast Real-Time PCR system and SYBR green detection (ThermoFisher Scientific). infC operon transcript expression was quantified using primers targeting the rplT coding region and expression of nifU was used as an internal normalization control ( ; ).

    Techniques: Recombinant, Sequencing, Polymerase Chain Reaction, Amplification, Generated, Transformation Assay, Construct, Homologous Recombination, Mutagenesis

    Regulatory activity of the B. subtilis L20-interacting RNA mutants examined in this study. ( A ) Secondary structure of the L20-interacting RNA in its protein-bound form with mutations M1–M4. The L20-binding site is in bold. Helix H4 is the rho-independent transcription terminator that forms upon L20 binding. Nucleotides are numbered from the transcript start site from the second infC ). ( B ) β-galactosidase activity (in Miller Units) of the L20-interacting RNA mutant constructs with overexpression of the infC operon or empty plasmid during log phase growth at 37°C. The values reported represent the mean of three or more independent experimental replicates; error bars represent standard error of the mean across biological replicates. ( C ) Fold repression of the L20-interacting RNA reporter constructs derived from the data in B . Fold repression was calculated for each reporter construct as follows: (Mean Miller Units of empty plasmid strain)/(Mean Miller Units of infC operon overexpression strain). Error bars represent standard error of the mean propagated from the values in B ).

    Journal: RNA

    Article Title: Fitness advantages conferred by the L20-interacting RNA cis-regulator of ribosomal protein synthesis in Bacillus subtilis

    doi: 10.1261/rna.065011.117

    Figure Lengend Snippet: Regulatory activity of the B. subtilis L20-interacting RNA mutants examined in this study. ( A ) Secondary structure of the L20-interacting RNA in its protein-bound form with mutations M1–M4. The L20-binding site is in bold. Helix H4 is the rho-independent transcription terminator that forms upon L20 binding. Nucleotides are numbered from the transcript start site from the second infC ). ( B ) β-galactosidase activity (in Miller Units) of the L20-interacting RNA mutant constructs with overexpression of the infC operon or empty plasmid during log phase growth at 37°C. The values reported represent the mean of three or more independent experimental replicates; error bars represent standard error of the mean across biological replicates. ( C ) Fold repression of the L20-interacting RNA reporter constructs derived from the data in B . Fold repression was calculated for each reporter construct as follows: (Mean Miller Units of empty plasmid strain)/(Mean Miller Units of infC operon overexpression strain). Error bars represent standard error of the mean propagated from the values in B ).

    Article Snippet: Reverse transcription was performed using the DNase-treated RNA, random hexamer, and SuperScript III according to the manufacturer's protocol (Invitrogen). qPCR was conducted with the resulting cDNA using an ABI 7500 Fast Real-Time PCR system and SYBR green detection (ThermoFisher Scientific). infC operon transcript expression was quantified using primers targeting the rplT coding region and expression of nifU was used as an internal normalization control ( ; ).

    Techniques: Activity Assay, Binding Assay, Mutagenesis, Construct, Over Expression, Plasmid Preparation, Derivative Assay

    Exl1 activity triggers a plant defence response involving JA, ET and SA pathways in A. thaliana leaves. Normalised RNA expression levels by RT-qPCR of marker genes involved in the biosynthesis of plant defence hormones: jasmonic acid, PDF1.2 (A) and AOS (B) ; ethylene, PR4 (C) ; salicylic acid, PR1 (D) and EDS5 (E) . Expression was analysed 5 min, 1 h and 24 h after buffer (Mock) or 3.7 μM Exl1 infiltration, and again 24 h after a challenge with P. brasiliense (Pb) previously treated with Exl1 for 24 hours. (F) A. thaliana mutants impaired in the synthesis of JA ( jar-1 ) and SA ( NahG and eds5 ) previously treated (for 24 h) with Exl1 fail to confer protection and become more susceptible towards P. brasiliense BF45. Error bars indicate the +/− standard deviations of the average across three independent experiments ( n = 70); no significant differences were determined with a Mann-Whitney test for non-parametric data.

    Journal: Scientific Reports

    Article Title: Expansin-like Exl1 from Pectobacterium is a virulence factor required for host infection, and induces a defence plant response involving ROS, and jasmonate, ethylene and salicylic acid signalling pathways in Arabidopsis thaliana

    doi: 10.1038/s41598-020-64529-9

    Figure Lengend Snippet: Exl1 activity triggers a plant defence response involving JA, ET and SA pathways in A. thaliana leaves. Normalised RNA expression levels by RT-qPCR of marker genes involved in the biosynthesis of plant defence hormones: jasmonic acid, PDF1.2 (A) and AOS (B) ; ethylene, PR4 (C) ; salicylic acid, PR1 (D) and EDS5 (E) . Expression was analysed 5 min, 1 h and 24 h after buffer (Mock) or 3.7 μM Exl1 infiltration, and again 24 h after a challenge with P. brasiliense (Pb) previously treated with Exl1 for 24 hours. (F) A. thaliana mutants impaired in the synthesis of JA ( jar-1 ) and SA ( NahG and eds5 ) previously treated (for 24 h) with Exl1 fail to confer protection and become more susceptible towards P. brasiliense BF45. Error bars indicate the +/− standard deviations of the average across three independent experiments ( n = 70); no significant differences were determined with a Mann-Whitney test for non-parametric data.

    Article Snippet: Contaminant genomic DNA was digested in RNase-free DNase columns (Promega). cDNA was synthesized with 1 μg of RNA using SuperScript III First Strand Synthesis System (Invitrogen).

    Techniques: Activity Assay, RNA Expression, Quantitative RT-PCR, Marker, Expressing, MANN-WHITNEY

    Induced knockdown of Pnn in HCET cells resulted in altered expression of an array of non-coding RNAs, including long-non-coding RNAs. A : Doxycycline-inducible shRNA-mediated PNN knockdown in human corneal epithelial cells led to the altered expression of specific subsets of ncRNAs, including a subset of lncRNAs, along with snRNA -U RNA, snoRNA, small non-coding components of Ro60 ribonucleoprotein particle (y RNA), rRNA, tRNA, miRNA microRNA, and scRNA small cytoplasmic RNA (7S). B : The increased expression level of Linc00085, seen in the transcriptomic array, was independently validated in RNA from PNN-knockdown human corneal epithelial (HCET) cells with real-time–PCR (RT–PCR). C : The change in splicing isoforms of lncRNA, HAS2-AS1, as demonstrated on the Affimetrix transcriptome-arrays, was verified through isoform-specific RT–PCR and sequencing analyses. D : Conditional knockout of Pnn in developing mouse cornea epithelium led to specific changes in the splicing pattern of mHas2as, the mouse ortholog of human HAS2-AS1. The epithelia from the lens-Cre knockouts demonstrated a decrease in the mHAS2AS1 isoform containing exon 1–5 and isoform containing exons 1, 2, and 5 (see Appendix 1). D : Splicing patterns of mHas2as was examined in multiple different mouse tissues. All tissues tested exhibited a differential splicing pattern across the three major splice variants, suggesting significant normal variations on mHAS2-AS1 across differing tissues and cell types, suggestive of tissue-specific splicing regulation.

    Journal: Molecular Vision

    Article Title: Role of Pnn in alternative splicing of a specific subset of lncRNAs of the corneal epithelium

    doi:

    Figure Lengend Snippet: Induced knockdown of Pnn in HCET cells resulted in altered expression of an array of non-coding RNAs, including long-non-coding RNAs. A : Doxycycline-inducible shRNA-mediated PNN knockdown in human corneal epithelial cells led to the altered expression of specific subsets of ncRNAs, including a subset of lncRNAs, along with snRNA -U RNA, snoRNA, small non-coding components of Ro60 ribonucleoprotein particle (y RNA), rRNA, tRNA, miRNA microRNA, and scRNA small cytoplasmic RNA (7S). B : The increased expression level of Linc00085, seen in the transcriptomic array, was independently validated in RNA from PNN-knockdown human corneal epithelial (HCET) cells with real-time–PCR (RT–PCR). C : The change in splicing isoforms of lncRNA, HAS2-AS1, as demonstrated on the Affimetrix transcriptome-arrays, was verified through isoform-specific RT–PCR and sequencing analyses. D : Conditional knockout of Pnn in developing mouse cornea epithelium led to specific changes in the splicing pattern of mHas2as, the mouse ortholog of human HAS2-AS1. The epithelia from the lens-Cre knockouts demonstrated a decrease in the mHAS2AS1 isoform containing exon 1–5 and isoform containing exons 1, 2, and 5 (see Appendix 1). D : Splicing patterns of mHas2as was examined in multiple different mouse tissues. All tissues tested exhibited a differential splicing pattern across the three major splice variants, suggesting significant normal variations on mHAS2-AS1 across differing tissues and cell types, suggestive of tissue-specific splicing regulation.

    Article Snippet: One μg of total RNA was reverse transcribed with Superscript III First-Strand Synthesis kit (Invitrogen, Carlsbad, CA) using oligo- dT primers.

    Techniques: Expressing, shRNA, Real-time Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Sequencing, Knock-Out

    NRIP is involved in the CUL-DDB1 E3 ligase mechanism by interacting with DDB1 and associating with the DDB1-CUL4 complex through its DxR motif A . NRIP is involved in the CUL4A-DDB1 complex. His-MBP and His-MBP-NRIP were expressed from bacteria and purified using Ni-NTA beads. The beads conjugated with recombinant proteins were incubated with the lysates of HeLa cells and the co-purified proteins were separated by SDS-PAGE and analyzed by Coomassie blue staining (upper panel) or western blotting (lower panel) using the antibodies indicated. B . The interaction between NRIP and DDB1. Calcium phosphate was used to transfect 293T cells with NRIP-FLAG and HA-DDB1 plasmids. Cell lysates were collected 48 h after transfection and immunoprecipitated with anti-FLAG or anti-HA antibodies for detection of NRIP or DDB1, respectively. C . A schematic depiction of the protein DxR motif of NRIP. Aspartic acids at 173 and 223 in the regions bounded by amino acid residues 166 to 179 and 216 to 229 were replaced by alanine using site-directed mutagenesis and named NRIP-DM. D . NRIP-DM lost DDB1 binding. 293T cells were cotransfected with the wild-type NRIP or NRIP-DM mutant with HA-DDB1, cell lysates were extracted and immunoprecipitated with anti-HA antibodies for detection of DDB1 and immunoblotted with anti-FLAG for detection of NRIP and NRIP-DM. E . NRIP-DM interacted with AR. After cotransfection of 293T cells with FLAG-tagged NRIP-DM and AR, cell extracts were subjected to immunoprecipitation with anti-FLAG or anti-AR antibodies and the immunoprecipitated proteins analyzed by western blotting using anti-AR or anti-FLAG antibodies, reciprocally. The loading of the cell extracts represents 10% of the input used for immunoprecipitation to assess comparable protein levels. F . AR protein stabilization was independent of NRIP and DDB1 interaction. LNCap cells were transfected with NRIP-FLAG, NRIP-DM-FLAG, and GFP, respectively. After 24 h, cells were treated with 10 nM DHT for 24 h. Proteins and RNAs were extracted by RIPA and Trizol reagent, respectively. The protein expression of NRIP and AR was detected by western blot analysis with anti-FLAG and anti-AR primary antibodies. The expression of PSA was detected by RT-PCR. GAPDH was used as a loading control.

    Journal: Oncotarget

    Article Title: NRIP/DCAF6 stabilizes the androgen receptor protein by displacing DDB2 from the CUL4A-DDB1 E3 ligase complex in prostate cancer

    doi: 10.18632/oncotarget.15308

    Figure Lengend Snippet: NRIP is involved in the CUL-DDB1 E3 ligase mechanism by interacting with DDB1 and associating with the DDB1-CUL4 complex through its DxR motif A . NRIP is involved in the CUL4A-DDB1 complex. His-MBP and His-MBP-NRIP were expressed from bacteria and purified using Ni-NTA beads. The beads conjugated with recombinant proteins were incubated with the lysates of HeLa cells and the co-purified proteins were separated by SDS-PAGE and analyzed by Coomassie blue staining (upper panel) or western blotting (lower panel) using the antibodies indicated. B . The interaction between NRIP and DDB1. Calcium phosphate was used to transfect 293T cells with NRIP-FLAG and HA-DDB1 plasmids. Cell lysates were collected 48 h after transfection and immunoprecipitated with anti-FLAG or anti-HA antibodies for detection of NRIP or DDB1, respectively. C . A schematic depiction of the protein DxR motif of NRIP. Aspartic acids at 173 and 223 in the regions bounded by amino acid residues 166 to 179 and 216 to 229 were replaced by alanine using site-directed mutagenesis and named NRIP-DM. D . NRIP-DM lost DDB1 binding. 293T cells were cotransfected with the wild-type NRIP or NRIP-DM mutant with HA-DDB1, cell lysates were extracted and immunoprecipitated with anti-HA antibodies for detection of DDB1 and immunoblotted with anti-FLAG for detection of NRIP and NRIP-DM. E . NRIP-DM interacted with AR. After cotransfection of 293T cells with FLAG-tagged NRIP-DM and AR, cell extracts were subjected to immunoprecipitation with anti-FLAG or anti-AR antibodies and the immunoprecipitated proteins analyzed by western blotting using anti-AR or anti-FLAG antibodies, reciprocally. The loading of the cell extracts represents 10% of the input used for immunoprecipitation to assess comparable protein levels. F . AR protein stabilization was independent of NRIP and DDB1 interaction. LNCap cells were transfected with NRIP-FLAG, NRIP-DM-FLAG, and GFP, respectively. After 24 h, cells were treated with 10 nM DHT for 24 h. Proteins and RNAs were extracted by RIPA and Trizol reagent, respectively. The protein expression of NRIP and AR was detected by western blot analysis with anti-FLAG and anti-AR primary antibodies. The expression of PSA was detected by RT-PCR. GAPDH was used as a loading control.

    Article Snippet: Reverse-transcriptase polymerase chain reaction (RT-PCR) Total RNAs were isolated with TRIzol reagent (Invitrogen) and treated with DNase (RQ1, Promega) to remove genomic DNA according to the manufacturers’ instructions.

    Techniques: Purification, Recombinant, Incubation, SDS Page, Staining, Western Blot, Transfection, Immunoprecipitation, Mutagenesis, Binding Assay, Cotransfection, Expressing, Reverse Transcription Polymerase Chain Reaction

    Expression of chondrocyte and zinc finger proteins during adherent chondrocyte passages. (a) Expression of the chondrocyte proteins COL2A1, MMP13, aggrecan, and COL1 as well as the zinc finger proteins ZNF521, ZNF423, ZNF470, and ZNF780B in adherent cultured chondrocytes. Each passage represents one week of growth on tissue culture treated dishes until the cells were 80% confluent. Cells were treated with trypsin and diluted at 1 : 3 for passage and RNA was prepared with Trizol. The expression of RNA levels was estimated by Q-RT-PCR normalized for GAPDH and calculated relative to the amount of each transcript in the chondrocyte cell line T/C28a4 (arbitrary units). Significant differences are indicated with P values less than 0.05. (b) Immunofluorescence of chondrocytes after one or three passages stained with rabbit antibodies specific for COL2A1 or ZNF521 and detected with anti-rabbit Alexa Fluor 495 (magnification 20x).

    Journal: Mediators of Inflammation

    Article Title: Expression Profiling and Functional Implications of a Set of Zinc Finger Proteins, ZNF423, ZNF470, ZNF521, and ZNF780B, in Primary Osteoarthritic Articular Chondrocytes

    doi: 10.1155/2014/318793

    Figure Lengend Snippet: Expression of chondrocyte and zinc finger proteins during adherent chondrocyte passages. (a) Expression of the chondrocyte proteins COL2A1, MMP13, aggrecan, and COL1 as well as the zinc finger proteins ZNF521, ZNF423, ZNF470, and ZNF780B in adherent cultured chondrocytes. Each passage represents one week of growth on tissue culture treated dishes until the cells were 80% confluent. Cells were treated with trypsin and diluted at 1 : 3 for passage and RNA was prepared with Trizol. The expression of RNA levels was estimated by Q-RT-PCR normalized for GAPDH and calculated relative to the amount of each transcript in the chondrocyte cell line T/C28a4 (arbitrary units). Significant differences are indicated with P values less than 0.05. (b) Immunofluorescence of chondrocytes after one or three passages stained with rabbit antibodies specific for COL2A1 or ZNF521 and detected with anti-rabbit Alexa Fluor 495 (magnification 20x).

    Article Snippet: RNA Extraction, cDNA Synthesis, and Q-RT-PCR Total RNA was prepared with Trizol (Life Technologies) treated with DNase I (RNase free, Promega) 1 U/1 μ g RNA.

    Techniques: Expressing, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Immunofluorescence, Staining

    Changes in expression levels of mRNAs in BMMs by treatment with R848. Mouse BMMs were cultured in the presence or absence of R848 (100 nM) for 24 h, then total RNA was extracted from the BMMs. The expression levels of mRNAs (TLR7, IL-12,

    Journal: Cytotechnology

    Article Title: R848, a toll-like receptor 7 agonist, inhibits osteoclast differentiation but not survival or bone-resorbing function of mature osteoclasts

    doi: 10.1007/s10616-012-9442-5

    Figure Lengend Snippet: Changes in expression levels of mRNAs in BMMs by treatment with R848. Mouse BMMs were cultured in the presence or absence of R848 (100 nM) for 24 h, then total RNA was extracted from the BMMs. The expression levels of mRNAs (TLR7, IL-12,

    Article Snippet: Total RNA from BMMs in culture dishes was prepared using TRIzol solution (Invitrogen Life Technologies, CA, USA) and synthesized from total RNA using Superscript III (Invitrogen Life Technologies), then subjected to amplification with GoTaq DNA polymerase (Promega Corporation, CA, USA) using the following specific PCR primers: GAPDH, 5′-GAAGGTCGGTGTGAACGGATTTGGC-3′ (forward) and 5′-CATGTAGGCCATGAGGTCCAACAC-3′ (reverse); IFN-β, 5′-CCCTATGGAGATGACGGAGA-3′ (forward) and 5′-GCAACCACCACTCATTCTGA-3′ (reverse); IFN-γ, 5′-GCGTCATTGAATCACACCTG-3′ (forward) and 5′-CGCAATCACAGTCTTGGCTA (reverse); IL-12, 5′-ACGGCAGGAAAAACTGAA-3′ (forward) and 5′-CAGATAGCCCATCACCCTGT-3′ (reverse); TLR7, 5′-GCGTGTCAAGGGTATGTCT-3′ (forward) and 5′-AGTTTGGCCAATGGTGTTTCT-3′ (reverse); iNOS, 5′-ACGCTTGGGTCTTGTTCACT-3′ (forward) and 5′-GTCTCTGGGTCCTCTGGTCA-3′ (reverse); and IL-6, 5′-CACAGAGGATACCACTCCCAACA-3′ (forward) and 5′-TCCACGATTTCCCAGAGAACA-3′ (reverse).

    Techniques: Expressing, Cell Culture

    Transcription of PcPET8 by P. carinii . A “one-step” RT-PCR reaction was performed using total RNA isolated from P. carinii and primers, based on the PcPET8 sequence. Lane 1 , DNase-treated total RNA template. The product demonstrates the

    Journal: American Journal of Respiratory Cell and Molecular Biology

    Article Title: Pneumocystis S-Adenosylmethionine Transport

    doi: 10.1165/rcmb.2011-0009OC

    Figure Lengend Snippet: Transcription of PcPET8 by P. carinii . A “one-step” RT-PCR reaction was performed using total RNA isolated from P. carinii and primers, based on the PcPET8 sequence. Lane 1 , DNase-treated total RNA template. The product demonstrates the

    Article Snippet: RNA was isolated from P. carinii cells, using the TRIZOL reagent according to the manufacturer's instructions (Invitrogen, Carlsbad, CA), and was then treated with RQ1 RNase-free DNase (Promega, San Luis Obispo, CA) to destroy any trace of genomic DNA. cDNA was synthesized using 1.0 μg of extracted RNA and the Superscript III One-Step RT-PCR system (Invitrogen) in a 50-μl reaction mix with the forward primer ATG GAT TTG AAA CTA ATT TAT G and the reverse primer AAT GCA CGT ATA CCT TCT TC. cDNA synthesis proceeded with the reverse transcription reaction at 56°C for 30 minutes, followed by 40 PCR amplification cycles (15 seconds at 94°C, 30 seconds at 56°C, and 60 seconds at 68°C), with a final extension for 5 minutes at 68°C.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Isolation, Sequencing

    DdrC protects DNA against degradation by nucleases. Protection of supercoiled pBR322 plasmid (3.5 nM) from DNase I activity (0.1 U) (panel a), linear pBR322 (3.5 nM) from Exonuclease III activity (200 U) (panel b) and phiX174 ssDNA (5.9 nM) from Mung Bean Nuclease activity (1 U) (panel c) by 7 μM, 7 μM, and 2 μM DdrC, respectively. Lanes C: DNA controls without protein. Lanes 1: DNA incubation with nuclease alone. Lanes 2: DNA incubation with DdrC alone. Lanes 3: DNA pre-incubated with DdrC 15 min at 4°C before addition of nuclease. Lanes 4: Reaction products corresponding to lane 3 were further treated with Proteinase K/SDS. Panel a, lane 5: DdrC and DNase I were simultaneously incubated with supercoiled DNA before treatment with Proteinase K/SDS.

    Journal: PLoS ONE

    Article Title: In vivo and in vitro characterization of DdrC, a DNA damage response protein in Deinococcus radiodurans bacterium

    doi: 10.1371/journal.pone.0177751

    Figure Lengend Snippet: DdrC protects DNA against degradation by nucleases. Protection of supercoiled pBR322 plasmid (3.5 nM) from DNase I activity (0.1 U) (panel a), linear pBR322 (3.5 nM) from Exonuclease III activity (200 U) (panel b) and phiX174 ssDNA (5.9 nM) from Mung Bean Nuclease activity (1 U) (panel c) by 7 μM, 7 μM, and 2 μM DdrC, respectively. Lanes C: DNA controls without protein. Lanes 1: DNA incubation with nuclease alone. Lanes 2: DNA incubation with DdrC alone. Lanes 3: DNA pre-incubated with DdrC 15 min at 4°C before addition of nuclease. Lanes 4: Reaction products corresponding to lane 3 were further treated with Proteinase K/SDS. Panel a, lane 5: DdrC and DNase I were simultaneously incubated with supercoiled DNA before treatment with Proteinase K/SDS.

    Article Snippet: Nuclease protection of supercoiled pBR322, linear pBR322 (cut by EcoRV ) or ss phiX174 virion was tested with 0.1 U DNase I (Promega), 200 U Exonuclease III (NEB) or 1 U Mung Bean Nuclease (Promega), respectively.

    Techniques: Plasmid Preparation, Activity Assay, Incubation

    qRT-PCR to determine the relative amount of other RNAs compared with L1 RNA in L1 RNPs. ( A ) Total RNA was isolated from RNPs after transfecting FL-O1F by Trizol extraction and treated with DNAse. cDNA was synthesized using an oligo-dT (12 Ts) primer and

    Journal: Human Molecular Genetics

    Article Title: Enrichment of processed pseudogene transcripts in L1-ribonucleoprotein particles

    doi: 10.1093/hmg/ddt225

    Figure Lengend Snippet: qRT-PCR to determine the relative amount of other RNAs compared with L1 RNA in L1 RNPs. ( A ) Total RNA was isolated from RNPs after transfecting FL-O1F by Trizol extraction and treated with DNAse. cDNA was synthesized using an oligo-dT (12 Ts) primer and

    Article Snippet: Total RNA (1.05 µg) was dissolved in 30 µl RNase-free water, and 9 µl (∼280 ng) total RNA was treated with DNAse (Promega) in 20 µl reaction volume.

    Techniques: Quantitative RT-PCR, Isolation, Synthesized

    ORF2-mediated RT activity on Alu, SVA, 7SL, U snRNAs and hYRNAs. ( A ) Panel 1:detection of RNA in the L1-RNP by RT-PCR. RNA was purified from L1-RNPs following transfection with FL-O1F and treated with DNase. The RT reaction was performed using an oligo-dT

    Journal: Human Molecular Genetics

    Article Title: Enrichment of processed pseudogene transcripts in L1-ribonucleoprotein particles

    doi: 10.1093/hmg/ddt225

    Figure Lengend Snippet: ORF2-mediated RT activity on Alu, SVA, 7SL, U snRNAs and hYRNAs. ( A ) Panel 1:detection of RNA in the L1-RNP by RT-PCR. RNA was purified from L1-RNPs following transfection with FL-O1F and treated with DNase. The RT reaction was performed using an oligo-dT

    Article Snippet: Total RNA (1.05 µg) was dissolved in 30 µl RNase-free water, and 9 µl (∼280 ng) total RNA was treated with DNAse (Promega) in 20 µl reaction volume.

    Techniques: Activity Assay, Reverse Transcription Polymerase Chain Reaction, Purification, Transfection

    Deletion of the 20q-TERRA locus decreases telomere length and protection in U2OS cells. ( a ) Q-FISH images obtained from metaphases spreads from U2OS cells WT and KO for the Chr20q-TERRA locus (clones A4, B4 and C4). (Left graphs) Frequency graphs of telomere length (a.u.) distribution measured in WT and in the 20q-KO cells (clones A4, B4 and C4) from three independent experiments. The mean telomere length and the number of telomeres and metaphases analyzed is shown. The red lines are arbitrary lines placed in the exact same position in each frequency graph to visualize differences between the 20q-KO clones and the WT controls (right graphs) The mean telomere length, the percentage of short telomeres and the quantification of signal-free ends per metaphase are also represented. Short telomeres are considered those in the 10% percentile of the total telomere length distribution. Total number of metaphases used for the statistical analysis is indicated. Scale bar, 10 μm and (zoom) 1 μm. ( b ) WT and 20q-KO cells were analyzed for T-SCE events with G-rich (green) and C-rich (red) PNA probes. The fraction of chromosome ends with T-SCE obtained from three different experiments was quantified and graphed as the mean values±s.e.m., n =30 metaphases. The number of metaphases analyzed is shown. Only events in which interchange of both colours were quantified (see examples of no-T-SCE and T-SCE). The quantification was carried out by counting the number of events in the same chromosome or in different chromosomes and then normalizing it by the total number of chromosomes observed in each metaphase. Scale bar, 1 μm. ( c ) Quantification of DNA-containing double minute chromosomes (TDMs) in WT and 20q-KO cells from three different experiments (mean values±s.e.m., n =30 metaphases). An example of TDMs is shown. One-way Anova with Dunnett's post test was used for all statistical analysis (* P

    Journal: Nature Communications

    Article Title: Telomeric RNAs are essential to maintain telomeres

    doi: 10.1038/ncomms12534

    Figure Lengend Snippet: Deletion of the 20q-TERRA locus decreases telomere length and protection in U2OS cells. ( a ) Q-FISH images obtained from metaphases spreads from U2OS cells WT and KO for the Chr20q-TERRA locus (clones A4, B4 and C4). (Left graphs) Frequency graphs of telomere length (a.u.) distribution measured in WT and in the 20q-KO cells (clones A4, B4 and C4) from three independent experiments. The mean telomere length and the number of telomeres and metaphases analyzed is shown. The red lines are arbitrary lines placed in the exact same position in each frequency graph to visualize differences between the 20q-KO clones and the WT controls (right graphs) The mean telomere length, the percentage of short telomeres and the quantification of signal-free ends per metaphase are also represented. Short telomeres are considered those in the 10% percentile of the total telomere length distribution. Total number of metaphases used for the statistical analysis is indicated. Scale bar, 10 μm and (zoom) 1 μm. ( b ) WT and 20q-KO cells were analyzed for T-SCE events with G-rich (green) and C-rich (red) PNA probes. The fraction of chromosome ends with T-SCE obtained from three different experiments was quantified and graphed as the mean values±s.e.m., n =30 metaphases. The number of metaphases analyzed is shown. Only events in which interchange of both colours were quantified (see examples of no-T-SCE and T-SCE). The quantification was carried out by counting the number of events in the same chromosome or in different chromosomes and then normalizing it by the total number of chromosomes observed in each metaphase. Scale bar, 1 μm. ( c ) Quantification of DNA-containing double minute chromosomes (TDMs) in WT and 20q-KO cells from three different experiments (mean values±s.e.m., n =30 metaphases). An example of TDMs is shown. One-way Anova with Dunnett's post test was used for all statistical analysis (* P

    Article Snippet: The slides were treated with 0.5 mg ml−1 RNase A for 10 min at 37 °C, stained with 0.5 μg ml−1 Hoechst 33258 (Sigma) in 2 × SSC (0.3 M NaCl, 0.03 M sodium citrate) for 15 min at room temperature and then exposed to 365 nm UV light (Stratalinker 1800 UV irradiator) for 25–30 min. Enzymatic digestion of the BrdU/BrdC-substituted DNA strands with 3 U μl−1 of Exonuclease III (Promega) in buffer supplied by the manufacturer (50 mM Tris–HCl, 5 mM MgCl2 and 5 mM dithiothreitol, pH 8) was allowed to proceed for 10 min at room temperature.

    Techniques: Fluorescence In Situ Hybridization, Clone Assay

    Deletion of the 20q-TERRA locus decreases telomere protection in U2OS cells. ( a ) Quantification of the total γH2AX signal per nucleus (mean values±s.e.m., n =number of cells) is shown. The total number of cells analyzed is indicated. ( b ) Quantification of the total 53BP1 spot signal per nucleus (mean values±s.e.m., n =number of cells is shown). The total number of cells analyzed is indicated. ( c ) Graphs showing the quantification of the co-localization (TIF) between TRF2 and either γH2AX or 53BP1 in WT cells and in all 20q-KO clones (mean values±s.e.m., n =3 independent experiments for γH2AX and n =number of cells for 53BP1) per cell is shown. The total number of nuclei analyzed is indicated. ( d ) Representative images of the average number of TIFs found on double inmunostain to detect the telomere protein TRF2 (green) and either the DNA damage markers phospho-Histone γH2AX or 53BP1 (red) in the U2OS cells WT or deleted for the 20q locus. Arrowheads indicate co-localization events. Scale bar, 10 μm. ( e ) Quantification of chromosomal end-to-end fusions in WT and in the 20q-KO cells from three independent experiments (mean values±s.e.m., n =metaphases). Examples of end-to-end fusions are shown as well. Scale bar, 1 μm. ( f ) Array-CGH analysis was performed on hybridization on the same membrane of DNA differentially labelled from WT and 20q-KO cells. The chromosomal gains and losses in 20q-KO cells normalized by WT cells are represented. The chromosomal gains are shown in green and in red the chromosomal losses. One-way Anova with Dunnett's post test was used for all statistical analysis except for the quantification of chromosomal fusions in which the Student's t -test was used (* P

    Journal: Nature Communications

    Article Title: Telomeric RNAs are essential to maintain telomeres

    doi: 10.1038/ncomms12534

    Figure Lengend Snippet: Deletion of the 20q-TERRA locus decreases telomere protection in U2OS cells. ( a ) Quantification of the total γH2AX signal per nucleus (mean values±s.e.m., n =number of cells) is shown. The total number of cells analyzed is indicated. ( b ) Quantification of the total 53BP1 spot signal per nucleus (mean values±s.e.m., n =number of cells is shown). The total number of cells analyzed is indicated. ( c ) Graphs showing the quantification of the co-localization (TIF) between TRF2 and either γH2AX or 53BP1 in WT cells and in all 20q-KO clones (mean values±s.e.m., n =3 independent experiments for γH2AX and n =number of cells for 53BP1) per cell is shown. The total number of nuclei analyzed is indicated. ( d ) Representative images of the average number of TIFs found on double inmunostain to detect the telomere protein TRF2 (green) and either the DNA damage markers phospho-Histone γH2AX or 53BP1 (red) in the U2OS cells WT or deleted for the 20q locus. Arrowheads indicate co-localization events. Scale bar, 10 μm. ( e ) Quantification of chromosomal end-to-end fusions in WT and in the 20q-KO cells from three independent experiments (mean values±s.e.m., n =metaphases). Examples of end-to-end fusions are shown as well. Scale bar, 1 μm. ( f ) Array-CGH analysis was performed on hybridization on the same membrane of DNA differentially labelled from WT and 20q-KO cells. The chromosomal gains and losses in 20q-KO cells normalized by WT cells are represented. The chromosomal gains are shown in green and in red the chromosomal losses. One-way Anova with Dunnett's post test was used for all statistical analysis except for the quantification of chromosomal fusions in which the Student's t -test was used (* P

    Article Snippet: The slides were treated with 0.5 mg ml−1 RNase A for 10 min at 37 °C, stained with 0.5 μg ml−1 Hoechst 33258 (Sigma) in 2 × SSC (0.3 M NaCl, 0.03 M sodium citrate) for 15 min at room temperature and then exposed to 365 nm UV light (Stratalinker 1800 UV irradiator) for 25–30 min. Enzymatic digestion of the BrdU/BrdC-substituted DNA strands with 3 U μl−1 of Exonuclease III (Promega) in buffer supplied by the manufacturer (50 mM Tris–HCl, 5 mM MgCl2 and 5 mM dithiothreitol, pH 8) was allowed to proceed for 10 min at room temperature.

    Techniques: Clone Assay, Hybridization

    RT–PCR amplification of nifH mRNA from wood-fed P. nigrolineatus GI tract regions. After dissection, RNA was extracted from fore (lane 2), hind (lane 3) and midgut (lane 4) regions, as described in the materials and methods section. RNA (3 μg) was first treated with DNaseI in the presence of RNasin and RT–PCR was carried out using the Superscript III One-Step Platinum Taq high fidelity kit (see Methods). Complementary DNA synthesis was followed by amplification with nifH32 and nifH623 primers and a second round amplification using nifH1 and nifH2 primers as described in the materials and methods section. Reaction products were separated on a 1.5% agarose gel. RNA preparations treated with DNase in the absence of RT and amplifications without DNase and RT treatments are shown. M is a 100 bp ladder; lane 1 is a negative control that did not contain RNA.

    Journal: The ISME Journal

    Article Title: Nitrogenase diversity and activity in the gastrointestinal tract of the wood-eating catfish Panaque nigrolineatus

    doi: 10.1038/ismej.2015.65

    Figure Lengend Snippet: RT–PCR amplification of nifH mRNA from wood-fed P. nigrolineatus GI tract regions. After dissection, RNA was extracted from fore (lane 2), hind (lane 3) and midgut (lane 4) regions, as described in the materials and methods section. RNA (3 μg) was first treated with DNaseI in the presence of RNasin and RT–PCR was carried out using the Superscript III One-Step Platinum Taq high fidelity kit (see Methods). Complementary DNA synthesis was followed by amplification with nifH32 and nifH623 primers and a second round amplification using nifH1 and nifH2 primers as described in the materials and methods section. Reaction products were separated on a 1.5% agarose gel. RNA preparations treated with DNase in the absence of RT and amplifications without DNase and RT treatments are shown. M is a 100 bp ladder; lane 1 is a negative control that did not contain RNA.

    Article Snippet: RNA (3 μg) was first treated with DNaseI (Fermentas, Hanover, MD, USA) in the presence of RNasin (Promega, Madison, WI, USA) and RT–PCR was carried out using the Superscript III One-Step Platinum Taq high fidelity kit (Invitrogen) with a 15 min complementary DNA synthesis step at 55 °C followed by amplification with nifH32 and nifH623 primers as described above.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Dissection, DNA Synthesis, Agarose Gel Electrophoresis, Negative Control

    Transcript accumulation of KASI and RAM2 genes. ( A ) Transcript accumulation of DIS , DIS-LIKE, KASI and RAM2 in control (mock) and R. irregularis colonized (AM) roots and in different organs of L. japonicus assessed by qRT-PCR. Expression values were normalized to those of the constitutively expressed gene EF1α ( DIS , DIS-LIKE, KASI) and Ubiquitin10 ( RAM2) . Black circles represent three biological replicates. Different letters indicate significant differences (ANOVA; posthoc Tukey; n = 15; p≤0.05, F 4,14 ( KASI ) = 1.191, F 4,14 ( DIS ) = 8.412, F 4,14 ( DIS-LIKE ) = 4.563; p≤0.001, F 4,14 = 67.41 ( RAM2) ). AM plants were inoculated with R. irregularis. Control and AM plants were harvested 5 wpi. ( B ) Arbuscule phenotype in wild type and dis-like-5 mutant roots after 5 wpi with R. irregularis as indicated by acid ink staining. White arrow heads indicate arbuscules. DOI: http://dx.doi.org/10.7554/eLife.29107.018

    Journal: eLife

    Article Title: Lipid transfer from plants to arbuscular mycorrhiza fungi

    doi: 10.7554/eLife.29107

    Figure Lengend Snippet: Transcript accumulation of KASI and RAM2 genes. ( A ) Transcript accumulation of DIS , DIS-LIKE, KASI and RAM2 in control (mock) and R. irregularis colonized (AM) roots and in different organs of L. japonicus assessed by qRT-PCR. Expression values were normalized to those of the constitutively expressed gene EF1α ( DIS , DIS-LIKE, KASI) and Ubiquitin10 ( RAM2) . Black circles represent three biological replicates. Different letters indicate significant differences (ANOVA; posthoc Tukey; n = 15; p≤0.05, F 4,14 ( KASI ) = 1.191, F 4,14 ( DIS ) = 8.412, F 4,14 ( DIS-LIKE ) = 4.563; p≤0.001, F 4,14 = 67.41 ( RAM2) ). AM plants were inoculated with R. irregularis. Control and AM plants were harvested 5 wpi. ( B ) Arbuscule phenotype in wild type and dis-like-5 mutant roots after 5 wpi with R. irregularis as indicated by acid ink staining. White arrow heads indicate arbuscules. DOI: http://dx.doi.org/10.7554/eLife.29107.018

    Article Snippet: The RNA was treated with Invitrogen DNAse I amp. grade ( www.invitrogen.com ) and tested for purity by PCR. cDNA synthesis was performed with 500 ng RNA using the Superscript III kit ( www.invitrogen.com ). qRT-PCR was performed with GoTaq G2 DNA polymerase (Promega), 5 x colorless GoTaq Buffer (Promega) and SYBR Green I (Invitrogen S7563, 10.000x concentrated, 500 µl) - diluted to 100x in DMSO.

    Techniques: Quantitative RT-PCR, Expressing, Mutagenesis, Staining

    Small hairpin RNA (shRNA) sequence selection. HEK-293 cells were collected 48 h post transfection, and RNA and protein were extracted. Aldehyde dehydrogenase (ALDH2) cDNA was co-transfected with five different shRNA plasmids (lanes 1–5); scramble and GFP plasmids co-transfection were used as ALDH2 expression control (lanes 6–7). GFP transfection (lane 8) and non-transfected cells (lane9). (A) Semi-quantitative reverse transcription polymerase chain reaction (RT-PCR). ALDH2 expression was determined using primers designed to amplify a 1,460 bp product. Integrity of RNA was determined by amplifying a 425 bp region of the human GAPDH gene and is shown in the bottom panel . (B) Western blot of ALDH2 (56 kDa) and β-actin (42 kDa, bottom panel ) in the HEK-293 cells treated as described above.

    Journal: Human Gene Therapy

    Article Title: AAV Gene Therapy for Alcoholism: Inhibition of Mitochondrial Aldehyde Dehydrogenase Enzyme Expression in Hepatoma Cells

    doi: 10.1089/hum.2017.043

    Figure Lengend Snippet: Small hairpin RNA (shRNA) sequence selection. HEK-293 cells were collected 48 h post transfection, and RNA and protein were extracted. Aldehyde dehydrogenase (ALDH2) cDNA was co-transfected with five different shRNA plasmids (lanes 1–5); scramble and GFP plasmids co-transfection were used as ALDH2 expression control (lanes 6–7). GFP transfection (lane 8) and non-transfected cells (lane9). (A) Semi-quantitative reverse transcription polymerase chain reaction (RT-PCR). ALDH2 expression was determined using primers designed to amplify a 1,460 bp product. Integrity of RNA was determined by amplifying a 425 bp region of the human GAPDH gene and is shown in the bottom panel . (B) Western blot of ALDH2 (56 kDa) and β-actin (42 kDa, bottom panel ) in the HEK-293 cells treated as described above.

    Article Snippet: For first-strand cDNA synthesis, 1 μg of RNA was used for retro transcription by SuperScript III RT (Thermo Fisher), followed by a RNase H treatment (Thermo Fisher).

    Techniques: shRNA, Sequencing, Selection, Transfection, Cotransfection, Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot

    Effect of RNAi of serine peptidases on T . brucei cell growth in vitro . Two independent RNAi cell lines were induced with 1 μgml -1 tetracycline (open symbols) or left untreated (filled symbols). Cells were counted every 24 hours, diluted down to 1 x 10 5 cells ml -1 and the cumulative cell number calculated. Insets: Target transcript levels in RNAi cell lines. Insets (upper left): Total RNA was isolated from non-induced (solid bars) or tetracycline-induced (striped bars) cells and used to make cDNA, which was used as a template in a real time PCR reaction using gene-specific primers ( S2 Table ). For cell lines in which multiple genes with non-identical sequences were targeted, PCR results for each target are shown. Results from three technical replicates are shown. Insets (lower right): For two targets, Western blots were done on lysates from control (-) or tetracycline induced (+) cells, using RNAi target protein-specific antibody (upper panel) or α-EF1-α (lower panel).

    Journal: PLoS ONE

    Article Title: An Essential Signal Peptide Peptidase Identified in an RNAi Screen of Serine Peptidases of Trypanosoma brucei

    doi: 10.1371/journal.pone.0123241

    Figure Lengend Snippet: Effect of RNAi of serine peptidases on T . brucei cell growth in vitro . Two independent RNAi cell lines were induced with 1 μgml -1 tetracycline (open symbols) or left untreated (filled symbols). Cells were counted every 24 hours, diluted down to 1 x 10 5 cells ml -1 and the cumulative cell number calculated. Insets: Target transcript levels in RNAi cell lines. Insets (upper left): Total RNA was isolated from non-induced (solid bars) or tetracycline-induced (striped bars) cells and used to make cDNA, which was used as a template in a real time PCR reaction using gene-specific primers ( S2 Table ). For cell lines in which multiple genes with non-identical sequences were targeted, PCR results for each target are shown. Results from three technical replicates are shown. Insets (lower right): For two targets, Western blots were done on lysates from control (-) or tetracycline induced (+) cells, using RNAi target protein-specific antibody (upper panel) or α-EF1-α (lower panel).

    Article Snippet: Genomic DNA was removed with RQ1 DNaseI (Promega) and first strand cDNA synthesised using Superscript III (Invitrogen) according to manufacturer’s instructions.

    Techniques: In Vitro, Isolation, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Western Blot