etoposide Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore etoposide vp 16
    Silencing of SNAI2 phenocopies the effects of miR-203 re-expression on sensitization of U251AR cells to anticancer drugs and reversion of EMT (A) a. U251AR/shNC cells; b. U251AR/shSNAI2 cells. Light microscopy, 100× (a, b); Fluorescent microscopy, 100× (a, b). shSNAI2 and negative vector (shNC) were transfected into U251AR cells. At 48 h after transfection, fluorescent microscopy showed emission green fluorescence. (B) qRT-PCR validate the downregulation of SNAI2 after shRNA knockdown in U251AR cells. (C) Immunofluorescence analysis of the endogenous SNAI2 protein (red, left panels) in U251AR cells transfected with shSNAI2 or negative vector. Nuclei are stained in blue with DAPI. Scale bar, 20 μm. (D) The sensitivities of U251AR and U251AR/shSNAI2 to different concentrations of TMZ, imatinib and <t>VP-16.</t> (E) Morphology of U251AR cells transfected with negative vector or shSNAI2 vector. Scale bar, 100 μm. (F) SNAI2 knockdown reduces the invasion capacity of U251AR cells. Scale bar, 200 μm. (G) U251AR cell monolayer was transfected as indicated and scratched, then the migration of the cells towards the wound was visualised. Images were taken at various time points and Image J was used to determine the migration distance. (H) Western blotting show that silencing of SNAI2 can modulate the expression of EMT markers. VP-16, <t>etoposide;</t> TMZ, temozolomide. Data are presented as mean±s.d. of three independent experiments. * P
    Etoposide Vp 16, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/etoposide vp 16/product/Millipore
    Average 99 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    etoposide vp 16 - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    85
    Bristol Myers etoposide vp 16
    Induction of H-sema E mRNA in CDDP-sensitive cells. ( a ) Induction of H-sema E in CDDP-sensitive TYKnu cells by CDDP treatment. TYKnu cells were treated for 3 days with 0.0 (untreated control, lane 3), 0.1 (lane 4), 0.3 (lane 5), or 1.0 (lane 6) μg/ml CDDP. The constitutive expression of H-sema E by CDDP-resistant TYKnuR cells (lane 1) was not affected by the 3-day treatment with 1.0 μg/ml CDDP (lane 2). The relative intensity of the blots compared with lane 3 was 5.4 (lane 1), 6.3 (lane 2), 0.2 (lane 4), 1.5 (lane 5), and 4.3 (lane 6). ( b ) Time-dependent induction of H-sema E in CDDP-sensitive Lu65 cells. Lu65 cells were untreated or treated with 2.0 μg/ml CDDP for 6 to 72 hr (hereafter, lanes marked “0” represent untreated controls). The relative intensity of the blots compared with the untreated control was 1.1 (6 hr), 1.0 (24 hr), 2.0 (48 hr), and 3.7 (72 hr). ( c ) Dose-dependent induction of H-sema E in CDDP-sensitive Lu65 cells by the platinum-containing compounds, CBDCA and CDDP. H-sema E was induced in a dose-dependent manner by 3-day treatment with 3–30 μg/ml CBDCA or 0.5–2.0 μg/ml CDDP. The relative intensity of the blots compared with the untreated controls was 1.8 (3 μg/ml CBDCA), 1.8 (10 μg/ml CBDCA), 3.4 (30 μg/ml CBDCA), 1.2 (0.5 μg/ml CDDP), 2.9 (1.0 μg/ml CDDP), and 5.7 (2.0 μg/ml CDDP). ( d ) Induction of H-sema E in CDDP-sensitive Lu65 cells by non-platinum-containing anti-cancer compounds. H-sema E was induced by 3-day treatment with 0.1 and 0.2 μg/ml MMC, 0.1 μg/ml ADM, and 1.0 μg/ml <t>VP-16.</t> The relative intensity of the blots compared with the untreated controls was 2.2 (0.1 μg/ml MMC), 2.7 (0.2 μg/ml MMC), 2.9 (0.1 μg/ml ADM), and 3.1 (1.0 μg/ml VP-16). ( e ) Time- and dose-dependent induction of H-sema E in CDDP-sensitive Lu65 cells by UV irradiation. Total RNA was extracted from Lu65 cells 3 days after UV irradiation at 20, 40, or 80 J/m 2 ( Left ), or 24, 48, or 72 hr after UV irradiation at 80 J/m 2 ( Right ). The relative intensity of the blots compared with the untreated controls was 1.1 (20 J/m 2 ), 1.5 (40 J/m 2 ), 2.5 (80 J/m 2 ), 0.6 (24 hr), 2.0 (48 hr), and 3.2 (72 hr). ( f ) Induction of H-sema E in CDDP-sensitive Lu65 cells by x-ray irradiation. Total RNA was extracted from Lu65 cells 3 days after irradiation at a dose of 3 or 10 Gy. The relative intensity of the blots compared with the untreated control was 0.7 (3 Gy) and 3.9 (10 Gy).
    Etoposide Vp 16, supplied by Bristol Myers, used in various techniques. Bioz Stars score: 85/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/etoposide vp 16/product/Bristol Myers
    Average 85 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    etoposide vp 16 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    99
    Millipore vp 16
    TuBECs and BECs respond differently to various cytotoxic agents. TuBECs and BECs were treated with <t>VP-16</t> ( A ; 10, 50 μmol/L), paclitaxel (Tax) ( B ; 3, 10 ng/ml), thapsigargin (Thap) ( C ; 10, 30 nmol/L), or temozolomide (Tmz) ( D ; 100, 300 μmol/L).
    Vp 16, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vp 16/product/Millipore
    Average 99 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    vp 16 - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    93
    Tokyo Chemical Industry etoposide vp 16 e0675
    DCLK1 compromises DNA repair in human colon cancer HCT116 and human lung cancer H1299 cells. The experimental design is demonstrated on the top in A. HCT116 (A) or H1299 (B) cells were transfected with pCIneoEGFP-DCLK1. 24 h later, the cells were exposed to 20 μM <t>VP-16</t> for 3 h and then VP-16 was washed out. Cells were fixed and γH2A.X was immunostained. γH2A.X remained in cells expressing GFP-DCLK1 at 24 h after VP-16 removal (arrowheads), while γH2A.X was undetectable in cells without GFP-DCLK1. 100 cells for each sample were observed and the ratios of γH2A.X-positive cells were calculated. Experiments were repeated three times. Bar graphs show mean +/- SD. n.s., not significant; * *, p
    Etoposide Vp 16 E0675, supplied by Tokyo Chemical Industry, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/etoposide vp 16 e0675/product/Tokyo Chemical Industry
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    etoposide vp 16 e0675 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    94
    Abcam etoposide
    DNA damage induces de-phosphorylation of nuclear Tau. ( a ) The effect of <t>Etoposide</t> and Vinblastine treatment on mouse C17.2 cells is shown by confocal microscopy upon immune staining of PFA-fixed cells with antibodies against the microtubule marker β-tubulin (in cyan) or the DNA damage marker γH2A-X (in red). ( b ) Confocal microscopic quantification of the activated kinases in the nucleus (DAPI mask). Mean percent ± sem relative to the respective controls. 2-tailed unpaired Mann-Whitney test, ****p
    Etoposide, supplied by Abcam, used in various techniques. Bioz Stars score: 94/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/etoposide/product/Abcam
    Average 94 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    etoposide - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    94
    Cell Signaling Technology Inc etoposide
    p53 induction in response to DNA damage is impaired in TFEB/TFE3 DKO RAW264.7. 7 cells. ( A ) Representative Western blot showing p53 induction, p53 Ser15 phosphorylation, and Mdm2 levels in WT and TFE3/TFEB DKO RAW264.7 cells following <t>etoposide</t> treatment up to 8 hr. ( B ) Quantification of p53 induction from data shown in A. Data represents mean relative p53 level ± standard deviation with n = 3. Significance tested with two-way ANOVA with Sidak’s multiple comparisons test (**p
    Etoposide, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 103 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/etoposide/product/Cell Signaling Technology Inc
    Average 94 stars, based on 103 article reviews
    Price from $9.99 to $1999.99
    etoposide - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    97
    Selleck Chemicals etoposide
    HT1080 FUCCI show strong cell cycle-associated cell death. Cell cycle-associated death standards are used. ( a ) A representative FUCCI trace of cells treated with the topoisomerase-α poison, <t>etoposide.</t> Cells progress from G1-phase (red), with normal kinetics, progress to a green state and die, consistent with S/G2-phase associated death. ( b ) A representative FUCCI trace of cells treated with the DNA modifier, cisplatin. Cells most often progress normally from G1-phase (red) to an all green state and die, consistent with S-phase associated death. ( c ) A representative FUCCI trace of cells treated with a Kinesin-5 inhibitor, K5I. This cell progresses through the cell cycle with normal kinetics and enters mitotic arrest at 14 h post-treatment (*). While arrested, red signal is reacquired after 3–4 h, beginning at 17 h. This cell dies at 23 h and nearly all other cells also die while arrested in mitosis. Arrows indicate time of death. See Supplementary Fig. 1e–g online for FUCCI distributions over time. Supplementary video S6-8 online. Cell number tracked: etoposide, 33, cisplatin, 21, K5I, 30.
    Etoposide, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 97/100, based on 197 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/etoposide/product/Selleck Chemicals
    Average 97 stars, based on 197 article reviews
    Price from $9.99 to $1999.99
    etoposide - by Bioz Stars, 2020-08
    97/100 stars
      Buy from Supplier

    93
    Tocris etoposide
    BLE and TE effect on proteins markers for apoptosis in HCA-7 cell line. ( a ) Western blot” Cells were treated for 24 h with bay leaf (BLE 15 μg GAE/mL), turmeric (TE 10 μg GAE/mL), and <t>Etoposide</t> 25 μM, which was used as a positive control for caspase-3 activation. ( a ) Quantitative analysis of Western blot bands. Protein expression was normalised against β-Actin and expressed relative to untreated control, where control is 100%; ( b ) Untreated control contained just DMEM with 10% FBS (vehicle control–ethanol was 0.4% ( v / v ), the highest amount found in the extracts). Bay leaf in ethanol (BLE), turmeric in ethanol (TE), n = 3, ±SEM.
    Etoposide, supplied by Tocris, used in various techniques. Bioz Stars score: 93/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/etoposide/product/Tocris
    Average 93 stars, based on 58 article reviews
    Price from $9.99 to $1999.99
    etoposide - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    84
    Qilu Pharmaceutical vp 16 etoposide injection
    Migration of HepG2 cells was promoted by chemotherapy-induced apoptosis. After the cells on the bottom of the wells being treated with 2.5 μM <t>VP-16,</t> crystal violet staining assay was applied to analyze the influence of the treated cells on the migration of HepG2 cells from day 1 to day 7. Results were expressed as the mean ± SD of three independent experiments, *p
    Vp 16 Etoposide Injection, supplied by Qilu Pharmaceutical, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vp 16 etoposide injection/product/Qilu Pharmaceutical
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    vp 16 etoposide injection - by Bioz Stars, 2020-08
    84/100 stars
      Buy from Supplier

    93
    Addgene inc vp 16 erβ
    Migration of HepG2 cells was promoted by chemotherapy-induced apoptosis. After the cells on the bottom of the wells being treated with 2.5 μM <t>VP-16,</t> crystal violet staining assay was applied to analyze the influence of the treated cells on the migration of HepG2 cells from day 1 to day 7. Results were expressed as the mean ± SD of three independent experiments, *p
    Vp 16 Erβ, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vp 16 erβ/product/Addgene inc
    Average 93 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    vp 16 erβ - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    93
    LKT Laboratories etoposide
    Cellular characterization of GFP+ HSC colonies resulting from illegitimate NHEJ DNA repair and a chromosomal translocation following exposure to <t>etoposide</t> or bioflavonoids. (A-H) GFP+ HSC colonies were scored by inverted fluorescent microscopy beginning 96 hrs post-exposure. Representative phase contrast (left panels) and fluorescent (right panels) microscopy images of GFP+ colonies are shown side by side. (A,B) negative control. (C,D) + etoposide. (E,F) + genistein. (G,H) + quercetin. The lack of background fluorescence in the assay is demonstrated in negative control (A) and one of the two colonies in the field following etoposide exposure (D) .
    Etoposide, supplied by LKT Laboratories, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/etoposide/product/LKT Laboratories
    Average 93 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    etoposide - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    85
    Santa Cruz Biotechnology anti vp 16
    Cellular characterization of GFP+ HSC colonies resulting from illegitimate NHEJ DNA repair and a chromosomal translocation following exposure to <t>etoposide</t> or bioflavonoids. (A-H) GFP+ HSC colonies were scored by inverted fluorescent microscopy beginning 96 hrs post-exposure. Representative phase contrast (left panels) and fluorescent (right panels) microscopy images of GFP+ colonies are shown side by side. (A,B) negative control. (C,D) + etoposide. (E,F) + genistein. (G,H) + quercetin. The lack of background fluorescence in the assay is demonstrated in negative control (A) and one of the two colonies in the field following etoposide exposure (D) .
    Anti Vp 16, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti vp 16/product/Santa Cruz Biotechnology
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti vp 16 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    86
    Santa Cruz Biotechnology vp 16 antibodies
    Cellular characterization of GFP+ HSC colonies resulting from illegitimate NHEJ DNA repair and a chromosomal translocation following exposure to <t>etoposide</t> or bioflavonoids. (A-H) GFP+ HSC colonies were scored by inverted fluorescent microscopy beginning 96 hrs post-exposure. Representative phase contrast (left panels) and fluorescent (right panels) microscopy images of GFP+ colonies are shown side by side. (A,B) negative control. (C,D) + etoposide. (E,F) + genistein. (G,H) + quercetin. The lack of background fluorescence in the assay is demonstrated in negative control (A) and one of the two colonies in the field following etoposide exposure (D) .
    Vp 16 Antibodies, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vp 16 antibodies/product/Santa Cruz Biotechnology
    Average 86 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    vp 16 antibodies - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    Image Search Results


    Silencing of SNAI2 phenocopies the effects of miR-203 re-expression on sensitization of U251AR cells to anticancer drugs and reversion of EMT (A) a. U251AR/shNC cells; b. U251AR/shSNAI2 cells. Light microscopy, 100× (a, b); Fluorescent microscopy, 100× (a, b). shSNAI2 and negative vector (shNC) were transfected into U251AR cells. At 48 h after transfection, fluorescent microscopy showed emission green fluorescence. (B) qRT-PCR validate the downregulation of SNAI2 after shRNA knockdown in U251AR cells. (C) Immunofluorescence analysis of the endogenous SNAI2 protein (red, left panels) in U251AR cells transfected with shSNAI2 or negative vector. Nuclei are stained in blue with DAPI. Scale bar, 20 μm. (D) The sensitivities of U251AR and U251AR/shSNAI2 to different concentrations of TMZ, imatinib and VP-16. (E) Morphology of U251AR cells transfected with negative vector or shSNAI2 vector. Scale bar, 100 μm. (F) SNAI2 knockdown reduces the invasion capacity of U251AR cells. Scale bar, 200 μm. (G) U251AR cell monolayer was transfected as indicated and scratched, then the migration of the cells towards the wound was visualised. Images were taken at various time points and Image J was used to determine the migration distance. (H) Western blotting show that silencing of SNAI2 can modulate the expression of EMT markers. VP-16, etoposide; TMZ, temozolomide. Data are presented as mean±s.d. of three independent experiments. * P

    Journal: Oncotarget

    Article Title: MiR-203 downregulation is responsible for chemoresistance in human glioblastoma by promoting epithelial-mesenchymal transition via SNAI2

    doi:

    Figure Lengend Snippet: Silencing of SNAI2 phenocopies the effects of miR-203 re-expression on sensitization of U251AR cells to anticancer drugs and reversion of EMT (A) a. U251AR/shNC cells; b. U251AR/shSNAI2 cells. Light microscopy, 100× (a, b); Fluorescent microscopy, 100× (a, b). shSNAI2 and negative vector (shNC) were transfected into U251AR cells. At 48 h after transfection, fluorescent microscopy showed emission green fluorescence. (B) qRT-PCR validate the downregulation of SNAI2 after shRNA knockdown in U251AR cells. (C) Immunofluorescence analysis of the endogenous SNAI2 protein (red, left panels) in U251AR cells transfected with shSNAI2 or negative vector. Nuclei are stained in blue with DAPI. Scale bar, 20 μm. (D) The sensitivities of U251AR and U251AR/shSNAI2 to different concentrations of TMZ, imatinib and VP-16. (E) Morphology of U251AR cells transfected with negative vector or shSNAI2 vector. Scale bar, 100 μm. (F) SNAI2 knockdown reduces the invasion capacity of U251AR cells. Scale bar, 200 μm. (G) U251AR cell monolayer was transfected as indicated and scratched, then the migration of the cells towards the wound was visualised. Images were taken at various time points and Image J was used to determine the migration distance. (H) Western blotting show that silencing of SNAI2 can modulate the expression of EMT markers. VP-16, etoposide; TMZ, temozolomide. Data are presented as mean±s.d. of three independent experiments. * P

    Article Snippet: After 24 h, the cells were treated with different concentrations of imatinib (Novartis, Basel, Switzerland), etoposide (VP-16) (Sigma Chemical Co., St. Louis, MO) and temozolomide (TMZ) (Sigma Chemical Co., St. Louis, MO), each at four concentrations ranging from 50 to 200 μg/ml for 48 h. The range of drug concentrations were based on earlier studies and aimed at obtaining IC50 values both for highly sensitive and resistant cases.

    Techniques: Expressing, Light Microscopy, Microscopy, Plasmid Preparation, Transfection, Fluorescence, Quantitative RT-PCR, shRNA, Immunofluorescence, Staining, Migration, Western Blot

    Re-expression of miR-203 in U251AR and U87AR cells sensitizes cells to anticancer drugs and reverses EMT while knockdown of miR-203 promotes resistance to anticancer drugs in U251 and U87 cells (A) qRT-PCR data validation of the downregulation of miR-203 in imatinib-resistant GBM cells compared with their parental cells, normalized to U6RNA, which was obtained from miRNA microarrays. (B, C) The sensitivities of U251AR and U87AR cells to imatinib, VP-16 and TMZ after transfected with miR-203 or miRNAs control. (D, E) Transfection with anti-miR-203 promotes resistance to imatinib, VP-16 and TMZ in U251 and U87 cells. (F) Morphology of U251AR and U87AR cells transfected with miRNA control or miR-203. Scale bar, 100 μm. (G) Western blotting show that re-expression of miR-203 modulates the expression of EMT markers. (H, I) U251AR and U87AR cells were transfected with miR-203 or anti-miR-203, and then collected for transwell invasion assay or wound healing assay. Shown were pictures of representative fields for each experiment. Scale bar, 200 μm. Data were expressed as mean±s.d. from three independent experiments. VP-16, etoposide; TMZ, temozolomide. * P

    Journal: Oncotarget

    Article Title: MiR-203 downregulation is responsible for chemoresistance in human glioblastoma by promoting epithelial-mesenchymal transition via SNAI2

    doi:

    Figure Lengend Snippet: Re-expression of miR-203 in U251AR and U87AR cells sensitizes cells to anticancer drugs and reverses EMT while knockdown of miR-203 promotes resistance to anticancer drugs in U251 and U87 cells (A) qRT-PCR data validation of the downregulation of miR-203 in imatinib-resistant GBM cells compared with their parental cells, normalized to U6RNA, which was obtained from miRNA microarrays. (B, C) The sensitivities of U251AR and U87AR cells to imatinib, VP-16 and TMZ after transfected with miR-203 or miRNAs control. (D, E) Transfection with anti-miR-203 promotes resistance to imatinib, VP-16 and TMZ in U251 and U87 cells. (F) Morphology of U251AR and U87AR cells transfected with miRNA control or miR-203. Scale bar, 100 μm. (G) Western blotting show that re-expression of miR-203 modulates the expression of EMT markers. (H, I) U251AR and U87AR cells were transfected with miR-203 or anti-miR-203, and then collected for transwell invasion assay or wound healing assay. Shown were pictures of representative fields for each experiment. Scale bar, 200 μm. Data were expressed as mean±s.d. from three independent experiments. VP-16, etoposide; TMZ, temozolomide. * P

    Article Snippet: After 24 h, the cells were treated with different concentrations of imatinib (Novartis, Basel, Switzerland), etoposide (VP-16) (Sigma Chemical Co., St. Louis, MO) and temozolomide (TMZ) (Sigma Chemical Co., St. Louis, MO), each at four concentrations ranging from 50 to 200 μg/ml for 48 h. The range of drug concentrations were based on earlier studies and aimed at obtaining IC50 values both for highly sensitive and resistant cases.

    Techniques: Expressing, Quantitative RT-PCR, Transfection, Western Blot, Transwell Invasion Assay, Wound Healing Assay

    SNAI2 contributes to chemoresistance and EMT in GBM cells (A) Overexpression of SNAI2 promotes resistance to imatinib, VP-16 and TMZ. (B) Morphology of U87 cells transfected with pcDNA3.1-mock or pcDNA3.1-SNAI2. Scale bar, 100 μm. (C) Invasion of U87 cells after pcDNA3.1-SNAI2 transfection. Scale bar, 200 μm. (D) Protein expression of EMT markers in U87 cells transfected with pcDNA3.1-mock or pcDNA3.1-SNAI2, determined by western blotting. (E) The sensitivities to imatinib, VP-16 and TMZ were measured after cells transfected with indicated constructs and miR-203 in U251AR. (F) Invasion assay of U251AR cells expressing indicated vectors and miR-203. (G) qRT-PCR for EMT markers in U251AR cells expressing indicated constructs and miR-203. * P

    Journal: Oncotarget

    Article Title: MiR-203 downregulation is responsible for chemoresistance in human glioblastoma by promoting epithelial-mesenchymal transition via SNAI2

    doi:

    Figure Lengend Snippet: SNAI2 contributes to chemoresistance and EMT in GBM cells (A) Overexpression of SNAI2 promotes resistance to imatinib, VP-16 and TMZ. (B) Morphology of U87 cells transfected with pcDNA3.1-mock or pcDNA3.1-SNAI2. Scale bar, 100 μm. (C) Invasion of U87 cells after pcDNA3.1-SNAI2 transfection. Scale bar, 200 μm. (D) Protein expression of EMT markers in U87 cells transfected with pcDNA3.1-mock or pcDNA3.1-SNAI2, determined by western blotting. (E) The sensitivities to imatinib, VP-16 and TMZ were measured after cells transfected with indicated constructs and miR-203 in U251AR. (F) Invasion assay of U251AR cells expressing indicated vectors and miR-203. (G) qRT-PCR for EMT markers in U251AR cells expressing indicated constructs and miR-203. * P

    Article Snippet: After 24 h, the cells were treated with different concentrations of imatinib (Novartis, Basel, Switzerland), etoposide (VP-16) (Sigma Chemical Co., St. Louis, MO) and temozolomide (TMZ) (Sigma Chemical Co., St. Louis, MO), each at four concentrations ranging from 50 to 200 μg/ml for 48 h. The range of drug concentrations were based on earlier studies and aimed at obtaining IC50 values both for highly sensitive and resistant cases.

    Techniques: Over Expression, Transfection, Expressing, Western Blot, Construct, Invasion Assay, Quantitative RT-PCR

    Effects of engraftment location, estrogen, and immune suppressant on tumorigenicity of breast cancer cells NOD/SCID mice were treated ± 17β-estradiol (E 2 ) and etoposide as indicated. Six days later, mice were surgically incised and injected with 500 cells from a breast cancer pleural effusion in 25% Matrigel. A: final tumor volume. Data represent mean ± SE. B: tumor incidence. C: latency of tumor formation following injection (* P

    Journal: Journal of cellular physiology

    Article Title: Local regulation of human breast xenograft models

    doi: 10.1002/jcp.22190

    Figure Lengend Snippet: Effects of engraftment location, estrogen, and immune suppressant on tumorigenicity of breast cancer cells NOD/SCID mice were treated ± 17β-estradiol (E 2 ) and etoposide as indicated. Six days later, mice were surgically incised and injected with 500 cells from a breast cancer pleural effusion in 25% Matrigel. A: final tumor volume. Data represent mean ± SE. B: tumor incidence. C: latency of tumor formation following injection (* P

    Article Snippet: Six days prior to cell injection, mice were treated ± subcutaneous 17β-estradiol pellet (0.72 mg, 90-day release; Innovative Research of America, Sarasota, FL) and ± the bone marrow suppressant VP-16 (etoposide, a commonly used immune suppressant, 0.6 mg; Calbiochem, Gibbstown, NJ) administered i.p. ( ; ; ).

    Techniques: Mouse Assay, Injection

    Actin polymerization increases in response to DNA damage. A. U2OS cells were treated with ETO (10 µM) or untreated as control for 24 h, and images were captured at the indicated time points. B. The cell length and width were analyzed with Image J software in ≥100 cells per condition. C . U2OS cells were treated with ETO (10 µM) or untreated as control for 24 h, the intensity of phalloidin was measured with Image Pro Plus software. Scale bar, 10 µm. D. U2OS cells were treated with ETO (10 µM) or untreated as control for 24 h, and fluorescence assays were performed with a fluorescence microplate reader to measure cellular F-actin levels (phalloidin intensity/DAPI intensity). E. Cells were treated with ETO (10 µM) at indicated time points, and then whole cell extracts were analyzed by western blotting using anti-γH2AX antibody (a). U2OS cells were treated with ETO (10 µM) or untreated as control for 24 h. Then, immunofluorescence was performed to detect the signal of γH2AX (b). Scale bar, 10 µm. All Statistical differences were determined by One-way ANOVA. Results are presented as means ± SD of values from three independent experiments. ETO, etoposide.

    Journal: PLoS ONE

    Article Title: Actin Polymerization Negatively Regulates p53 Function by Impairing Its Nuclear Import in Response to DNA Damage

    doi: 10.1371/journal.pone.0060179

    Figure Lengend Snippet: Actin polymerization increases in response to DNA damage. A. U2OS cells were treated with ETO (10 µM) or untreated as control for 24 h, and images were captured at the indicated time points. B. The cell length and width were analyzed with Image J software in ≥100 cells per condition. C . U2OS cells were treated with ETO (10 µM) or untreated as control for 24 h, the intensity of phalloidin was measured with Image Pro Plus software. Scale bar, 10 µm. D. U2OS cells were treated with ETO (10 µM) or untreated as control for 24 h, and fluorescence assays were performed with a fluorescence microplate reader to measure cellular F-actin levels (phalloidin intensity/DAPI intensity). E. Cells were treated with ETO (10 µM) at indicated time points, and then whole cell extracts were analyzed by western blotting using anti-γH2AX antibody (a). U2OS cells were treated with ETO (10 µM) or untreated as control for 24 h. Then, immunofluorescence was performed to detect the signal of γH2AX (b). Scale bar, 10 µm. All Statistical differences were determined by One-way ANOVA. Results are presented as means ± SD of values from three independent experiments. ETO, etoposide.

    Article Snippet: Etoposide (ETO), a DNA damage inducer used in the present study, was from Sigma.

    Techniques: Software, Fluorescence, Western Blot, Immunofluorescence

    Induction of H-sema E mRNA in CDDP-sensitive cells. ( a ) Induction of H-sema E in CDDP-sensitive TYKnu cells by CDDP treatment. TYKnu cells were treated for 3 days with 0.0 (untreated control, lane 3), 0.1 (lane 4), 0.3 (lane 5), or 1.0 (lane 6) μg/ml CDDP. The constitutive expression of H-sema E by CDDP-resistant TYKnuR cells (lane 1) was not affected by the 3-day treatment with 1.0 μg/ml CDDP (lane 2). The relative intensity of the blots compared with lane 3 was 5.4 (lane 1), 6.3 (lane 2), 0.2 (lane 4), 1.5 (lane 5), and 4.3 (lane 6). ( b ) Time-dependent induction of H-sema E in CDDP-sensitive Lu65 cells. Lu65 cells were untreated or treated with 2.0 μg/ml CDDP for 6 to 72 hr (hereafter, lanes marked “0” represent untreated controls). The relative intensity of the blots compared with the untreated control was 1.1 (6 hr), 1.0 (24 hr), 2.0 (48 hr), and 3.7 (72 hr). ( c ) Dose-dependent induction of H-sema E in CDDP-sensitive Lu65 cells by the platinum-containing compounds, CBDCA and CDDP. H-sema E was induced in a dose-dependent manner by 3-day treatment with 3–30 μg/ml CBDCA or 0.5–2.0 μg/ml CDDP. The relative intensity of the blots compared with the untreated controls was 1.8 (3 μg/ml CBDCA), 1.8 (10 μg/ml CBDCA), 3.4 (30 μg/ml CBDCA), 1.2 (0.5 μg/ml CDDP), 2.9 (1.0 μg/ml CDDP), and 5.7 (2.0 μg/ml CDDP). ( d ) Induction of H-sema E in CDDP-sensitive Lu65 cells by non-platinum-containing anti-cancer compounds. H-sema E was induced by 3-day treatment with 0.1 and 0.2 μg/ml MMC, 0.1 μg/ml ADM, and 1.0 μg/ml VP-16. The relative intensity of the blots compared with the untreated controls was 2.2 (0.1 μg/ml MMC), 2.7 (0.2 μg/ml MMC), 2.9 (0.1 μg/ml ADM), and 3.1 (1.0 μg/ml VP-16). ( e ) Time- and dose-dependent induction of H-sema E in CDDP-sensitive Lu65 cells by UV irradiation. Total RNA was extracted from Lu65 cells 3 days after UV irradiation at 20, 40, or 80 J/m 2 ( Left ), or 24, 48, or 72 hr after UV irradiation at 80 J/m 2 ( Right ). The relative intensity of the blots compared with the untreated controls was 1.1 (20 J/m 2 ), 1.5 (40 J/m 2 ), 2.5 (80 J/m 2 ), 0.6 (24 hr), 2.0 (48 hr), and 3.2 (72 hr). ( f ) Induction of H-sema E in CDDP-sensitive Lu65 cells by x-ray irradiation. Total RNA was extracted from Lu65 cells 3 days after irradiation at a dose of 3 or 10 Gy. The relative intensity of the blots compared with the untreated control was 0.7 (3 Gy) and 3.9 (10 Gy).

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Identification of semaphorin E as a non-MDR drug resistance gene of human cancers

    doi:

    Figure Lengend Snippet: Induction of H-sema E mRNA in CDDP-sensitive cells. ( a ) Induction of H-sema E in CDDP-sensitive TYKnu cells by CDDP treatment. TYKnu cells were treated for 3 days with 0.0 (untreated control, lane 3), 0.1 (lane 4), 0.3 (lane 5), or 1.0 (lane 6) μg/ml CDDP. The constitutive expression of H-sema E by CDDP-resistant TYKnuR cells (lane 1) was not affected by the 3-day treatment with 1.0 μg/ml CDDP (lane 2). The relative intensity of the blots compared with lane 3 was 5.4 (lane 1), 6.3 (lane 2), 0.2 (lane 4), 1.5 (lane 5), and 4.3 (lane 6). ( b ) Time-dependent induction of H-sema E in CDDP-sensitive Lu65 cells. Lu65 cells were untreated or treated with 2.0 μg/ml CDDP for 6 to 72 hr (hereafter, lanes marked “0” represent untreated controls). The relative intensity of the blots compared with the untreated control was 1.1 (6 hr), 1.0 (24 hr), 2.0 (48 hr), and 3.7 (72 hr). ( c ) Dose-dependent induction of H-sema E in CDDP-sensitive Lu65 cells by the platinum-containing compounds, CBDCA and CDDP. H-sema E was induced in a dose-dependent manner by 3-day treatment with 3–30 μg/ml CBDCA or 0.5–2.0 μg/ml CDDP. The relative intensity of the blots compared with the untreated controls was 1.8 (3 μg/ml CBDCA), 1.8 (10 μg/ml CBDCA), 3.4 (30 μg/ml CBDCA), 1.2 (0.5 μg/ml CDDP), 2.9 (1.0 μg/ml CDDP), and 5.7 (2.0 μg/ml CDDP). ( d ) Induction of H-sema E in CDDP-sensitive Lu65 cells by non-platinum-containing anti-cancer compounds. H-sema E was induced by 3-day treatment with 0.1 and 0.2 μg/ml MMC, 0.1 μg/ml ADM, and 1.0 μg/ml VP-16. The relative intensity of the blots compared with the untreated controls was 2.2 (0.1 μg/ml MMC), 2.7 (0.2 μg/ml MMC), 2.9 (0.1 μg/ml ADM), and 3.1 (1.0 μg/ml VP-16). ( e ) Time- and dose-dependent induction of H-sema E in CDDP-sensitive Lu65 cells by UV irradiation. Total RNA was extracted from Lu65 cells 3 days after UV irradiation at 20, 40, or 80 J/m 2 ( Left ), or 24, 48, or 72 hr after UV irradiation at 80 J/m 2 ( Right ). The relative intensity of the blots compared with the untreated controls was 1.1 (20 J/m 2 ), 1.5 (40 J/m 2 ), 2.5 (80 J/m 2 ), 0.6 (24 hr), 2.0 (48 hr), and 3.2 (72 hr). ( f ) Induction of H-sema E in CDDP-sensitive Lu65 cells by x-ray irradiation. Total RNA was extracted from Lu65 cells 3 days after irradiation at a dose of 3 or 10 Gy. The relative intensity of the blots compared with the untreated control was 0.7 (3 Gy) and 3.9 (10 Gy).

    Article Snippet: CDDP, cis -diammine (1,1-cyclobutane) dicarboxylatoplatinum(II) (CBDCA), etoposide (VP-16) (Bristol-Myers Squibb, Tokyo), mitomycin C (MMC), and doxorubicin (ADM) (Kyowa Hakko Kogyo, Tokyo) were prepared for clinical use.

    Techniques: Expressing, Irradiation

    TuBECs and BECs respond differently to various cytotoxic agents. TuBECs and BECs were treated with VP-16 ( A ; 10, 50 μmol/L), paclitaxel (Tax) ( B ; 3, 10 ng/ml), thapsigargin (Thap) ( C ; 10, 30 nmol/L), or temozolomide (Tmz) ( D ; 100, 300 μmol/L).

    Journal:

    Article Title: Increased Survivin Expression Confers Chemoresistance to Tumor-Associated Endothelial Cells

    doi: 10.2353/ajpath.2008.071079

    Figure Lengend Snippet: TuBECs and BECs respond differently to various cytotoxic agents. TuBECs and BECs were treated with VP-16 ( A ; 10, 50 μmol/L), paclitaxel (Tax) ( B ; 3, 10 ng/ml), thapsigargin (Thap) ( C ; 10, 30 nmol/L), or temozolomide (Tmz) ( D ; 100, 300 μmol/L).

    Article Snippet: Similar results for VP-16, paclitaxel, and thapsigargin treatments were obtained using the LDH release assay .

    Techniques:

    DCLK1 compromises DNA repair in human colon cancer HCT116 and human lung cancer H1299 cells. The experimental design is demonstrated on the top in A. HCT116 (A) or H1299 (B) cells were transfected with pCIneoEGFP-DCLK1. 24 h later, the cells were exposed to 20 μM VP-16 for 3 h and then VP-16 was washed out. Cells were fixed and γH2A.X was immunostained. γH2A.X remained in cells expressing GFP-DCLK1 at 24 h after VP-16 removal (arrowheads), while γH2A.X was undetectable in cells without GFP-DCLK1. 100 cells for each sample were observed and the ratios of γH2A.X-positive cells were calculated. Experiments were repeated three times. Bar graphs show mean +/- SD. n.s., not significant; * *, p

    Journal: Biochemistry and Biophysics Reports

    Article Title: Doublecortin-like kinase 1 compromises DNA repair and induces chromosomal instability

    doi: 10.1016/j.bbrep.2018.10.014

    Figure Lengend Snippet: DCLK1 compromises DNA repair in human colon cancer HCT116 and human lung cancer H1299 cells. The experimental design is demonstrated on the top in A. HCT116 (A) or H1299 (B) cells were transfected with pCIneoEGFP-DCLK1. 24 h later, the cells were exposed to 20 μM VP-16 for 3 h and then VP-16 was washed out. Cells were fixed and γH2A.X was immunostained. γH2A.X remained in cells expressing GFP-DCLK1 at 24 h after VP-16 removal (arrowheads), while γH2A.X was undetectable in cells without GFP-DCLK1. 100 cells for each sample were observed and the ratios of γH2A.X-positive cells were calculated. Experiments were repeated three times. Bar graphs show mean +/- SD. n.s., not significant; * *, p

    Article Snippet: The antibodies and reagents were obtained from commercial sources: mouse anti-γH2A.X (Ser139) (clone JBW301) (05-636) (Merck Millipore, Burlington, MA, USA); human recombinant epidermal growth factor (EGF) (059–07873), human recombinant insulin (099–06473), basic fibroblast growth factor (bFGF) (062–06661), hydrocortisone (082–02481), methyl cellulose 400 (132–05055), and anti-DYKDDDDK-tag beads (016–22784) (Wako Pure Chemical Industries, Ltd., Osaka, Japan); mouse anti-E-cadherin (clone 36/E-cadherin) (610181), and mouse anti-N-cadherin (clone 32/N-cadherin) (610921), (BD Biosciences, San Jose, CA, USA); rabbit anti-CD44 (15675–1-AP) (Proteintech, Chicago, IL, USA); rabbit anti-Myc (562), and rabbit anti-β-actin (PM053) (Medical & Biological Laboratories Co., Ltd., Nagoya, Japan); etoposide (VP-16) (E0675) (Tokyo Chemical Industry Co., Ltd., Tokyo, Japan); mouse anti-vimentin (clone V9) (sc-6260) (Santa Cruz Biotechnology, Inc., Dallas, TX, USA); rabbit anti-CTGF (ab6992) (Abcam, Cambridge, UK); rabbit anti-WWTR1 (HPA007415), hexadimethrine bromide (H9268), and Hoechst33342 (14533) (Sigma-Aldrich, St. Louis, MO, USA); mouse anti-p53 (DO-1) (NCL-p53-DO1) (Leica Biosystems, Wetzlar, Germany); peroxidase-conjugated goat anti-mouse (55550) and anti-rabbit (55685) secondary antibodies (MP Biomedicals, Santa Ana, CA, USA); Alexa Fluor® 568 goat anti-mouse IgG (A-11031), puromycin (A1113803), 4′,6-diamidino-2-phenylindole (DAPI), and KaryoMAX™ Colcemid™ Solution (Thermo Fisher Scientific, Waltham, MA, USA).

    Techniques: Transfection, Expressing

    DNA damage induces de-phosphorylation of nuclear Tau. ( a ) The effect of Etoposide and Vinblastine treatment on mouse C17.2 cells is shown by confocal microscopy upon immune staining of PFA-fixed cells with antibodies against the microtubule marker β-tubulin (in cyan) or the DNA damage marker γH2A-X (in red). ( b ) Confocal microscopic quantification of the activated kinases in the nucleus (DAPI mask). Mean percent ± sem relative to the respective controls. 2-tailed unpaired Mann-Whitney test, ****p

    Journal: Scientific Reports

    Article Title: Phosphorylation of nuclear Tau is modulated by distinct cellular pathways

    doi: 10.1038/s41598-018-36374-4

    Figure Lengend Snippet: DNA damage induces de-phosphorylation of nuclear Tau. ( a ) The effect of Etoposide and Vinblastine treatment on mouse C17.2 cells is shown by confocal microscopy upon immune staining of PFA-fixed cells with antibodies against the microtubule marker β-tubulin (in cyan) or the DNA damage marker γH2A-X (in red). ( b ) Confocal microscopic quantification of the activated kinases in the nucleus (DAPI mask). Mean percent ± sem relative to the respective controls. 2-tailed unpaired Mann-Whitney test, ****p

    Article Snippet: Drug treatments During the last 5 h of tetracycline incubation, C17.2 cells with inducible Tau expression were treated with 60 µM Etoposide (Abcam, ab120227; 100 mM stock in DMSO), 3 µM Vinblastine (Sigma-Aldrich, V1377; 11 mM stock in DMSO), or 60 nM Leptomycin B (Sigma-Aldrich, L2913; 10.3 µM in 70% ethanol).

    Techniques: De-Phosphorylation Assay, Confocal Microscopy, Staining, Marker, MANN-WHITNEY

    OTIs designed against a patient-observed PML-RARA translocation increase DNA cleavage mediated by human type II topoisomerases. ( A ) Sequences of the top and bottom strands of each PML-RARA duplex are shown. The blue portion corresponds to the segment derived from the PML gene, and the orange portion corresponds to the segment derived from the RARA gene. The yellow box indicates the position of the tethered etoposide core on each OTI (bottom strand). The OTIs were 50, 30 or 20 bases in length (black lines below the diagram). Arrows indicate sites of DNA cleavage induced by free etoposide (blue) and the translocation OTIs (yellow). ( B ) Comparison of DNA cleavage mediated by human topoisomerase IIα (hTIIα, left) and topoisomerase IIβ (hTIIβ, right) of the radiolabeled, unmodified PML-RARA top/target strand hybridized to an unmodified PML-RARA bottom strand in the presence of free etoposide or of the radiolabeled PML-RARA top strand hybridized to a 50-mer, 30-mer or 20-mer PML-RARA OTI bottom strand. Lanes 1–5 contain the unmodified PML-RARA duplex in the absence of enzyme, or in the presence of enzyme and 0–500 μM free etoposide. Lanes 7 and 8 contain the unmodified PML-RARA top strand hybridized with the 50-mer OTI. Lanes 10 and 11 contain the unmodified top strand hybridized with the 30-mer OTI. Lanes 13 and 14 contain the unmodified top strand hybridized with the 20-mer OTI. Lanes 6, 10, 13, and 15 contain reference (R) oligonucleotides 24, 23, 20 and 19 bases in length. Gels are representative of at least three independent experiments. ( C ) Quantification of the relative levels of enzyme-mediated DNA cleavage. DNA cleavage at each site is normalized to the cleavage observed at site 24–25 in reactions containing an unmodified duplex in the absence of etoposide (lane 2). Results with unmodified PML – RARA duplex in the presence of 500 μM free etoposide (blue) or with unmodified top strand hybridized with 50-mer OTI (yellow), 30-mer OTI (orange), or 20-mer OTI (green) bottom strand are shown. Error bars represent the standard deviation of at least three independent experiments. Significance was determined by paired t -tests. P -values are indicated by asterisks (* P

    Journal: Nucleic Acids Research

    Article Title: Coupling the core of the anticancer drug etoposide to an oligonucleotide induces topoisomerase II-mediated cleavage at specific DNA sequences

    doi: 10.1093/nar/gky072

    Figure Lengend Snippet: OTIs designed against a patient-observed PML-RARA translocation increase DNA cleavage mediated by human type II topoisomerases. ( A ) Sequences of the top and bottom strands of each PML-RARA duplex are shown. The blue portion corresponds to the segment derived from the PML gene, and the orange portion corresponds to the segment derived from the RARA gene. The yellow box indicates the position of the tethered etoposide core on each OTI (bottom strand). The OTIs were 50, 30 or 20 bases in length (black lines below the diagram). Arrows indicate sites of DNA cleavage induced by free etoposide (blue) and the translocation OTIs (yellow). ( B ) Comparison of DNA cleavage mediated by human topoisomerase IIα (hTIIα, left) and topoisomerase IIβ (hTIIβ, right) of the radiolabeled, unmodified PML-RARA top/target strand hybridized to an unmodified PML-RARA bottom strand in the presence of free etoposide or of the radiolabeled PML-RARA top strand hybridized to a 50-mer, 30-mer or 20-mer PML-RARA OTI bottom strand. Lanes 1–5 contain the unmodified PML-RARA duplex in the absence of enzyme, or in the presence of enzyme and 0–500 μM free etoposide. Lanes 7 and 8 contain the unmodified PML-RARA top strand hybridized with the 50-mer OTI. Lanes 10 and 11 contain the unmodified top strand hybridized with the 30-mer OTI. Lanes 13 and 14 contain the unmodified top strand hybridized with the 20-mer OTI. Lanes 6, 10, 13, and 15 contain reference (R) oligonucleotides 24, 23, 20 and 19 bases in length. Gels are representative of at least three independent experiments. ( C ) Quantification of the relative levels of enzyme-mediated DNA cleavage. DNA cleavage at each site is normalized to the cleavage observed at site 24–25 in reactions containing an unmodified duplex in the absence of etoposide (lane 2). Results with unmodified PML – RARA duplex in the presence of 500 μM free etoposide (blue) or with unmodified top strand hybridized with 50-mer OTI (yellow), 30-mer OTI (orange), or 20-mer OTI (green) bottom strand are shown. Error bars represent the standard deviation of at least three independent experiments. Significance was determined by paired t -tests. P -values are indicated by asterisks (* P

    Article Snippet: Synthesis of the activated etoposide core, shown in the top portion of Figure , started with commercially available DEPT ( 1 ) (ABCAM Biochemicals).

    Techniques: Translocation Assay, Derivative Assay, Standard Deviation

    Structure-guided design of an OTI. ( A ) Schematic illustrating domains of type II topoisomerases used to determine the crystal structure of human topoisomerase IIβ covalently attached to DNA (green) in the presence of etoposide (orange). Domains pictured are TOPRIM (Top), winged helix domain (WHD), tower domain (Tow), and exit gate domain (Ex). ( B ) Schematic of topoisomerase II function. Protein protomer subunits are shown in blue and gray. T DNA, transport double helix (black); G DNA, gate double helix (green). ( C, D ) Detail from the crystal structure of a topoisomerase IIβ cleavage complex with two bound etoposide molecules (orange) stabilizing a double-stranded DNA (green) break; PDB code 3QX3. For clarity, in panel C, only the Cα trace of the protein subunits (blue and black lines) and catalytic tyrosines (blue and gray sticks) are shown. In panel D, only the catalytic tyrosine residues that cleave the DNA are shown. The conventional numbering scheme used for DNA cleavage complexes formed by type II topoisomerases is shown. The enzyme cleaves between the -1 and the +1 on each strand. The numbering on the two strands in the double helix is differentiated by the presence or absence of asterisks. The catalytic tyrosine residues are covalently attached to the DNA at the +1 positions. ( E , F ) Model of a cleavage complex with one bound etoposide molecule stabilizing a single-stranded DNA break. The cleaved DNA strand is indicated by asterisks. The protein subunits shown are the same as those in C and D. ( G ) Chemical (left) and modeled (right) structure of the etoposide core (DEPT) linked to the pyrimidine base. ( H ) OTI28 (orange strand) modeled with the modified cytosine base in the +5* position, stabilizing DNA scission at the 23–24 site (–1 to +1) on the cleaved target strand (green). Structural figures were drawn with Pymol (The PyMOL Molecular Graphics System, Version 1.8 Schrödinger, LLC).

    Journal: Nucleic Acids Research

    Article Title: Coupling the core of the anticancer drug etoposide to an oligonucleotide induces topoisomerase II-mediated cleavage at specific DNA sequences

    doi: 10.1093/nar/gky072

    Figure Lengend Snippet: Structure-guided design of an OTI. ( A ) Schematic illustrating domains of type II topoisomerases used to determine the crystal structure of human topoisomerase IIβ covalently attached to DNA (green) in the presence of etoposide (orange). Domains pictured are TOPRIM (Top), winged helix domain (WHD), tower domain (Tow), and exit gate domain (Ex). ( B ) Schematic of topoisomerase II function. Protein protomer subunits are shown in blue and gray. T DNA, transport double helix (black); G DNA, gate double helix (green). ( C, D ) Detail from the crystal structure of a topoisomerase IIβ cleavage complex with two bound etoposide molecules (orange) stabilizing a double-stranded DNA (green) break; PDB code 3QX3. For clarity, in panel C, only the Cα trace of the protein subunits (blue and black lines) and catalytic tyrosines (blue and gray sticks) are shown. In panel D, only the catalytic tyrosine residues that cleave the DNA are shown. The conventional numbering scheme used for DNA cleavage complexes formed by type II topoisomerases is shown. The enzyme cleaves between the -1 and the +1 on each strand. The numbering on the two strands in the double helix is differentiated by the presence or absence of asterisks. The catalytic tyrosine residues are covalently attached to the DNA at the +1 positions. ( E , F ) Model of a cleavage complex with one bound etoposide molecule stabilizing a single-stranded DNA break. The cleaved DNA strand is indicated by asterisks. The protein subunits shown are the same as those in C and D. ( G ) Chemical (left) and modeled (right) structure of the etoposide core (DEPT) linked to the pyrimidine base. ( H ) OTI28 (orange strand) modeled with the modified cytosine base in the +5* position, stabilizing DNA scission at the 23–24 site (–1 to +1) on the cleaved target strand (green). Structural figures were drawn with Pymol (The PyMOL Molecular Graphics System, Version 1.8 Schrödinger, LLC).

    Article Snippet: Synthesis of the activated etoposide core, shown in the top portion of Figure , started with commercially available DEPT ( 1 ) (ABCAM Biochemicals).

    Techniques: Modification

    ). ( A ) Cleavage between bases 24–25 is depicted on the target (top) strand (green). ( B ) Cleavage between bases 23–24 is depicted on the target strand (green). The bottom (OTI) strand is shown in orange. The tethered etoposide core is shown in yellow (carbons, yellow; nitrogen, blue; oxygen, red). A Cα trace is shown for the two topoisomerase II subunits (blue and black lines) in the top panels. The bottom panels include a semi-transparent molecular surface, illustrating that the linker does not clash with the protein. The sequence diagram (middle) shows the position of the tethered etoposide core on OTI28 (yellow box). Black arrows indicate the cleavage sites.

    Journal: Nucleic Acids Research

    Article Title: Coupling the core of the anticancer drug etoposide to an oligonucleotide induces topoisomerase II-mediated cleavage at specific DNA sequences

    doi: 10.1093/nar/gky072

    Figure Lengend Snippet: ). ( A ) Cleavage between bases 24–25 is depicted on the target (top) strand (green). ( B ) Cleavage between bases 23–24 is depicted on the target strand (green). The bottom (OTI) strand is shown in orange. The tethered etoposide core is shown in yellow (carbons, yellow; nitrogen, blue; oxygen, red). A Cα trace is shown for the two topoisomerase II subunits (blue and black lines) in the top panels. The bottom panels include a semi-transparent molecular surface, illustrating that the linker does not clash with the protein. The sequence diagram (middle) shows the position of the tethered etoposide core on OTI28 (yellow box). Black arrows indicate the cleavage sites.

    Article Snippet: Synthesis of the activated etoposide core, shown in the top portion of Figure , started with commercially available DEPT ( 1 ) (ABCAM Biochemicals).

    Techniques: Sequencing

    OTI28 inhibits DNA ligation and stabilizes cleavage complexes similarly to free etoposide. ( A ) Enzyme-mediated ligation of DNA. ( B ) Persistence of cleavage complexes. For both A and B, cleavage results of the unmodified PML duplex in the presence of 500 μM free etoposide are shown in blue and those with an unmodified PML top/target strand hybridized to OTI28 are shown in yellow. Error bars represent the standard deviation of at least three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: Coupling the core of the anticancer drug etoposide to an oligonucleotide induces topoisomerase II-mediated cleavage at specific DNA sequences

    doi: 10.1093/nar/gky072

    Figure Lengend Snippet: OTI28 inhibits DNA ligation and stabilizes cleavage complexes similarly to free etoposide. ( A ) Enzyme-mediated ligation of DNA. ( B ) Persistence of cleavage complexes. For both A and B, cleavage results of the unmodified PML duplex in the presence of 500 μM free etoposide are shown in blue and those with an unmodified PML top/target strand hybridized to OTI28 are shown in yellow. Error bars represent the standard deviation of at least three independent experiments.

    Article Snippet: Synthesis of the activated etoposide core, shown in the top portion of Figure , started with commercially available DEPT ( 1 ) (ABCAM Biochemicals).

    Techniques: DNA Ligation, Ligation, Standard Deviation

    An oligonucleotide-linked etoposide core increases topoisomerase II-mediated DNA cleavage. ( A ) The central 30 base pairs of a double stranded 50-mer oligonucleotide sequence corresponding to bases 1471–1500 (top strand) of PML intron 6 is shown. The yellow box denotes the position of the tethered etoposide core and linker moieties on OTI28 or LIN28. Arrows indicate sites of DNA cleavage induced by free etoposide (blue) or OTI28 (yellow). ( B ) Comparison of DNA cleavage mediated by human topoisomerase IIα (hTIIα, left) and topoisomerase IIβ (hTIIβ, right) of the radiolabeled, unmodified PML top strand hybridized to an unmodified PML bottom strand in the presence of free etoposide or hybridized to OTI28 (bottom strand). For each gel, lane 1 contains the unmodified PML oligonucleotide. Lanes 2–5 contain the unmodified PML duplex treated with 0–500 μM free etoposide. Lanes 7 and 8 contain the unmodified PML top strand hybridized with OTI28. Lanes 10 and 11 contain the unmodified top strand duplexed with LIN28 (bottom strand oligonucleotide that contains the linker at position 28 with no attached etoposide core). Lanes 6, 9, and 12 contain reference (R) oligonucleotides that were 24, 23 and 19 bases in length. Gels are representative of at least three independent experiments. ( C ) Quantification of the relative levels of DNA cleavage mediated by topoisomerase IIα (left) and topoisomerase IIβ (right). DNA cleavage at each site was normalized to the cleavage observed at site 24–25 in reactions containing unmodified duplex in the absence of etoposide (lane 2). Cleavage results of the unmodified duplex in the presence of 500 μM free etoposide are shown in blue (lane 5) and those with an unmodified top strand hybridized to OTI28 are shown in yellow (lane 8). Error bars represent the standard error of the mean of an average of two to five independent experiments. Significance was determined by paired t-tests. P -values are indicated by asterisks (* P

    Journal: Nucleic Acids Research

    Article Title: Coupling the core of the anticancer drug etoposide to an oligonucleotide induces topoisomerase II-mediated cleavage at specific DNA sequences

    doi: 10.1093/nar/gky072

    Figure Lengend Snippet: An oligonucleotide-linked etoposide core increases topoisomerase II-mediated DNA cleavage. ( A ) The central 30 base pairs of a double stranded 50-mer oligonucleotide sequence corresponding to bases 1471–1500 (top strand) of PML intron 6 is shown. The yellow box denotes the position of the tethered etoposide core and linker moieties on OTI28 or LIN28. Arrows indicate sites of DNA cleavage induced by free etoposide (blue) or OTI28 (yellow). ( B ) Comparison of DNA cleavage mediated by human topoisomerase IIα (hTIIα, left) and topoisomerase IIβ (hTIIβ, right) of the radiolabeled, unmodified PML top strand hybridized to an unmodified PML bottom strand in the presence of free etoposide or hybridized to OTI28 (bottom strand). For each gel, lane 1 contains the unmodified PML oligonucleotide. Lanes 2–5 contain the unmodified PML duplex treated with 0–500 μM free etoposide. Lanes 7 and 8 contain the unmodified PML top strand hybridized with OTI28. Lanes 10 and 11 contain the unmodified top strand duplexed with LIN28 (bottom strand oligonucleotide that contains the linker at position 28 with no attached etoposide core). Lanes 6, 9, and 12 contain reference (R) oligonucleotides that were 24, 23 and 19 bases in length. Gels are representative of at least three independent experiments. ( C ) Quantification of the relative levels of DNA cleavage mediated by topoisomerase IIα (left) and topoisomerase IIβ (right). DNA cleavage at each site was normalized to the cleavage observed at site 24–25 in reactions containing unmodified duplex in the absence of etoposide (lane 2). Cleavage results of the unmodified duplex in the presence of 500 μM free etoposide are shown in blue (lane 5) and those with an unmodified top strand hybridized to OTI28 are shown in yellow (lane 8). Error bars represent the standard error of the mean of an average of two to five independent experiments. Significance was determined by paired t-tests. P -values are indicated by asterisks (* P

    Article Snippet: Synthesis of the activated etoposide core, shown in the top portion of Figure , started with commercially available DEPT ( 1 ) (ABCAM Biochemicals).

    Techniques: Sequencing

    OTI28 induces lower levels of DNA cleavage mediated by an etoposide-resistant mutant yeast topoisomerase II (H1011Y) as compared to wild-type yeast topoisomerase II. Quantification of the relative levels of enzyme-mediated DNA cleavage at site 24–25 (indicated as the band labeled 24 in the inset) mediated by wild-type (yTop2WT) and H1011Y mutant (yTop2H1011Y) yeast topoisomerase II on an unmodified PML top strand hybridized to OTI28 (graph: +enz, red; inset: +WT, +H1011Y). DNA cleavage is normalized to background levels of DNA when no enzyme is present (graph: -enz, blue; inset: -WT, -H1011Y). Error bars represent the standard deviation of three independent experiments. Significance was determined by a paired t -test. P -values are indicated by asterisks (*** P

    Journal: Nucleic Acids Research

    Article Title: Coupling the core of the anticancer drug etoposide to an oligonucleotide induces topoisomerase II-mediated cleavage at specific DNA sequences

    doi: 10.1093/nar/gky072

    Figure Lengend Snippet: OTI28 induces lower levels of DNA cleavage mediated by an etoposide-resistant mutant yeast topoisomerase II (H1011Y) as compared to wild-type yeast topoisomerase II. Quantification of the relative levels of enzyme-mediated DNA cleavage at site 24–25 (indicated as the band labeled 24 in the inset) mediated by wild-type (yTop2WT) and H1011Y mutant (yTop2H1011Y) yeast topoisomerase II on an unmodified PML top strand hybridized to OTI28 (graph: +enz, red; inset: +WT, +H1011Y). DNA cleavage is normalized to background levels of DNA when no enzyme is present (graph: -enz, blue; inset: -WT, -H1011Y). Error bars represent the standard deviation of three independent experiments. Significance was determined by a paired t -test. P -values are indicated by asterisks (*** P

    Article Snippet: Synthesis of the activated etoposide core, shown in the top portion of Figure , started with commercially available DEPT ( 1 ) (ABCAM Biochemicals).

    Techniques: Mutagenesis, Labeling, Standard Deviation

    Moving the position of the linked etoposide core along the bottom strand (OTI) sequence alters the topoisomerase II-mediated cleavage pattern of the top strand. ( A ) Sequences of the top/target and bottom PML strands are shown. The different-colored boxes indicate the position of the tethered etoposide core in each OTI (bottom strand), including OTI28 (yellow), OTI29 (orange), OTI33 (green), and OTI23 (purple). Arrows indicate the cleavage sites induced by each OTI (shown by corresponding colors). Large arrows indicate the major site of cleavage. T and B (first column) indicate top and bottom strands, respectively. ( B ) Comparison of DNA cleavage mediated by human topoisomerase IIα (hTIIα, left) and topoisomerase IIβ (hTIIβ, right) of the radiolabeled, unmodified PML top strand hybridized to an unmodified PML bottom strand in the presence of 0–500 μM free etoposide (lanes 2–3) or hybridized to the bottom strands OTI28 (lanes 5–6), OTI29 (lanes 8–9), OTI33 (lanes 11–12), or OTI23 (lanes 14–15). For each gel, lane 1 contains an unmodified PML duplex. Reference (R) oligonucleotides are 24, 23, 20 and 19 bases long. Gels are representative of at least three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: Coupling the core of the anticancer drug etoposide to an oligonucleotide induces topoisomerase II-mediated cleavage at specific DNA sequences

    doi: 10.1093/nar/gky072

    Figure Lengend Snippet: Moving the position of the linked etoposide core along the bottom strand (OTI) sequence alters the topoisomerase II-mediated cleavage pattern of the top strand. ( A ) Sequences of the top/target and bottom PML strands are shown. The different-colored boxes indicate the position of the tethered etoposide core in each OTI (bottom strand), including OTI28 (yellow), OTI29 (orange), OTI33 (green), and OTI23 (purple). Arrows indicate the cleavage sites induced by each OTI (shown by corresponding colors). Large arrows indicate the major site of cleavage. T and B (first column) indicate top and bottom strands, respectively. ( B ) Comparison of DNA cleavage mediated by human topoisomerase IIα (hTIIα, left) and topoisomerase IIβ (hTIIβ, right) of the radiolabeled, unmodified PML top strand hybridized to an unmodified PML bottom strand in the presence of 0–500 μM free etoposide (lanes 2–3) or hybridized to the bottom strands OTI28 (lanes 5–6), OTI29 (lanes 8–9), OTI33 (lanes 11–12), or OTI23 (lanes 14–15). For each gel, lane 1 contains an unmodified PML duplex. Reference (R) oligonucleotides are 24, 23, 20 and 19 bases long. Gels are representative of at least three independent experiments.

    Article Snippet: Synthesis of the activated etoposide core, shown in the top portion of Figure , started with commercially available DEPT ( 1 ) (ABCAM Biochemicals).

    Techniques: Sequencing

    An oligonucleotide with an abasic site analog at position 28 generates a different DNA cleavage pattern than does OTI28. Lanes 1–3 contain a radiolabeled unmodified PML top/target strand hybridized to an unmodified PML bottom strand in the absence of enzyme, or in the presence of enzyme and 0–500 μM free etoposide. Lanes 4 and 5 contain a radiolabeled PML top strand hybridized with OTI28 (bottom strand). Lanes 6 and 7 contain a radiolabeled unmodified PML top strand hybridized to a bottom strand oligonucleotide containing an abasic site analog at position 28 (AP28). Lane 8 contains reference (R) oligonucleotides that are 24, 23 and 19 bases in length. The gel is representative of at least three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: Coupling the core of the anticancer drug etoposide to an oligonucleotide induces topoisomerase II-mediated cleavage at specific DNA sequences

    doi: 10.1093/nar/gky072

    Figure Lengend Snippet: An oligonucleotide with an abasic site analog at position 28 generates a different DNA cleavage pattern than does OTI28. Lanes 1–3 contain a radiolabeled unmodified PML top/target strand hybridized to an unmodified PML bottom strand in the absence of enzyme, or in the presence of enzyme and 0–500 μM free etoposide. Lanes 4 and 5 contain a radiolabeled PML top strand hybridized with OTI28 (bottom strand). Lanes 6 and 7 contain a radiolabeled unmodified PML top strand hybridized to a bottom strand oligonucleotide containing an abasic site analog at position 28 (AP28). Lane 8 contains reference (R) oligonucleotides that are 24, 23 and 19 bases in length. The gel is representative of at least three independent experiments.

    Article Snippet: Synthesis of the activated etoposide core, shown in the top portion of Figure , started with commercially available DEPT ( 1 ) (ABCAM Biochemicals).

    Techniques:

    OTIs that incorporate an APL patient-derived PML-RARA translocation sequence do not increase DNA cleavage mediated by human type II topoisomerases when they are hybridized with the parental PML or RARA sequences. Comparison of DNA cleavage mediated by human topoisomerase IIα (hTIIα) ( A ) and topoisomerase IIβ (hTIIβ) ( B ) of the radiolabeled top strand of an unmodified PML-RARA duplex in the presence of free etoposide, a radiolabeled, unmodified PML or RARA top strand hybridized to a PML-RARA bottom strand in the presence of free etoposide, or a radiolabeled, unmodified PML or RARA top strand hybridized to a 50-mer OTI, a 30-mer OTI, or a 20-mer PML-RARA OTI bottom strand. For each gel, lanes 1–3 contain unmodified PML-RARA top/target strand hybridized to the unmodified 50-mer PML-RARA bottom strand, in the absence of enzyme, or in the presence of enzyme and 0–500 μM etoposide. Lanes 4–6 contain unmodified parental PML top/target strand hybridized to the unmodified 50-mer PML-RARA bottom strand, in the absence of enzyme, or in the presence of enzyme and 0–500 μM etoposide. Lanes 7–12 contain the unmodified parental PML top strand hybridized to the 50-mer, 30-mer or 20-mer PML-RARA OTI bottom strand in the absence or presence of enzyme. Lanes 14–16 contain unmodified parental RARA top strand hybridized to the 50-mer PML-RARA bottom strand, in the absence of enzyme, or in the presence of enzyme and 0–500 μM etoposide. Lanes 17–22 contain the unmodified parental RARA top strand hybridized to the 50-mer, 30-mer, or 20-mer PML-RARA OTI bottom strand in the absence or presence of enzyme. Lanes 13 and 23 contain a combination of reference (R) oligonucleotides 24, 23, 20 and 19 bases in length. Gels are representative of at least three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: Coupling the core of the anticancer drug etoposide to an oligonucleotide induces topoisomerase II-mediated cleavage at specific DNA sequences

    doi: 10.1093/nar/gky072

    Figure Lengend Snippet: OTIs that incorporate an APL patient-derived PML-RARA translocation sequence do not increase DNA cleavage mediated by human type II topoisomerases when they are hybridized with the parental PML or RARA sequences. Comparison of DNA cleavage mediated by human topoisomerase IIα (hTIIα) ( A ) and topoisomerase IIβ (hTIIβ) ( B ) of the radiolabeled top strand of an unmodified PML-RARA duplex in the presence of free etoposide, a radiolabeled, unmodified PML or RARA top strand hybridized to a PML-RARA bottom strand in the presence of free etoposide, or a radiolabeled, unmodified PML or RARA top strand hybridized to a 50-mer OTI, a 30-mer OTI, or a 20-mer PML-RARA OTI bottom strand. For each gel, lanes 1–3 contain unmodified PML-RARA top/target strand hybridized to the unmodified 50-mer PML-RARA bottom strand, in the absence of enzyme, or in the presence of enzyme and 0–500 μM etoposide. Lanes 4–6 contain unmodified parental PML top/target strand hybridized to the unmodified 50-mer PML-RARA bottom strand, in the absence of enzyme, or in the presence of enzyme and 0–500 μM etoposide. Lanes 7–12 contain the unmodified parental PML top strand hybridized to the 50-mer, 30-mer or 20-mer PML-RARA OTI bottom strand in the absence or presence of enzyme. Lanes 14–16 contain unmodified parental RARA top strand hybridized to the 50-mer PML-RARA bottom strand, in the absence of enzyme, or in the presence of enzyme and 0–500 μM etoposide. Lanes 17–22 contain the unmodified parental RARA top strand hybridized to the 50-mer, 30-mer, or 20-mer PML-RARA OTI bottom strand in the absence or presence of enzyme. Lanes 13 and 23 contain a combination of reference (R) oligonucleotides 24, 23, 20 and 19 bases in length. Gels are representative of at least three independent experiments.

    Article Snippet: Synthesis of the activated etoposide core, shown in the top portion of Figure , started with commercially available DEPT ( 1 ) (ABCAM Biochemicals).

    Techniques: Derivative Assay, Translocation Assay, Sequencing

    p53 induction in response to DNA damage is impaired in TFEB/TFE3 DKO RAW264.7. 7 cells. ( A ) Representative Western blot showing p53 induction, p53 Ser15 phosphorylation, and Mdm2 levels in WT and TFE3/TFEB DKO RAW264.7 cells following etoposide treatment up to 8 hr. ( B ) Quantification of p53 induction from data shown in A. Data represents mean relative p53 level ± standard deviation with n = 3. Significance tested with two-way ANOVA with Sidak’s multiple comparisons test (**p

    Journal: eLife

    Article Title: The transcription factors TFE3 and TFEB amplify p53 dependent transcriptional programs in response to DNA damage

    doi: 10.7554/eLife.40856

    Figure Lengend Snippet: p53 induction in response to DNA damage is impaired in TFEB/TFE3 DKO RAW264.7. 7 cells. ( A ) Representative Western blot showing p53 induction, p53 Ser15 phosphorylation, and Mdm2 levels in WT and TFE3/TFEB DKO RAW264.7 cells following etoposide treatment up to 8 hr. ( B ) Quantification of p53 induction from data shown in A. Data represents mean relative p53 level ± standard deviation with n = 3. Significance tested with two-way ANOVA with Sidak’s multiple comparisons test (**p

    Article Snippet: For drug treatments, cells were treated for the indicated times with the following reagents: DMSO (Sigma-Aldrich), 100 μM Etoposide (Cell Signaling Technology), dimethylformamide (Sigma-Aldrich D4551), 50 μM Cisplatin (Sigma-Aldrich 479306), Ethanol (Werner Graham Company), 2 mM LLOMe (Sigma-Aldrich L7393).

    Techniques: Western Blot, Standard Deviation

    ( A ) Representative Western blot showing TFEB and TFE3 gel shifts in response to etoposide in WT MEF, but not in p53 -/- MEF. All the immunoblots are representative of three independent experiments. ( B ) qPCR data showing relative induction of lysosomal-autophagy genes in response to starvation in WT and p53 -/- MEF. Data normalized to untreated cells and represents geometric means ± standard deviation and significance determined with Student’s t-test (*p

    Journal: eLife

    Article Title: The transcription factors TFE3 and TFEB amplify p53 dependent transcriptional programs in response to DNA damage

    doi: 10.7554/eLife.40856

    Figure Lengend Snippet: ( A ) Representative Western blot showing TFEB and TFE3 gel shifts in response to etoposide in WT MEF, but not in p53 -/- MEF. All the immunoblots are representative of three independent experiments. ( B ) qPCR data showing relative induction of lysosomal-autophagy genes in response to starvation in WT and p53 -/- MEF. Data normalized to untreated cells and represents geometric means ± standard deviation and significance determined with Student’s t-test (*p

    Article Snippet: For drug treatments, cells were treated for the indicated times with the following reagents: DMSO (Sigma-Aldrich), 100 μM Etoposide (Cell Signaling Technology), dimethylformamide (Sigma-Aldrich D4551), 50 μM Cisplatin (Sigma-Aldrich 479306), Ethanol (Werner Graham Company), 2 mM LLOMe (Sigma-Aldrich L7393).

    Techniques: Western Blot, Real-time Polymerase Chain Reaction, Standard Deviation

    TFE3 and TFEB are necessary for proper execution of apoptosis in response to DNA damage in RAW264.7 cells. ( A ) Representative Western blot showing Caspase-3 cleavage in response to increasing time of etoposide treatment. ( B ) Quantification of data shown in A indicating defects in Caspase-3 cleavage in TFEB/TFE3 DKO RAW264.7 cells. Cleaved Caspase-3 levels are normalized to WT cells after 16 hr etoposide treatment with n = 3. Significance tested with Student’s t-test (#p

    Journal: eLife

    Article Title: The transcription factors TFE3 and TFEB amplify p53 dependent transcriptional programs in response to DNA damage

    doi: 10.7554/eLife.40856

    Figure Lengend Snippet: TFE3 and TFEB are necessary for proper execution of apoptosis in response to DNA damage in RAW264.7 cells. ( A ) Representative Western blot showing Caspase-3 cleavage in response to increasing time of etoposide treatment. ( B ) Quantification of data shown in A indicating defects in Caspase-3 cleavage in TFEB/TFE3 DKO RAW264.7 cells. Cleaved Caspase-3 levels are normalized to WT cells after 16 hr etoposide treatment with n = 3. Significance tested with Student’s t-test (#p

    Article Snippet: For drug treatments, cells were treated for the indicated times with the following reagents: DMSO (Sigma-Aldrich), 100 μM Etoposide (Cell Signaling Technology), dimethylformamide (Sigma-Aldrich D4551), 50 μM Cisplatin (Sigma-Aldrich 479306), Ethanol (Werner Graham Company), 2 mM LLOMe (Sigma-Aldrich L7393).

    Techniques: Western Blot

    ( A ) Immunofluorescence images of ARPE-19 cells treated with 100 μM etoposide or 50 μM Cisplatin for 24 hr or 10 hr after UVC irradiation. Scale bar = 10 μm. ( B ) Immunofluorescence images of HeLa cells treated with 100 μM etoposide for 24 hr or 50 μM Cisplatin for 12 hr and 4 hr after UVC irradiation. Scale bar = 10 μm. ( C ) Immunofluorescence images of RAW 264.7 cells treated with 100 μM etoposide for 10 hr or 35 μM Cisplatin for 10 hr or 4 hr after UVC irradiation. Scale bar = 10 μm. ( D ) Representative Western blot showing TFE3 de-phosphorylation at Ser321 and gel shift in TFEB in WT MEFs exposed to 100 μM etoposide for 8 hr or 50 μM Cisplatin for 10 hr or 10 hr after UVC irradiation. ( E ) Representative Western blot showing TFE3 de-phosphorylation at Ser321 and gel shift in TFEB in ARPE19 cells exposed to 100 μM etoposide for 24 hr or 50 μM Cisplatin for 24 hr or 24 hr after UVC irradiation. ( F ) Representative Western blot showing TFE3 de-phosphorylation at Ser321 and gel shift in TFEB in HeLa cells exposed to 100 μM etoposide for 24 hr or 50 μM Cisplatin for 18 hr. ( G ) Representative Western blot showing TFE3 de-phosphorylation at Ser321 and gel shift in TFEB in RAW 264.7 cells exposed to 100 μM etoposide for 8 hr or 50 μM Cisplatin for 8 hr or 4 hr after UVC irradiation. ( H ) Representative Western blot showing TFE3 nuclear distribution by subcellular fractionation of WT MEFs exposed to 50 μM Cisplatin for 10 hr. ( I ) Western blot showing etoposide dependent S6K de-phosphorylation in ARPE19 cells. All the immunoblots are representative of three independent experiments.

    Journal: eLife

    Article Title: The transcription factors TFE3 and TFEB amplify p53 dependent transcriptional programs in response to DNA damage

    doi: 10.7554/eLife.40856

    Figure Lengend Snippet: ( A ) Immunofluorescence images of ARPE-19 cells treated with 100 μM etoposide or 50 μM Cisplatin for 24 hr or 10 hr after UVC irradiation. Scale bar = 10 μm. ( B ) Immunofluorescence images of HeLa cells treated with 100 μM etoposide for 24 hr or 50 μM Cisplatin for 12 hr and 4 hr after UVC irradiation. Scale bar = 10 μm. ( C ) Immunofluorescence images of RAW 264.7 cells treated with 100 μM etoposide for 10 hr or 35 μM Cisplatin for 10 hr or 4 hr after UVC irradiation. Scale bar = 10 μm. ( D ) Representative Western blot showing TFE3 de-phosphorylation at Ser321 and gel shift in TFEB in WT MEFs exposed to 100 μM etoposide for 8 hr or 50 μM Cisplatin for 10 hr or 10 hr after UVC irradiation. ( E ) Representative Western blot showing TFE3 de-phosphorylation at Ser321 and gel shift in TFEB in ARPE19 cells exposed to 100 μM etoposide for 24 hr or 50 μM Cisplatin for 24 hr or 24 hr after UVC irradiation. ( F ) Representative Western blot showing TFE3 de-phosphorylation at Ser321 and gel shift in TFEB in HeLa cells exposed to 100 μM etoposide for 24 hr or 50 μM Cisplatin for 18 hr. ( G ) Representative Western blot showing TFE3 de-phosphorylation at Ser321 and gel shift in TFEB in RAW 264.7 cells exposed to 100 μM etoposide for 8 hr or 50 μM Cisplatin for 8 hr or 4 hr after UVC irradiation. ( H ) Representative Western blot showing TFE3 nuclear distribution by subcellular fractionation of WT MEFs exposed to 50 μM Cisplatin for 10 hr. ( I ) Western blot showing etoposide dependent S6K de-phosphorylation in ARPE19 cells. All the immunoblots are representative of three independent experiments.

    Article Snippet: For drug treatments, cells were treated for the indicated times with the following reagents: DMSO (Sigma-Aldrich), 100 μM Etoposide (Cell Signaling Technology), dimethylformamide (Sigma-Aldrich D4551), 50 μM Cisplatin (Sigma-Aldrich 479306), Ethanol (Werner Graham Company), 2 mM LLOMe (Sigma-Aldrich L7393).

    Techniques: Immunofluorescence, Irradiation, Western Blot, De-Phosphorylation Assay, Electrophoretic Mobility Shift Assay, Fractionation

    ( A ) Enriched GO terms in the ‘Biological Process’ category of differentially expressed genes between etoposide-treated WT and TFEB/TFE3 DKO RAW264.7 cells. GO terms are ranked by q value (

    Journal: eLife

    Article Title: The transcription factors TFE3 and TFEB amplify p53 dependent transcriptional programs in response to DNA damage

    doi: 10.7554/eLife.40856

    Figure Lengend Snippet: ( A ) Enriched GO terms in the ‘Biological Process’ category of differentially expressed genes between etoposide-treated WT and TFEB/TFE3 DKO RAW264.7 cells. GO terms are ranked by q value (

    Article Snippet: For drug treatments, cells were treated for the indicated times with the following reagents: DMSO (Sigma-Aldrich), 100 μM Etoposide (Cell Signaling Technology), dimethylformamide (Sigma-Aldrich D4551), 50 μM Cisplatin (Sigma-Aldrich 479306), Ethanol (Werner Graham Company), 2 mM LLOMe (Sigma-Aldrich L7393).

    Techniques:

    TFEB and TFE3 are essential for etoposide-induced lysosomal membrane permeabilization in MEFs. ( A ) Immunofluorescence images showing LMP in MEFs. Red galectin-1 puncta appear co-localized or within the lumen of green Lamp1 positive lysosomes. No LMP is detected under basal conditions in either WT or TFEB/TFE3 DKO MEFs. Treatment with etoposide induces profound LMP in WT, but not TFEB/TFE3 DKO cells. No differences in LMP induction were detected in LLOMe treated cells, regardless of genotype. Scale bar = 20 μm, inset = 2 μm. ( B ) WT MEFs exhibit a time-dependent increase in LMP after etoposide treatment. Quantification of data shown in A of galectin-1+/Lamp1 + LMP puncta per WT MEF cell. Data represent mean number of puncta per cell ± standard deviation from randomly selected confocal images, with > 20 cells per counted for each time point over three separate experiments. ( C ) Quantification of total number of galectin-1+/Lamp1+ LMP puncta per cell in WT vs TFE3/TFEB DKO MEFs treated for 8 hr with etoposide. Distribution is representative of one of the three independent experiments performed and shows 29 randomly selected WT MEF cells and 51 randomly selected TFEB/TFE3 DKO MEF cells. Significance determined using Student’s t-test (****p

    Journal: eLife

    Article Title: The transcription factors TFE3 and TFEB amplify p53 dependent transcriptional programs in response to DNA damage

    doi: 10.7554/eLife.40856

    Figure Lengend Snippet: TFEB and TFE3 are essential for etoposide-induced lysosomal membrane permeabilization in MEFs. ( A ) Immunofluorescence images showing LMP in MEFs. Red galectin-1 puncta appear co-localized or within the lumen of green Lamp1 positive lysosomes. No LMP is detected under basal conditions in either WT or TFEB/TFE3 DKO MEFs. Treatment with etoposide induces profound LMP in WT, but not TFEB/TFE3 DKO cells. No differences in LMP induction were detected in LLOMe treated cells, regardless of genotype. Scale bar = 20 μm, inset = 2 μm. ( B ) WT MEFs exhibit a time-dependent increase in LMP after etoposide treatment. Quantification of data shown in A of galectin-1+/Lamp1 + LMP puncta per WT MEF cell. Data represent mean number of puncta per cell ± standard deviation from randomly selected confocal images, with > 20 cells per counted for each time point over three separate experiments. ( C ) Quantification of total number of galectin-1+/Lamp1+ LMP puncta per cell in WT vs TFE3/TFEB DKO MEFs treated for 8 hr with etoposide. Distribution is representative of one of the three independent experiments performed and shows 29 randomly selected WT MEF cells and 51 randomly selected TFEB/TFE3 DKO MEF cells. Significance determined using Student’s t-test (****p

    Article Snippet: For drug treatments, cells were treated for the indicated times with the following reagents: DMSO (Sigma-Aldrich), 100 μM Etoposide (Cell Signaling Technology), dimethylformamide (Sigma-Aldrich D4551), 50 μM Cisplatin (Sigma-Aldrich 479306), Ethanol (Werner Graham Company), 2 mM LLOMe (Sigma-Aldrich L7393).

    Techniques: Immunofluorescence, Standard Deviation

    HT1080 FUCCI show strong cell cycle-associated cell death. Cell cycle-associated death standards are used. ( a ) A representative FUCCI trace of cells treated with the topoisomerase-α poison, etoposide. Cells progress from G1-phase (red), with normal kinetics, progress to a green state and die, consistent with S/G2-phase associated death. ( b ) A representative FUCCI trace of cells treated with the DNA modifier, cisplatin. Cells most often progress normally from G1-phase (red) to an all green state and die, consistent with S-phase associated death. ( c ) A representative FUCCI trace of cells treated with a Kinesin-5 inhibitor, K5I. This cell progresses through the cell cycle with normal kinetics and enters mitotic arrest at 14 h post-treatment (*). While arrested, red signal is reacquired after 3–4 h, beginning at 17 h. This cell dies at 23 h and nearly all other cells also die while arrested in mitosis. Arrows indicate time of death. See Supplementary Fig. 1e–g online for FUCCI distributions over time. Supplementary video S6-8 online. Cell number tracked: etoposide, 33, cisplatin, 21, K5I, 30.

    Journal: Scientific Reports

    Article Title: Longitudinal tracking of single live cancer cells to understand cell cycle effects of the nuclear export inhibitor, selinexor

    doi: 10.1038/srep14391

    Figure Lengend Snippet: HT1080 FUCCI show strong cell cycle-associated cell death. Cell cycle-associated death standards are used. ( a ) A representative FUCCI trace of cells treated with the topoisomerase-α poison, etoposide. Cells progress from G1-phase (red), with normal kinetics, progress to a green state and die, consistent with S/G2-phase associated death. ( b ) A representative FUCCI trace of cells treated with the DNA modifier, cisplatin. Cells most often progress normally from G1-phase (red) to an all green state and die, consistent with S-phase associated death. ( c ) A representative FUCCI trace of cells treated with a Kinesin-5 inhibitor, K5I. This cell progresses through the cell cycle with normal kinetics and enters mitotic arrest at 14 h post-treatment (*). While arrested, red signal is reacquired after 3–4 h, beginning at 17 h. This cell dies at 23 h and nearly all other cells also die while arrested in mitosis. Arrows indicate time of death. See Supplementary Fig. 1e–g online for FUCCI distributions over time. Supplementary video S6-8 online. Cell number tracked: etoposide, 33, cisplatin, 21, K5I, 30.

    Article Snippet: PD0332991, Etoposide (VP-16), and cisplatin are from Selleckchem (Houston, TX); stock solutions re in DMSO except for cisplatin, which is in dimethylformamide.

    Techniques:

    Longitudinal single cell tracking with survival analysis reveals cell cycle-associated responses of selinexor. HT1080 FUCCI cells. ( a ) Percent survival after treatment with cell cycle drugs, selinexor and controls. 100% of cells have divided by ~16 h for untreated (black) and KPT 301 treated (blueberry) cells; dashed lines represent the daughter cell population. Half of selinexor-treated cells are lost by ~55 h (maraschino) and the rate of loss is most similar to the S-phase associated drug, etoposide (honeydew); cisplatin (grape) and K5I (avocado) are comparatively very potent killers. ( b ) Survival curve for selinexor treated cells separated by FUCCI status upon treatment. Cells treated in early S-phase (yellow) die the fastest. Cells treated in late S/G2-phase (green) show little death and instead divide (dashed green line). Cells treated in G1-phase (red) and daughter cells from treated late S/G2-phase cells die at very similar rates. ( c , d ) Two-axis and violin plots for all cells that die after selinexor treatment or that die after being born into selinexor. Two-axis plots show FUCCI status upon treatment on the left axis and upon death on the right. Violin plot shows timing of death and FUCCI status (red triangle for G1-phase, yellow square for early S-phase, green circle for S/G2-phase, and blue star for mitosis) upon death. For ( d ) the FUCCI status of parent cells upon treatment are on the left axis and FUCCI status of daughter cells upon death on the right –84% of cells that die after dividing in selinexor, die in G1-phase (~84%). ( e ) Continuously tracked cells to obtain fraction of time spent in each FUCCI stage for each condition and table indicating the average life-span of cells for each condition; selinexor treated cells live 42 h on average, and spend increased time in G1-phase in particular (see Table 1 ). Supplementary videos S15-18 online. Cell numbers scored: ( a – d ) untreated, 42, selinexor, 376, KPT 301, 47, etoposide, 84, cisplatin, 54, K5I, 51. ( e ) Cell number tracked: untreated, 22, PD0332991, 19, aphidicolin, 24, RO-3306, 20, etoposide, 33, cisplatin, 21, K5I, 30, KPT 301, 27, selinexor, 117.

    Journal: Scientific Reports

    Article Title: Longitudinal tracking of single live cancer cells to understand cell cycle effects of the nuclear export inhibitor, selinexor

    doi: 10.1038/srep14391

    Figure Lengend Snippet: Longitudinal single cell tracking with survival analysis reveals cell cycle-associated responses of selinexor. HT1080 FUCCI cells. ( a ) Percent survival after treatment with cell cycle drugs, selinexor and controls. 100% of cells have divided by ~16 h for untreated (black) and KPT 301 treated (blueberry) cells; dashed lines represent the daughter cell population. Half of selinexor-treated cells are lost by ~55 h (maraschino) and the rate of loss is most similar to the S-phase associated drug, etoposide (honeydew); cisplatin (grape) and K5I (avocado) are comparatively very potent killers. ( b ) Survival curve for selinexor treated cells separated by FUCCI status upon treatment. Cells treated in early S-phase (yellow) die the fastest. Cells treated in late S/G2-phase (green) show little death and instead divide (dashed green line). Cells treated in G1-phase (red) and daughter cells from treated late S/G2-phase cells die at very similar rates. ( c , d ) Two-axis and violin plots for all cells that die after selinexor treatment or that die after being born into selinexor. Two-axis plots show FUCCI status upon treatment on the left axis and upon death on the right. Violin plot shows timing of death and FUCCI status (red triangle for G1-phase, yellow square for early S-phase, green circle for S/G2-phase, and blue star for mitosis) upon death. For ( d ) the FUCCI status of parent cells upon treatment are on the left axis and FUCCI status of daughter cells upon death on the right –84% of cells that die after dividing in selinexor, die in G1-phase (~84%). ( e ) Continuously tracked cells to obtain fraction of time spent in each FUCCI stage for each condition and table indicating the average life-span of cells for each condition; selinexor treated cells live 42 h on average, and spend increased time in G1-phase in particular (see Table 1 ). Supplementary videos S15-18 online. Cell numbers scored: ( a – d ) untreated, 42, selinexor, 376, KPT 301, 47, etoposide, 84, cisplatin, 54, K5I, 51. ( e ) Cell number tracked: untreated, 22, PD0332991, 19, aphidicolin, 24, RO-3306, 20, etoposide, 33, cisplatin, 21, K5I, 30, KPT 301, 27, selinexor, 117.

    Article Snippet: PD0332991, Etoposide (VP-16), and cisplatin are from Selleckchem (Houston, TX); stock solutions re in DMSO except for cisplatin, which is in dimethylformamide.

    Techniques: Single Cell Tracking

    BLE and TE effect on proteins markers for apoptosis in HCA-7 cell line. ( a ) Western blot” Cells were treated for 24 h with bay leaf (BLE 15 μg GAE/mL), turmeric (TE 10 μg GAE/mL), and Etoposide 25 μM, which was used as a positive control for caspase-3 activation. ( a ) Quantitative analysis of Western blot bands. Protein expression was normalised against β-Actin and expressed relative to untreated control, where control is 100%; ( b ) Untreated control contained just DMEM with 10% FBS (vehicle control–ethanol was 0.4% ( v / v ), the highest amount found in the extracts). Bay leaf in ethanol (BLE), turmeric in ethanol (TE), n = 3, ±SEM.

    Journal: Nutrients

    Article Title: Inhibitory Effects of Culinary Herbs and Spices on the Growth of HCA-7 Colorectal Cancer Cells and Their COX-2 Expression

    doi: 10.3390/nu9101051

    Figure Lengend Snippet: BLE and TE effect on proteins markers for apoptosis in HCA-7 cell line. ( a ) Western blot” Cells were treated for 24 h with bay leaf (BLE 15 μg GAE/mL), turmeric (TE 10 μg GAE/mL), and Etoposide 25 μM, which was used as a positive control for caspase-3 activation. ( a ) Quantitative analysis of Western blot bands. Protein expression was normalised against β-Actin and expressed relative to untreated control, where control is 100%; ( b ) Untreated control contained just DMEM with 10% FBS (vehicle control–ethanol was 0.4% ( v / v ), the highest amount found in the extracts). Bay leaf in ethanol (BLE), turmeric in ethanol (TE), n = 3, ±SEM.

    Article Snippet: A caspase-3/7 inhibitor and Etoposide (Tocris Bioscience, Bristol, UK), a caspase activator, were used as a positive control for caspase 3 activation and a negative control, respectively.

    Techniques: High Content Screening, Western Blot, Positive Control, Activation Assay, Expressing

    Dose-dependent Mdm2 expression was mainly regulated by ATM-mediated Mdm2 degradation. ( A ) Mdm2 degradation kinetics in U-2 OS cells under the indicated treatment condition plus cycloheximide (2.5 μg/ml) were measured by Western blot analysis of Mdm2 level at 12 selected time points (unit: minute). Actin, which served as a loading control, was shown beneath each Mdm2 sample. Mdm2 half-life τ under different treatment conditions was derived from the exponential fit of the Mdm2 degradation kinetics averaged from three independent sets of Western blots. ( B ) Mdm2 degradation kinetics of MCF7 cells and the respective exponential fits under the indicated treatment conditions. ( C ) Mdm2 half-life of the six cell lines at low (top) or high (bottom) drug dose in comparison with that under the control condition. The bottom panel also showed Mdm2 half-life of the three sensitive lines under the combined treatment of 100 μM etoposide and 20 μM KU55933, an ATM inhibitor (ATMi). ctrl, control.

    Journal: Science Advances

    Article Title: Cell type–dependent bimodal p53 activation engenders a dynamic mechanism of chemoresistance

    doi: 10.1126/sciadv.aat5077

    Figure Lengend Snippet: Dose-dependent Mdm2 expression was mainly regulated by ATM-mediated Mdm2 degradation. ( A ) Mdm2 degradation kinetics in U-2 OS cells under the indicated treatment condition plus cycloheximide (2.5 μg/ml) were measured by Western blot analysis of Mdm2 level at 12 selected time points (unit: minute). Actin, which served as a loading control, was shown beneath each Mdm2 sample. Mdm2 half-life τ under different treatment conditions was derived from the exponential fit of the Mdm2 degradation kinetics averaged from three independent sets of Western blots. ( B ) Mdm2 degradation kinetics of MCF7 cells and the respective exponential fits under the indicated treatment conditions. ( C ) Mdm2 half-life of the six cell lines at low (top) or high (bottom) drug dose in comparison with that under the control condition. The bottom panel also showed Mdm2 half-life of the three sensitive lines under the combined treatment of 100 μM etoposide and 20 μM KU55933, an ATM inhibitor (ATMi). ctrl, control.

    Article Snippet: Chemicals and reagents Etoposide, Nutlin-3, and the ATM kinase inhibitors KU55933 and KU60019 were purchased from Tocris or Selleckchem. siRNA oligos for gene knockdown include siWip1 (UUGGCCUUGUGCCUACUAA; used at a final concentration of 20 nM), sip53 (UGAACCAUUGUUCAAUAUCGUCCGG; used at 20 nM), and siATM-1 (GCCUCC AGGCAGAAAAAGA; used at 40 nM in A375 and A549.

    Techniques: Expressing, Western Blot, Derivative Assay

    p53 dynamics and p53-mediated drug response correlated with kinetics of a number of proteins/protein modifications. ( A ) Network diagram of key regulatory components of the p53 pathway associated with response to etoposide. ( B and C ) Western blot comparison of dose response of (B) U-2 OS cells and (C) MCF7 cells at low versus high drug concentration. ( D ) Comparison of U-2 OS and MCF7 response at high etoposide concentration. ( E ) Comparison of the six cell lines after an 8-hour treatment of the indicated etoposide concentration. ( F ) Expression of p21 and Puma in U-2 OS and MCF7 at the indicated low versus high etoposide concentration. The quantified Western blot results were color-coded by cell line and drug concentration as indicated. Error bars were SDs calculated on the basis of three independent sets of Western blots. For all Western blotting analysis, actin served as the loading control. DNA damage level was indicated by a DNA damage marker, γH2A.X, and the extent of cell death was indicated by Parp1 cleavage. All data shown are representative of at least three independent Western blot measurements.

    Journal: Science Advances

    Article Title: Cell type–dependent bimodal p53 activation engenders a dynamic mechanism of chemoresistance

    doi: 10.1126/sciadv.aat5077

    Figure Lengend Snippet: p53 dynamics and p53-mediated drug response correlated with kinetics of a number of proteins/protein modifications. ( A ) Network diagram of key regulatory components of the p53 pathway associated with response to etoposide. ( B and C ) Western blot comparison of dose response of (B) U-2 OS cells and (C) MCF7 cells at low versus high drug concentration. ( D ) Comparison of U-2 OS and MCF7 response at high etoposide concentration. ( E ) Comparison of the six cell lines after an 8-hour treatment of the indicated etoposide concentration. ( F ) Expression of p21 and Puma in U-2 OS and MCF7 at the indicated low versus high etoposide concentration. The quantified Western blot results were color-coded by cell line and drug concentration as indicated. Error bars were SDs calculated on the basis of three independent sets of Western blots. For all Western blotting analysis, actin served as the loading control. DNA damage level was indicated by a DNA damage marker, γH2A.X, and the extent of cell death was indicated by Parp1 cleavage. All data shown are representative of at least three independent Western blot measurements.

    Article Snippet: Chemicals and reagents Etoposide, Nutlin-3, and the ATM kinase inhibitors KU55933 and KU60019 were purchased from Tocris or Selleckchem. siRNA oligos for gene knockdown include siWip1 (UUGGCCUUGUGCCUACUAA; used at a final concentration of 20 nM), sip53 (UGAACCAUUGUUCAAUAUCGUCCGG; used at 20 nM), and siATM-1 (GCCUCC AGGCAGAAAAAGA; used at 40 nM in A375 and A549.

    Techniques: Western Blot, Concentration Assay, Expressing, Marker

    p53 dynamics and cellular response to etoposide were both dose and cell type dependent. ( A ) p53 dynamics monitored by p53-Venue fluorescence in the representative drug-sensitive cell line U-2 OS (top) and resistant cell line MCF7 (bottom) at low and high concentrations of etoposide. Still images were from time-lapse movies. Time (unit: hour) is indicated at the top right corner of each image. ( B ) Representative single-cell trajectories of p53 dynamics quantified from fluorescence of the p53-Venus reporter in the nucleus of the six cancer cell lines at the indicated low (black lines) and high (red lines) etoposide doses. The abrupt end of p53 trajectories in the sensitive cell lines corresponds to the time of death. ( C ) Heat maps of nuclear p53-Venus fluorescence in U-2 OS (left) and MCF7 cells (right) at high drug dose. Black squares indicate the time of cell death. ( D ) Ratio of the average peak level of p53-Venus fluorescence at high and low drug doses in the six cell lines. Error bars indicate standard deviation (SD). The two-tailed P value was obtained by Welch’s unpaired t test with A375 as the reference group. N.S., not statistically significant. * P

    Journal: Science Advances

    Article Title: Cell type–dependent bimodal p53 activation engenders a dynamic mechanism of chemoresistance

    doi: 10.1126/sciadv.aat5077

    Figure Lengend Snippet: p53 dynamics and cellular response to etoposide were both dose and cell type dependent. ( A ) p53 dynamics monitored by p53-Venue fluorescence in the representative drug-sensitive cell line U-2 OS (top) and resistant cell line MCF7 (bottom) at low and high concentrations of etoposide. Still images were from time-lapse movies. Time (unit: hour) is indicated at the top right corner of each image. ( B ) Representative single-cell trajectories of p53 dynamics quantified from fluorescence of the p53-Venus reporter in the nucleus of the six cancer cell lines at the indicated low (black lines) and high (red lines) etoposide doses. The abrupt end of p53 trajectories in the sensitive cell lines corresponds to the time of death. ( C ) Heat maps of nuclear p53-Venus fluorescence in U-2 OS (left) and MCF7 cells (right) at high drug dose. Black squares indicate the time of cell death. ( D ) Ratio of the average peak level of p53-Venus fluorescence at high and low drug doses in the six cell lines. Error bars indicate standard deviation (SD). The two-tailed P value was obtained by Welch’s unpaired t test with A375 as the reference group. N.S., not statistically significant. * P

    Article Snippet: Chemicals and reagents Etoposide, Nutlin-3, and the ATM kinase inhibitors KU55933 and KU60019 were purchased from Tocris or Selleckchem. siRNA oligos for gene knockdown include siWip1 (UUGGCCUUGUGCCUACUAA; used at a final concentration of 20 nM), sip53 (UGAACCAUUGUUCAAUAUCGUCCGG; used at 20 nM), and siATM-1 (GCCUCC AGGCAGAAAAAGA; used at 40 nM in A375 and A549.

    Techniques: Fluorescence, Standard Deviation, Two Tailed Test

    Bimodal p53 dynamics were regulated by a four-component regulatory module consisting of ATM, p53, Mdm2, and Wip1. ( A and B ) Simulated single-cell dynamics of p53 and the corresponding four-component module. The black and red trajectories are p53 levels as a function of time under 1 μM (5 μM) and 100 μM (200 μM) etoposide in (A) U-2 OS and (B) MCF7 cells, respectively. ( C ) Bifurcation diagram of p53 concentration versus etoposide concentration. The red and black curves denote the respective steady states for U-2 OS and MCF7 cells. The solid and dotted curves separately denote the stable and unstable states. The circles denote the Hopf bifurcation points. The magenta (blue) curves denote the maxima and minima of [p53] in the limit cycles for U-2 OS (MCF7) cells. The x axis is on log scale. ( D ) Dependence of p53 induction dynamics in U-2 OS cell on expression of ATM t , Mdm2, and Wip1 and the ATM-mediated Mdm2 degradation rate γ m1 . The above parameters were either increased or decreased by δ-fold. ( E ) Effects of total amount of ATM on p53 dynamics in MCF7 at 200 μM etoposide. ( F ) Simulated p53 dynamics in MCF7 cells under the indicated treatment conditions: 200 μM etoposide (black), Mdm2 inhibition (blue), 200 μM etoposide + Wip1 inhibition (magenta), 200 μM etoposide + Mdm2 inhibition (green), and 200 μM etoposide + combined inhibition of Mdm2 and Wip1 (red).

    Journal: Science Advances

    Article Title: Cell type–dependent bimodal p53 activation engenders a dynamic mechanism of chemoresistance

    doi: 10.1126/sciadv.aat5077

    Figure Lengend Snippet: Bimodal p53 dynamics were regulated by a four-component regulatory module consisting of ATM, p53, Mdm2, and Wip1. ( A and B ) Simulated single-cell dynamics of p53 and the corresponding four-component module. The black and red trajectories are p53 levels as a function of time under 1 μM (5 μM) and 100 μM (200 μM) etoposide in (A) U-2 OS and (B) MCF7 cells, respectively. ( C ) Bifurcation diagram of p53 concentration versus etoposide concentration. The red and black curves denote the respective steady states for U-2 OS and MCF7 cells. The solid and dotted curves separately denote the stable and unstable states. The circles denote the Hopf bifurcation points. The magenta (blue) curves denote the maxima and minima of [p53] in the limit cycles for U-2 OS (MCF7) cells. The x axis is on log scale. ( D ) Dependence of p53 induction dynamics in U-2 OS cell on expression of ATM t , Mdm2, and Wip1 and the ATM-mediated Mdm2 degradation rate γ m1 . The above parameters were either increased or decreased by δ-fold. ( E ) Effects of total amount of ATM on p53 dynamics in MCF7 at 200 μM etoposide. ( F ) Simulated p53 dynamics in MCF7 cells under the indicated treatment conditions: 200 μM etoposide (black), Mdm2 inhibition (blue), 200 μM etoposide + Wip1 inhibition (magenta), 200 μM etoposide + Mdm2 inhibition (green), and 200 μM etoposide + combined inhibition of Mdm2 and Wip1 (red).

    Article Snippet: Chemicals and reagents Etoposide, Nutlin-3, and the ATM kinase inhibitors KU55933 and KU60019 were purchased from Tocris or Selleckchem. siRNA oligos for gene knockdown include siWip1 (UUGGCCUUGUGCCUACUAA; used at a final concentration of 20 nM), sip53 (UGAACCAUUGUUCAAUAUCGUCCGG; used at 20 nM), and siATM-1 (GCCUCC AGGCAGAAAAAGA; used at 40 nM in A375 and A549.

    Techniques: Concentration Assay, Expressing, Inhibition

    Inhibition of Mdm2 or Mdm2 plus Wip1 altered p53 dynamics in the resistant cell lines and sensitized their drug-induced cell death. ( A ) Representative single-cell trajectories and heat maps of p53-Venus fluorescence in individual MCF7 cells under the indicated treatment conditions, including etoposide (200 μM) alone, Nutlin-3 (10 μM) alone, etoposide + Nutlin-3, etoposide + Wip1 knockdown (KD), and etoposide + Nutlin-3 + Wip1 KD. Cells under treatment conditions without Wip1 knockdown were transfected with nontargeting small interfering RNA (siRNA) to control for transfection toxicity. The abrupt end of p53 trajectory and the black squares in the heat map under etoposide + Nutlin-3 + Wip1 KD correspond to the time of death. ( B ) Cumulative survival curves of MCF7 cells under the indicated treatment conditions. Data were averaged from three independent imaging experiments, and the total number of cells analyzed for each condition in each experiment ranged from 62 to 132. Cell death was scored morphologically on the basis of time-lapse movies, and the kinetics of cell death were plotted as cumulative survival curves. The shaded area of each curve indicates SD. ( C ) Representative single-cell p53 trajectories of HepG2 and 769-P cells and their survival statistics after 24 or 48 hours of the indicated treatment conditions. Data were averaged from two independent imaging experiments, and the total number of cells analyzed for each condition in each experiment ranged from 40 to 129. ( D ) Western blot comparison of selected proteins/protein modifications of MCF7 cells treated with 200 μM etoposide plus control siRNA or Wip1 KD or 200 μM etoposide + 10 μM Nutlin-3 versus etoposide + Nutlin-3 + Wip1 KD.

    Journal: Science Advances

    Article Title: Cell type–dependent bimodal p53 activation engenders a dynamic mechanism of chemoresistance

    doi: 10.1126/sciadv.aat5077

    Figure Lengend Snippet: Inhibition of Mdm2 or Mdm2 plus Wip1 altered p53 dynamics in the resistant cell lines and sensitized their drug-induced cell death. ( A ) Representative single-cell trajectories and heat maps of p53-Venus fluorescence in individual MCF7 cells under the indicated treatment conditions, including etoposide (200 μM) alone, Nutlin-3 (10 μM) alone, etoposide + Nutlin-3, etoposide + Wip1 knockdown (KD), and etoposide + Nutlin-3 + Wip1 KD. Cells under treatment conditions without Wip1 knockdown were transfected with nontargeting small interfering RNA (siRNA) to control for transfection toxicity. The abrupt end of p53 trajectory and the black squares in the heat map under etoposide + Nutlin-3 + Wip1 KD correspond to the time of death. ( B ) Cumulative survival curves of MCF7 cells under the indicated treatment conditions. Data were averaged from three independent imaging experiments, and the total number of cells analyzed for each condition in each experiment ranged from 62 to 132. Cell death was scored morphologically on the basis of time-lapse movies, and the kinetics of cell death were plotted as cumulative survival curves. The shaded area of each curve indicates SD. ( C ) Representative single-cell p53 trajectories of HepG2 and 769-P cells and their survival statistics after 24 or 48 hours of the indicated treatment conditions. Data were averaged from two independent imaging experiments, and the total number of cells analyzed for each condition in each experiment ranged from 40 to 129. ( D ) Western blot comparison of selected proteins/protein modifications of MCF7 cells treated with 200 μM etoposide plus control siRNA or Wip1 KD or 200 μM etoposide + 10 μM Nutlin-3 versus etoposide + Nutlin-3 + Wip1 KD.

    Article Snippet: Chemicals and reagents Etoposide, Nutlin-3, and the ATM kinase inhibitors KU55933 and KU60019 were purchased from Tocris or Selleckchem. siRNA oligos for gene knockdown include siWip1 (UUGGCCUUGUGCCUACUAA; used at a final concentration of 20 nM), sip53 (UGAACCAUUGUUCAAUAUCGUCCGG; used at 20 nM), and siATM-1 (GCCUCC AGGCAGAAAAAGA; used at 40 nM in A375 and A549.

    Techniques: Inhibition, Fluorescence, Transfection, Small Interfering RNA, Imaging, Western Blot

    Migration of HepG2 cells was promoted by chemotherapy-induced apoptosis. After the cells on the bottom of the wells being treated with 2.5 μM VP-16, crystal violet staining assay was applied to analyze the influence of the treated cells on the migration of HepG2 cells from day 1 to day 7. Results were expressed as the mean ± SD of three independent experiments, *p

    Journal: OncoTargets and therapy

    Article Title: Berberine Inhibits the Apoptosis-Induced Metastasis by Suppressing the iPLA2/LOX-5/LTB4 Pathway in Hepatocellular Carcinoma

    doi: 10.2147/OTT.S243357

    Figure Lengend Snippet: Migration of HepG2 cells was promoted by chemotherapy-induced apoptosis. After the cells on the bottom of the wells being treated with 2.5 μM VP-16, crystal violet staining assay was applied to analyze the influence of the treated cells on the migration of HepG2 cells from day 1 to day 7. Results were expressed as the mean ± SD of three independent experiments, *p

    Article Snippet: Chemicals and Reagents VP-16 (etoposide) injection was purchased from Qilu pharmaceutical Co., LTD. Berberine chloride hydrate (C20 H18 ClNO4, Purity > 99%, hereinafter referred to as Berberine) was kindly provided by the Northeast Pharmaceutical Group Co., Ltd. (Shenyang, China).

    Techniques: Migration, Staining

    Berberine reversed the apoptosis-induced migration of HepG2 cells. ( A ) After the cells on the bottom of the wells being treated with 2.5 μM VP-16, 3.125 μM Berberine was applied to the system and cultured for 6 days. Crystal violet staining assay was applied to analyze the migration of HepG2 cells. Cell numbers were counted under the microscope. ( B ) Cells from the outer side of the membrane were photographed under the microscope. ( C ) The cells were then exposed to the culture medium of the 7th day’s incubation for the Scratch-wound assay. ( D ) Migration of the cells was analyzed by Image J. Each bar represents the mean ± SD of three independent experiments, n=3, *p

    Journal: OncoTargets and therapy

    Article Title: Berberine Inhibits the Apoptosis-Induced Metastasis by Suppressing the iPLA2/LOX-5/LTB4 Pathway in Hepatocellular Carcinoma

    doi: 10.2147/OTT.S243357

    Figure Lengend Snippet: Berberine reversed the apoptosis-induced migration of HepG2 cells. ( A ) After the cells on the bottom of the wells being treated with 2.5 μM VP-16, 3.125 μM Berberine was applied to the system and cultured for 6 days. Crystal violet staining assay was applied to analyze the migration of HepG2 cells. Cell numbers were counted under the microscope. ( B ) Cells from the outer side of the membrane were photographed under the microscope. ( C ) The cells were then exposed to the culture medium of the 7th day’s incubation for the Scratch-wound assay. ( D ) Migration of the cells was analyzed by Image J. Each bar represents the mean ± SD of three independent experiments, n=3, *p

    Article Snippet: Chemicals and Reagents VP-16 (etoposide) injection was purchased from Qilu pharmaceutical Co., LTD. Berberine chloride hydrate (C20 H18 ClNO4, Purity > 99%, hereinafter referred to as Berberine) was kindly provided by the Northeast Pharmaceutical Group Co., Ltd. (Shenyang, China).

    Techniques: Migration, Cell Culture, Staining, Microscopy, Incubation, Scratch Wound Assay Assay

    The protein expression of iPLA 2 and LOX-5 in HepG2 cells treated by VP-16 and/or Berberine. ( A ) The cells after 5 days’ incubation were collected and the protein expression of iPLA 2 and LOX-5 in HepG2 cells were measured by Western blot analysis. ( B ) Relative quantification of iPLA 2 levels expressed relative to control. ( C ) Relative quantification of LOX-5 levels expressed relative to control. ( D ) The LTB4 levels in HepG2 cells treated by VP-16 and/or Berberine. The supernatants of each group were collected each day during the 7 days’ incubation. The LTB4 levels were measured by ELISA. Each bar represents the mean ± SD of three independent experiments, n=3, *p

    Journal: OncoTargets and therapy

    Article Title: Berberine Inhibits the Apoptosis-Induced Metastasis by Suppressing the iPLA2/LOX-5/LTB4 Pathway in Hepatocellular Carcinoma

    doi: 10.2147/OTT.S243357

    Figure Lengend Snippet: The protein expression of iPLA 2 and LOX-5 in HepG2 cells treated by VP-16 and/or Berberine. ( A ) The cells after 5 days’ incubation were collected and the protein expression of iPLA 2 and LOX-5 in HepG2 cells were measured by Western blot analysis. ( B ) Relative quantification of iPLA 2 levels expressed relative to control. ( C ) Relative quantification of LOX-5 levels expressed relative to control. ( D ) The LTB4 levels in HepG2 cells treated by VP-16 and/or Berberine. The supernatants of each group were collected each day during the 7 days’ incubation. The LTB4 levels were measured by ELISA. Each bar represents the mean ± SD of three independent experiments, n=3, *p

    Article Snippet: Chemicals and Reagents VP-16 (etoposide) injection was purchased from Qilu pharmaceutical Co., LTD. Berberine chloride hydrate (C20 H18 ClNO4, Purity > 99%, hereinafter referred to as Berberine) was kindly provided by the Northeast Pharmaceutical Group Co., Ltd. (Shenyang, China).

    Techniques: Expressing, Incubation, Western Blot, Enzyme-linked Immunosorbent Assay

    Cellular characterization of GFP+ HSC colonies resulting from illegitimate NHEJ DNA repair and a chromosomal translocation following exposure to etoposide or bioflavonoids. (A-H) GFP+ HSC colonies were scored by inverted fluorescent microscopy beginning 96 hrs post-exposure. Representative phase contrast (left panels) and fluorescent (right panels) microscopy images of GFP+ colonies are shown side by side. (A,B) negative control. (C,D) + etoposide. (E,F) + genistein. (G,H) + quercetin. The lack of background fluorescence in the assay is demonstrated in negative control (A) and one of the two colonies in the field following etoposide exposure (D) .

    Journal: Environmental and molecular mutagenesis

    Article Title: Bioflavonoids promote stable translocations between MLL-AF9 breakpoint cluster regions independent of normal chromosomal context: Model system to screen environmental risks

    doi: 10.1002/em.22245

    Figure Lengend Snippet: Cellular characterization of GFP+ HSC colonies resulting from illegitimate NHEJ DNA repair and a chromosomal translocation following exposure to etoposide or bioflavonoids. (A-H) GFP+ HSC colonies were scored by inverted fluorescent microscopy beginning 96 hrs post-exposure. Representative phase contrast (left panels) and fluorescent (right panels) microscopy images of GFP+ colonies are shown side by side. (A,B) negative control. (C,D) + etoposide. (E,F) + genistein. (G,H) + quercetin. The lack of background fluorescence in the assay is demonstrated in negative control (A) and one of the two colonies in the field following etoposide exposure (D) .

    Article Snippet: Etoposide, all flavonoids, and vitamins were obtained from LKT Laboratories.

    Techniques: Non-Homologous End Joining, Translocation Assay, Microscopy, Negative Control, Fluorescence

    γH2AX foci as marker of DNA damage observed 1 hr post-exposure to tested compounds at approximate calculated LD50 dose. (A) DMSO vehicle only. (B) etoposide 12.5μM. (C-F) flavonols— (C) quercetin 75μM, (D) kaempferol 100μM, (E) myricetin 50μM, (F) fisetin 25μM. (G-I) isoflavones— (G) genistein 75μM, (H) daidzein 200μM, (I) biochaninA 200μM. (J-K) flavones— (J) luteolin 200μM, (K) flavone 200μM. (L) flavanone narigenin 200μM.

    Journal: Environmental and molecular mutagenesis

    Article Title: Bioflavonoids promote stable translocations between MLL-AF9 breakpoint cluster regions independent of normal chromosomal context: Model system to screen environmental risks

    doi: 10.1002/em.22245

    Figure Lengend Snippet: γH2AX foci as marker of DNA damage observed 1 hr post-exposure to tested compounds at approximate calculated LD50 dose. (A) DMSO vehicle only. (B) etoposide 12.5μM. (C-F) flavonols— (C) quercetin 75μM, (D) kaempferol 100μM, (E) myricetin 50μM, (F) fisetin 25μM. (G-I) isoflavones— (G) genistein 75μM, (H) daidzein 200μM, (I) biochaninA 200μM. (J-K) flavones— (J) luteolin 200μM, (K) flavone 200μM. (L) flavanone narigenin 200μM.

    Article Snippet: Etoposide, all flavonoids, and vitamins were obtained from LKT Laboratories.

    Techniques: Marker

    Induction of (A) p-H2AX, (B) total p53, (C) p-p53(ser15), and (D–F) p53 effector proteins following 24-h etoposide, quercetin, and methyl methanesulfonate treatment. Circles, squares, and triangles represent the mean of three independent experiments (three biological replicates, each with three technical replicates). Cross bars represent the standard error of the mean (SEM). The lowest statistically significant ( p

    Journal: Toxicological Sciences

    Article Title: Profiling Dose-Dependent Activation of p53-Mediated Signaling Pathways by Chemicals with Distinct Mechanisms of DNA Damage

    doi: 10.1093/toxsci/kfu153

    Figure Lengend Snippet: Induction of (A) p-H2AX, (B) total p53, (C) p-p53(ser15), and (D–F) p53 effector proteins following 24-h etoposide, quercetin, and methyl methanesulfonate treatment. Circles, squares, and triangles represent the mean of three independent experiments (three biological replicates, each with three technical replicates). Cross bars represent the standard error of the mean (SEM). The lowest statistically significant ( p

    Article Snippet: Reagents and antibodies Etoposide (≥98%) (CAS no. 33419-42-0; Cat no. 152003; Lot no. 2249K) and quercetin (97%) (quercetin dehydrate; CAS no. 6151-25-3; Cat no. E7657; Lot no. 23925401) were purchased from LKT Laboratories and MP Biomedicals, respectively.

    Techniques:

    Time- and concentration-dependent response for p-p53(ser15) induction in HT1080 cells following exposure to (A) etoposide, (B) quercetin, and (C) methyl methanesulfonate. Cells were treated with DMSO (0.1%), etoposide, quercetin, or methyl methanesulfonate for 1, 2, 4, 6, 8, 16, or 24 h and analyzed for p-p53 using flow cytometry. Circles and triangles represent the mean of three independent experiments (three biological replicates, each with three technical replicates). Bars represent the standard error of the mean (SEM).

    Journal: Toxicological Sciences

    Article Title: Profiling Dose-Dependent Activation of p53-Mediated Signaling Pathways by Chemicals with Distinct Mechanisms of DNA Damage

    doi: 10.1093/toxsci/kfu153

    Figure Lengend Snippet: Time- and concentration-dependent response for p-p53(ser15) induction in HT1080 cells following exposure to (A) etoposide, (B) quercetin, and (C) methyl methanesulfonate. Cells were treated with DMSO (0.1%), etoposide, quercetin, or methyl methanesulfonate for 1, 2, 4, 6, 8, 16, or 24 h and analyzed for p-p53 using flow cytometry. Circles and triangles represent the mean of three independent experiments (three biological replicates, each with three technical replicates). Bars represent the standard error of the mean (SEM).

    Article Snippet: Reagents and antibodies Etoposide (≥98%) (CAS no. 33419-42-0; Cat no. 152003; Lot no. 2249K) and quercetin (97%) (quercetin dehydrate; CAS no. 6151-25-3; Cat no. E7657; Lot no. 23925401) were purchased from LKT Laboratories and MP Biomedicals, respectively.

    Techniques: Concentration Assay, Flow Cytometry, Cytometry

    Characterization of the damage mechanism-independent p53 response. (A) Venn diagram of genes differentially expressed genes regulated by p53 following exposure to etoposide, quercetin, or methyl methanesulfonate, which have been previously shown to be regulated by p53 binding. (B) Functional annotation graph of Gene Ontology (GO) terms enriched in the genes regulated by p53 and differentially expressed in response to exposure to all three chemicals. Terms are connected according to the structure of the parent-child relationships defined by GO. Blue terms are statistically enriched, relative to their prevalence in the genome ( p

    Journal: Toxicological Sciences

    Article Title: Profiling Dose-Dependent Activation of p53-Mediated Signaling Pathways by Chemicals with Distinct Mechanisms of DNA Damage

    doi: 10.1093/toxsci/kfu153

    Figure Lengend Snippet: Characterization of the damage mechanism-independent p53 response. (A) Venn diagram of genes differentially expressed genes regulated by p53 following exposure to etoposide, quercetin, or methyl methanesulfonate, which have been previously shown to be regulated by p53 binding. (B) Functional annotation graph of Gene Ontology (GO) terms enriched in the genes regulated by p53 and differentially expressed in response to exposure to all three chemicals. Terms are connected according to the structure of the parent-child relationships defined by GO. Blue terms are statistically enriched, relative to their prevalence in the genome ( p

    Article Snippet: Reagents and antibodies Etoposide (≥98%) (CAS no. 33419-42-0; Cat no. 152003; Lot no. 2249K) and quercetin (97%) (quercetin dehydrate; CAS no. 6151-25-3; Cat no. E7657; Lot no. 23925401) were purchased from LKT Laboratories and MP Biomedicals, respectively.

    Techniques: Binding Assay, Functional Assay

    Induction of (A) p-p53(ser46), (B) apoptosis, and (C) necrosis following 24-h etoposide, quercetin, and methyl methanesulfonate treatment. Circles, squares, and triangles represent the mean of three independent experiments (three biological replicates, each with three technical replicates). Cross bars represent the standard error of the mean (SEM). (B) Apoptosis indicates the percent of cells stained positive for cleaved caspase 3. (C) Necrosis indicates the percent of cells stained positive for membrane permeability dye. (D) Late apoptosis indicates percent of cells co-stained with cleaved caspase 3 and membrane permeability dye. The lowest statistically significant ( p

    Journal: Toxicological Sciences

    Article Title: Profiling Dose-Dependent Activation of p53-Mediated Signaling Pathways by Chemicals with Distinct Mechanisms of DNA Damage

    doi: 10.1093/toxsci/kfu153

    Figure Lengend Snippet: Induction of (A) p-p53(ser46), (B) apoptosis, and (C) necrosis following 24-h etoposide, quercetin, and methyl methanesulfonate treatment. Circles, squares, and triangles represent the mean of three independent experiments (three biological replicates, each with three technical replicates). Cross bars represent the standard error of the mean (SEM). (B) Apoptosis indicates the percent of cells stained positive for cleaved caspase 3. (C) Necrosis indicates the percent of cells stained positive for membrane permeability dye. (D) Late apoptosis indicates percent of cells co-stained with cleaved caspase 3 and membrane permeability dye. The lowest statistically significant ( p

    Article Snippet: Reagents and antibodies Etoposide (≥98%) (CAS no. 33419-42-0; Cat no. 152003; Lot no. 2249K) and quercetin (97%) (quercetin dehydrate; CAS no. 6151-25-3; Cat no. E7657; Lot no. 23925401) were purchased from LKT Laboratories and MP Biomedicals, respectively.

    Techniques: Staining, Permeability

    Induction of micronuclei following (A) etoposide, (B) quercetin, and (C) methyl methanesulfonate treatment. Circles represent the mean of three independent experiments (three biological replicates, each with three technical replicates). Cross bars represent the standard error of the mean (SEM). Insets show data for concentrations near the transition point on a linear scale, together with the model predicted using the Lutz and Lutz hockey stick model (Lutz and Lutz, 2009 ). The Lutz model p -values for the micronucleus curves were 0.30, 0.99, and 0.048 for etoposide, quercetin, and methyl methanesulfonate, respectively. The lowest statistically significant ( p

    Journal: Toxicological Sciences

    Article Title: Profiling Dose-Dependent Activation of p53-Mediated Signaling Pathways by Chemicals with Distinct Mechanisms of DNA Damage

    doi: 10.1093/toxsci/kfu153

    Figure Lengend Snippet: Induction of micronuclei following (A) etoposide, (B) quercetin, and (C) methyl methanesulfonate treatment. Circles represent the mean of three independent experiments (three biological replicates, each with three technical replicates). Cross bars represent the standard error of the mean (SEM). Insets show data for concentrations near the transition point on a linear scale, together with the model predicted using the Lutz and Lutz hockey stick model (Lutz and Lutz, 2009 ). The Lutz model p -values for the micronucleus curves were 0.30, 0.99, and 0.048 for etoposide, quercetin, and methyl methanesulfonate, respectively. The lowest statistically significant ( p

    Article Snippet: Reagents and antibodies Etoposide (≥98%) (CAS no. 33419-42-0; Cat no. 152003; Lot no. 2249K) and quercetin (97%) (quercetin dehydrate; CAS no. 6151-25-3; Cat no. E7657; Lot no. 23925401) were purchased from LKT Laboratories and MP Biomedicals, respectively.

    Techniques:

    Activation of protein and cell fate response at concentrations of etoposide, quercetin, or methyl methanesulfonate concentrations causing similar induction of p53. A p53-normalized concentration was established based on a similar level of p53 activation (approximately 25% of cells responding for total p53 at 24 h). This level of induction in p53 expression represents approximately half of the maximal induction observed with any of the three prototype chemicals. The resulting concentrations for comparison were 0.3-μM etoposide, 30-μM quercetin, and 200-μM methyl methanesulfonate. The degree of orange coloring indicates the degree of upregulation for a particular protein or process. For each endpoint, the percent of maximal response was calculated for each chemical. The response data were then divided into quintiles: 0–20%, 21–40%, 41–60%, 61–80%, and 81–100% of maximal response.

    Journal: Toxicological Sciences

    Article Title: Profiling Dose-Dependent Activation of p53-Mediated Signaling Pathways by Chemicals with Distinct Mechanisms of DNA Damage

    doi: 10.1093/toxsci/kfu153

    Figure Lengend Snippet: Activation of protein and cell fate response at concentrations of etoposide, quercetin, or methyl methanesulfonate concentrations causing similar induction of p53. A p53-normalized concentration was established based on a similar level of p53 activation (approximately 25% of cells responding for total p53 at 24 h). This level of induction in p53 expression represents approximately half of the maximal induction observed with any of the three prototype chemicals. The resulting concentrations for comparison were 0.3-μM etoposide, 30-μM quercetin, and 200-μM methyl methanesulfonate. The degree of orange coloring indicates the degree of upregulation for a particular protein or process. For each endpoint, the percent of maximal response was calculated for each chemical. The response data were then divided into quintiles: 0–20%, 21–40%, 41–60%, 61–80%, and 81–100% of maximal response.

    Article Snippet: Reagents and antibodies Etoposide (≥98%) (CAS no. 33419-42-0; Cat no. 152003; Lot no. 2249K) and quercetin (97%) (quercetin dehydrate; CAS no. 6151-25-3; Cat no. E7657; Lot no. 23925401) were purchased from LKT Laboratories and MP Biomedicals, respectively.

    Techniques: Activation Assay, Concentration Assay, Expressing

    Cell viability in HT1080 cells after treatment with (A) etoposide, (B) quercetin, or (C) methyl methanesulfonate. Cells were treated with DMSO, etoposide, quercetin, or methyl methanesulfonate for 4, 24, or 48 h. Cell viability was measured using an intracellular ATP content luminescence assay. The y-axes indicate the relative luminescence of the treated samples compared with control samples. Circles (4 h), squares (24 h), and triangles (48 h) represent the mean of three independent experiments (three biological and three technical replicates). Cross bars represent the standard error of the mean (SEM) of the data. RLU: relative fluorescence units. Etoposide caused a statistically significant ( p

    Journal: Toxicological Sciences

    Article Title: Profiling Dose-Dependent Activation of p53-Mediated Signaling Pathways by Chemicals with Distinct Mechanisms of DNA Damage

    doi: 10.1093/toxsci/kfu153

    Figure Lengend Snippet: Cell viability in HT1080 cells after treatment with (A) etoposide, (B) quercetin, or (C) methyl methanesulfonate. Cells were treated with DMSO, etoposide, quercetin, or methyl methanesulfonate for 4, 24, or 48 h. Cell viability was measured using an intracellular ATP content luminescence assay. The y-axes indicate the relative luminescence of the treated samples compared with control samples. Circles (4 h), squares (24 h), and triangles (48 h) represent the mean of three independent experiments (three biological and three technical replicates). Cross bars represent the standard error of the mean (SEM) of the data. RLU: relative fluorescence units. Etoposide caused a statistically significant ( p

    Article Snippet: Reagents and antibodies Etoposide (≥98%) (CAS no. 33419-42-0; Cat no. 152003; Lot no. 2249K) and quercetin (97%) (quercetin dehydrate; CAS no. 6151-25-3; Cat no. E7657; Lot no. 23925401) were purchased from LKT Laboratories and MP Biomedicals, respectively.

    Techniques: Luminescence Assay, Fluorescence

    Time course for DNA damage and p53 network response in HT1080 cells following exposure to etoposide, quercetin, or methyl methanesulfonate. Representative Western blots from three separate experiments are shown. HT1080 cells were exposed to 0.1% DMSO (control cells; Ctrl), 1-μM etoposide (ETP), 30-μM quercetin (QUE), or 200-μM methyl methanesulfonate (MMS) for 3, 8, or 24 h. Total cellular protein was isolated and subjected to immunoblot analysis. GAPDH was used as an internal control.

    Journal: Toxicological Sciences

    Article Title: Profiling Dose-Dependent Activation of p53-Mediated Signaling Pathways by Chemicals with Distinct Mechanisms of DNA Damage

    doi: 10.1093/toxsci/kfu153

    Figure Lengend Snippet: Time course for DNA damage and p53 network response in HT1080 cells following exposure to etoposide, quercetin, or methyl methanesulfonate. Representative Western blots from three separate experiments are shown. HT1080 cells were exposed to 0.1% DMSO (control cells; Ctrl), 1-μM etoposide (ETP), 30-μM quercetin (QUE), or 200-μM methyl methanesulfonate (MMS) for 3, 8, or 24 h. Total cellular protein was isolated and subjected to immunoblot analysis. GAPDH was used as an internal control.

    Article Snippet: Reagents and antibodies Etoposide (≥98%) (CAS no. 33419-42-0; Cat no. 152003; Lot no. 2249K) and quercetin (97%) (quercetin dehydrate; CAS no. 6151-25-3; Cat no. E7657; Lot no. 23925401) were purchased from LKT Laboratories and MP Biomedicals, respectively.

    Techniques: Western Blot, Isolation

    Cell cycle effects following 24-h (A) etoposide, (B) quercetin, and (C) methyl methanesulfonate treatment. Circles, squares, and triangles represent the mean of three independent experiments (three biological replicates, each with three technical replicates). Cross bars represent the standard error of the mean (SEM). The lowest statistically significant ( p

    Journal: Toxicological Sciences

    Article Title: Profiling Dose-Dependent Activation of p53-Mediated Signaling Pathways by Chemicals with Distinct Mechanisms of DNA Damage

    doi: 10.1093/toxsci/kfu153

    Figure Lengend Snippet: Cell cycle effects following 24-h (A) etoposide, (B) quercetin, and (C) methyl methanesulfonate treatment. Circles, squares, and triangles represent the mean of three independent experiments (three biological replicates, each with three technical replicates). Cross bars represent the standard error of the mean (SEM). The lowest statistically significant ( p

    Article Snippet: Reagents and antibodies Etoposide (≥98%) (CAS no. 33419-42-0; Cat no. 152003; Lot no. 2249K) and quercetin (97%) (quercetin dehydrate; CAS no. 6151-25-3; Cat no. E7657; Lot no. 23925401) were purchased from LKT Laboratories and MP Biomedicals, respectively.

    Techniques: