escherichia coli bl21 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs competent bl21 e coli
    Recombinant c3B protein expression, purification, and detection. (A) Coomassie blue-stained polyacrylamide gel of recombinant MBP-c3B protein expressed in BL21  E. coli  and affinity purified using amylose resin. Lane M, molecular mass markers (Mark 12;
    Competent Bl21 E Coli, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/competent bl21 e coli/product/New England Biolabs
    Average 99 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    competent bl21 e coli - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    ATCC e coli bl21
    SDS–PAGE analysis of glutathione-S-transferase (GST)-tagged recombinant Apl_avian β-defensin (Apl_AvBD) proteins expressed in E. coli <t>BL21</t> (DE3) cells. (A) total protein from BL21 containing Apl_AvBD1, 3, 5, 6, 16, and GST with IPTG induction, respectively; (B) inclusion bodies with Apl_AvBD1, 3, 5, 6, 16, and GST respectively; (C) purified proteins of Apl_AvBD1, 3, 5, 6, 16, and GST with IPTG induction, respectively. IPTG, isopropyl-beta-D-thiogalactoside.
    E Coli Bl21, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 96 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/ATCC
    Average 99 stars, based on 96 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore e coli bl 21
    RP-HPLC separation of the heated cellular extract. Cellular extract of E. coli <t>BL21</t> [DE3] (pMA24) were treated as described in Section 2.4 . Chromatogram was monitored at (A) λ = 220 nm and (B) λ = 280 nm. Peaks were collected and individually analyzed by MALDI-TOF MS.
    E Coli Bl 21, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1534 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl 21/product/Millipore
    Average 99 stars, based on 1534 article reviews
    Price from $9.99 to $1999.99
    e coli bl 21 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    81
    Thermo Fisher escherichia coli e coli bl21
    Recombinant enolase1 from C. albicans has TGase activity. The C. albicans ENO1 gene was cloned in the pCold II plasmid and transformed into E. coli <t>BL21</t> (DE3) pLysS-competent cells; protein production was induced at 23 °C for 24 h. A , Eno1 protein was purified by IMAC with a Ni 2+ -NTA–agarose column in native conditions as described, and elution fractions were evaluated by 12% SDS-PAGE; MWM , protein molecular weight markers. Empty vector was also transformed in bacteria and passed through the same IMAC column, and the fractions obtained were also analyzed as a negative control (data not shown). B , Western blot of purified recombinant protein using anti-His–tag polyclonal antibodies ( lane 2 ) and rabbit anti-rCaEno1 protein ( lane 3 ). C , Western blot of C. albicans cell fractions using anti-rCaEno1 polyclonal antibodies. WPE , whole-protein extracts; CW , cell wall fraction; MMF , mixed membrane fraction; S-35K , soluble cytosolic fraction. Arrows indicate Eno1 protein. D , enolase activity was determined with purified rCaEno1 protein. E , TGase activity determined with purified rCaEno1 protein. These results allowed us to conclude that rCaEno1 protein has both enolase and transglutaminase activities. Statistical unpaired t test. *, p
    Escherichia Coli E Coli Bl21, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 81/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli e coli bl21/product/Thermo Fisher
    Average 81 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    escherichia coli e coli bl21 - by Bioz Stars, 2020-04
    81/100 stars
      Buy from Supplier

    99
    ATCC e coli bl21 de3
    Recombinant enolase1 from C. albicans has TGase activity. The C. albicans ENO1 gene was cloned in the pCold II plasmid and transformed into E. coli <t>BL21</t> (DE3) pLysS-competent cells; protein production was induced at 23 °C for 24 h. A , Eno1 protein was purified by IMAC with a Ni 2+ -NTA–agarose column in native conditions as described, and elution fractions were evaluated by 12% SDS-PAGE; MWM , protein molecular weight markers. Empty vector was also transformed in bacteria and passed through the same IMAC column, and the fractions obtained were also analyzed as a negative control (data not shown). B , Western blot of purified recombinant protein using anti-His–tag polyclonal antibodies ( lane 2 ) and rabbit anti-rCaEno1 protein ( lane 3 ). C , Western blot of C. albicans cell fractions using anti-rCaEno1 polyclonal antibodies. WPE , whole-protein extracts; CW , cell wall fraction; MMF , mixed membrane fraction; S-35K , soluble cytosolic fraction. Arrows indicate Eno1 protein. D , enolase activity was determined with purified rCaEno1 protein. E , TGase activity determined with purified rCaEno1 protein. These results allowed us to conclude that rCaEno1 protein has both enolase and transglutaminase activities. Statistical unpaired t test. *, p
    E Coli Bl21 De3, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21 de3/product/ATCC
    Average 99 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 de3 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    91
    Stratagene escherichia coli e coli bl21 codonplus
    Recombinant enolase1 from C. albicans has TGase activity. The C. albicans ENO1 gene was cloned in the pCold II plasmid and transformed into E. coli <t>BL21</t> (DE3) pLysS-competent cells; protein production was induced at 23 °C for 24 h. A , Eno1 protein was purified by IMAC with a Ni 2+ -NTA–agarose column in native conditions as described, and elution fractions were evaluated by 12% SDS-PAGE; MWM , protein molecular weight markers. Empty vector was also transformed in bacteria and passed through the same IMAC column, and the fractions obtained were also analyzed as a negative control (data not shown). B , Western blot of purified recombinant protein using anti-His–tag polyclonal antibodies ( lane 2 ) and rabbit anti-rCaEno1 protein ( lane 3 ). C , Western blot of C. albicans cell fractions using anti-rCaEno1 polyclonal antibodies. WPE , whole-protein extracts; CW , cell wall fraction; MMF , mixed membrane fraction; S-35K , soluble cytosolic fraction. Arrows indicate Eno1 protein. D , enolase activity was determined with purified rCaEno1 protein. E , TGase activity determined with purified rCaEno1 protein. These results allowed us to conclude that rCaEno1 protein has both enolase and transglutaminase activities. Statistical unpaired t test. *, p
    Escherichia Coli E Coli Bl21 Codonplus, supplied by Stratagene, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli e coli bl21 codonplus/product/Stratagene
    Average 91 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    escherichia coli e coli bl21 codonplus - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    97
    Pasteur Institute escherichia coli e coli bl21 strain
    Recombinant enolase1 from C. albicans has TGase activity. The C. albicans ENO1 gene was cloned in the pCold II plasmid and transformed into E. coli <t>BL21</t> (DE3) pLysS-competent cells; protein production was induced at 23 °C for 24 h. A , Eno1 protein was purified by IMAC with a Ni 2+ -NTA–agarose column in native conditions as described, and elution fractions were evaluated by 12% SDS-PAGE; MWM , protein molecular weight markers. Empty vector was also transformed in bacteria and passed through the same IMAC column, and the fractions obtained were also analyzed as a negative control (data not shown). B , Western blot of purified recombinant protein using anti-His–tag polyclonal antibodies ( lane 2 ) and rabbit anti-rCaEno1 protein ( lane 3 ). C , Western blot of C. albicans cell fractions using anti-rCaEno1 polyclonal antibodies. WPE , whole-protein extracts; CW , cell wall fraction; MMF , mixed membrane fraction; S-35K , soluble cytosolic fraction. Arrows indicate Eno1 protein. D , enolase activity was determined with purified rCaEno1 protein. E , TGase activity determined with purified rCaEno1 protein. These results allowed us to conclude that rCaEno1 protein has both enolase and transglutaminase activities. Statistical unpaired t test. *, p
    Escherichia Coli E Coli Bl21 Strain, supplied by Pasteur Institute, used in various techniques. Bioz Stars score: 97/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli e coli bl21 strain/product/Pasteur Institute
    Average 97 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    escherichia coli e coli bl21 strain - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    99
    ATCC escherichia coli strain bl21
    Recombinant enolase1 from C. albicans has TGase activity. The C. albicans ENO1 gene was cloned in the pCold II plasmid and transformed into E. coli <t>BL21</t> (DE3) pLysS-competent cells; protein production was induced at 23 °C for 24 h. A , Eno1 protein was purified by IMAC with a Ni 2+ -NTA–agarose column in native conditions as described, and elution fractions were evaluated by 12% SDS-PAGE; MWM , protein molecular weight markers. Empty vector was also transformed in bacteria and passed through the same IMAC column, and the fractions obtained were also analyzed as a negative control (data not shown). B , Western blot of purified recombinant protein using anti-His–tag polyclonal antibodies ( lane 2 ) and rabbit anti-rCaEno1 protein ( lane 3 ). C , Western blot of C. albicans cell fractions using anti-rCaEno1 polyclonal antibodies. WPE , whole-protein extracts; CW , cell wall fraction; MMF , mixed membrane fraction; S-35K , soluble cytosolic fraction. Arrows indicate Eno1 protein. D , enolase activity was determined with purified rCaEno1 protein. E , TGase activity determined with purified rCaEno1 protein. These results allowed us to conclude that rCaEno1 protein has both enolase and transglutaminase activities. Statistical unpaired t test. *, p
    Escherichia Coli Strain Bl21, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli strain bl21/product/ATCC
    Average 99 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    escherichia coli strain bl21 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs escherichia coli bl21 de3 competent cells
    Recombinant enolase1 from C. albicans has TGase activity. The C. albicans ENO1 gene was cloned in the pCold II plasmid and transformed into E. coli <t>BL21</t> (DE3) pLysS-competent cells; protein production was induced at 23 °C for 24 h. A , Eno1 protein was purified by IMAC with a Ni 2+ -NTA–agarose column in native conditions as described, and elution fractions were evaluated by 12% SDS-PAGE; MWM , protein molecular weight markers. Empty vector was also transformed in bacteria and passed through the same IMAC column, and the fractions obtained were also analyzed as a negative control (data not shown). B , Western blot of purified recombinant protein using anti-His–tag polyclonal antibodies ( lane 2 ) and rabbit anti-rCaEno1 protein ( lane 3 ). C , Western blot of C. albicans cell fractions using anti-rCaEno1 polyclonal antibodies. WPE , whole-protein extracts; CW , cell wall fraction; MMF , mixed membrane fraction; S-35K , soluble cytosolic fraction. Arrows indicate Eno1 protein. D , enolase activity was determined with purified rCaEno1 protein. E , TGase activity determined with purified rCaEno1 protein. These results allowed us to conclude that rCaEno1 protein has both enolase and transglutaminase activities. Statistical unpaired t test. *, p
    Escherichia Coli Bl21 De3 Competent Cells, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli bl21 de3 competent cells/product/New England Biolabs
    Average 99 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    escherichia coli bl21 de3 competent cells - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    88
    Thermo Fisher escherichia coli e coli bl21 de3 cells
    Recombinant enolase1 from C. albicans has TGase activity. The C. albicans ENO1 gene was cloned in the pCold II plasmid and transformed into E. coli <t>BL21</t> (DE3) pLysS-competent cells; protein production was induced at 23 °C for 24 h. A , Eno1 protein was purified by IMAC with a Ni 2+ -NTA–agarose column in native conditions as described, and elution fractions were evaluated by 12% SDS-PAGE; MWM , protein molecular weight markers. Empty vector was also transformed in bacteria and passed through the same IMAC column, and the fractions obtained were also analyzed as a negative control (data not shown). B , Western blot of purified recombinant protein using anti-His–tag polyclonal antibodies ( lane 2 ) and rabbit anti-rCaEno1 protein ( lane 3 ). C , Western blot of C. albicans cell fractions using anti-rCaEno1 polyclonal antibodies. WPE , whole-protein extracts; CW , cell wall fraction; MMF , mixed membrane fraction; S-35K , soluble cytosolic fraction. Arrows indicate Eno1 protein. D , enolase activity was determined with purified rCaEno1 protein. E , TGase activity determined with purified rCaEno1 protein. These results allowed us to conclude that rCaEno1 protein has both enolase and transglutaminase activities. Statistical unpaired t test. *, p
    Escherichia Coli E Coli Bl21 De3 Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli e coli bl21 de3 cells/product/Thermo Fisher
    Average 88 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    escherichia coli e coli bl21 de3 cells - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    85
    GE Healthcare escherichia coli e coli bl21
    Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in <t>BL21</t> bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.
    Escherichia Coli E Coli Bl21, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 85/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli e coli bl21/product/GE Healthcare
    Average 85 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    escherichia coli e coli bl21 - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    92
    tiangen biotech co escherichia coli e coli bl21
    Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in <t>BL21</t> bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.
    Escherichia Coli E Coli Bl21, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli e coli bl21/product/tiangen biotech co
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    escherichia coli e coli bl21 - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    99
    Millipore bl21 de3 t1r competent escherichia coli
    Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in <t>BL21</t> bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.
    Bl21 De3 T1r Competent Escherichia Coli, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 t1r competent escherichia coli/product/Millipore
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 t1r competent escherichia coli - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher e coli bl21 de3
    Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in <t>BL21</t> bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.
    E Coli Bl21 De3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1114 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21 de3/product/Thermo Fisher
    Average 99 stars, based on 1114 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 de3 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Stratagene e coli bl21
    SDS-PAGE analysis of purified protein recombinant SllB in E. coli <t>BL21</t> cells. Lane M: Takara Protein Marker; lane 1, SDS-PAGE analysis of the recombinant S-layer protein before purification; lane 2, SDS-PAGE analysis of the purified recombinant protein.
    E Coli Bl21, supplied by Stratagene, used in various techniques. Bioz Stars score: 99/100, based on 2866 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/Stratagene
    Average 99 stars, based on 2866 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    96
    Merck & Co e coli bl21
    SDS-PAGE analysis of the purified xylanases obtained from E.coli <t>BL21.</t> Lane 1: 100 mM imidazole wash of the recombined protein XYNB to Ni-nitrilotriacetic acid resin; Lane2: 100 mM imidazole wash of the recombined protein XYNA1 to Ni-nitrilotriacetic acid resin; M: Standard protein molecular weight. The protein gels were stained with Coomasie Brilliant Blue R250. →:interest proteins
    E Coli Bl21, supplied by Merck & Co, used in various techniques. Bioz Stars score: 96/100, based on 112 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/Merck & Co
    Average 96 stars, based on 112 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    93
    Merck KGaA e coli bl21
    SDS-PAGE (a) and western blot (b) analyses of the recombinant BirA protein expressed via pET24-BirA vector in <t>BL21</t> E. coli cells by addition of IPTG to the final concentration of 1 mM. (a) Lane 1: Protein molecular weight marker (Unstained protein molecular weight marker, Fermentas, Lithuania). Different induced colonies (lane 3–7) showed the same size of BirA (36.6 kDa) expression compared with un-induced sample (lane 2) (b) Western blot analysis of recombinant BirA protein by anti-His antibody specific for C-terminal polyhistidine tag indicated the specific 36.6 kDa protein band. Lane 1: Protein marker (PrestainedProtein Ladder, CinnaGen, Iran) Lane 2: Un-induced bacterial lysate. Lane 3: Recombinant BirA protein (36.6 kDa). Arrows indicate the target protein bands
    E Coli Bl21, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 93/100, based on 240 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/Merck KGaA
    Average 93 stars, based on 240 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    99
    TaKaRa e coli bl21
    Expression of rDer f 5 in Escherichia coli <t>BL21</t> cells. E. coli BL21 cells were transformed with either pET28a(+)-Der f 5 or empty vector pET28a(+) as control. A , SDS-PAGE analysis of the rDer f 5 protein. Lane M 1 = TaKaRa protein marker (Broad); lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = supernatant of cells containing pET28a; lane 3 = pellet of cells containing pET28a; lane 4 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5; lane 5 = supernatant of cells containing pET28a(+)-Der f 5; lane 6 = pellet of cells containing pET28a(+)-Der f 5. B , Western blotting analysis of the rDer f 5 protein. Lane M 2 = Precision Plus Protein Standards; lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5. Arrows point to the band of rDer f 5.
    E Coli Bl21, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 550 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/TaKaRa
    Average 99 stars, based on 550 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Promega e coli bl21
    Cloning, expression, and large-scale cultivation of dimeric thymosin beta 4 (DTβ4) engineered bacteria. ( A ) Two entire complementary DNA sequences of thymosin beta 4 (Tβ4) were constructed into a prokaryotic expression plasmid with a small DNA linker (GGTTCT). The results show a 267 bp fragment with correct sequence as expected (arrow). ( B ) Five colonies obtained after the transformation of Escherichia coli were randomly picked to test the protein expression on a small scale with sodium dodecyl sulfate polyacrylamide gel electrophoresis. After isopropyl β-D-1-thiogalactopyranoside (IPTG) induction, a new protein (arrow) appeared in each culture pellet and accounted for over 15% of all the bacteria proteins (1: molecular ladder; 2–6: protein expression of picked five clones; 7: protein expression without IPTG induction). ( C ) Bacterial growth curve of <t>BL21/DTβ4</t> in a 10 L fermenter (the arrow indicates the induction time). ( D ) DTβ4 expression (arrow) during fermentation (1: DTβ4 expression without IPTG induction; 2–6: DTβ4 expression every hour after IPTG induction). Abbreviation: DNA, deoxyribonucleic acid.
    E Coli Bl21, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 586 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/Promega
    Average 99 stars, based on 586 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    92
    Millipore bl21 de3 escherichia coli
    Cloning, expression, and large-scale cultivation of dimeric thymosin beta 4 (DTβ4) engineered bacteria. ( A ) Two entire complementary DNA sequences of thymosin beta 4 (Tβ4) were constructed into a prokaryotic expression plasmid with a small DNA linker (GGTTCT). The results show a 267 bp fragment with correct sequence as expected (arrow). ( B ) Five colonies obtained after the transformation of Escherichia coli were randomly picked to test the protein expression on a small scale with sodium dodecyl sulfate polyacrylamide gel electrophoresis. After isopropyl β-D-1-thiogalactopyranoside (IPTG) induction, a new protein (arrow) appeared in each culture pellet and accounted for over 15% of all the bacteria proteins (1: molecular ladder; 2–6: protein expression of picked five clones; 7: protein expression without IPTG induction). ( C ) Bacterial growth curve of <t>BL21/DTβ4</t> in a 10 L fermenter (the arrow indicates the induction time). ( D ) DTβ4 expression (arrow) during fermentation (1: DTβ4 expression without IPTG induction; 2–6: DTβ4 expression every hour after IPTG induction). Abbreviation: DNA, deoxyribonucleic acid.
    Bl21 De3 Escherichia Coli, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 116 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 escherichia coli/product/Millipore
    Average 92 stars, based on 116 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 escherichia coli - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    79
    Covance bl21 escherichia coli
    Cloning, expression, and large-scale cultivation of dimeric thymosin beta 4 (DTβ4) engineered bacteria. ( A ) Two entire complementary DNA sequences of thymosin beta 4 (Tβ4) were constructed into a prokaryotic expression plasmid with a small DNA linker (GGTTCT). The results show a 267 bp fragment with correct sequence as expected (arrow). ( B ) Five colonies obtained after the transformation of Escherichia coli were randomly picked to test the protein expression on a small scale with sodium dodecyl sulfate polyacrylamide gel electrophoresis. After isopropyl β-D-1-thiogalactopyranoside (IPTG) induction, a new protein (arrow) appeared in each culture pellet and accounted for over 15% of all the bacteria proteins (1: molecular ladder; 2–6: protein expression of picked five clones; 7: protein expression without IPTG induction). ( C ) Bacterial growth curve of <t>BL21/DTβ4</t> in a 10 L fermenter (the arrow indicates the induction time). ( D ) DTβ4 expression (arrow) during fermentation (1: DTβ4 expression without IPTG induction; 2–6: DTβ4 expression every hour after IPTG induction). Abbreviation: DNA, deoxyribonucleic acid.
    Bl21 Escherichia Coli, supplied by Covance, used in various techniques. Bioz Stars score: 79/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 escherichia coli/product/Covance
    Average 79 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bl21 escherichia coli - by Bioz Stars, 2020-04
    79/100 stars
      Buy from Supplier

    80
    Pfizer Inc escherichia coli bl21
    Cloning, expression, and large-scale cultivation of dimeric thymosin beta 4 (DTβ4) engineered bacteria. ( A ) Two entire complementary DNA sequences of thymosin beta 4 (Tβ4) were constructed into a prokaryotic expression plasmid with a small DNA linker (GGTTCT). The results show a 267 bp fragment with correct sequence as expected (arrow). ( B ) Five colonies obtained after the transformation of Escherichia coli were randomly picked to test the protein expression on a small scale with sodium dodecyl sulfate polyacrylamide gel electrophoresis. After isopropyl β-D-1-thiogalactopyranoside (IPTG) induction, a new protein (arrow) appeared in each culture pellet and accounted for over 15% of all the bacteria proteins (1: molecular ladder; 2–6: protein expression of picked five clones; 7: protein expression without IPTG induction). ( C ) Bacterial growth curve of <t>BL21/DTβ4</t> in a 10 L fermenter (the arrow indicates the induction time). ( D ) DTβ4 expression (arrow) during fermentation (1: DTβ4 expression without IPTG induction; 2–6: DTβ4 expression every hour after IPTG induction). Abbreviation: DNA, deoxyribonucleic acid.
    Escherichia Coli Bl21, supplied by Pfizer Inc, used in various techniques. Bioz Stars score: 80/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli bl21/product/Pfizer Inc
    Average 80 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    escherichia coli bl21 - by Bioz Stars, 2020-04
    80/100 stars
      Buy from Supplier

    96
    TransGen biotech co e coli bl21
    Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli <t>BL21/pETSip2</t> (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P
    E Coli Bl21, supplied by TransGen biotech co, used in various techniques. Bioz Stars score: 96/100, based on 96 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/TransGen biotech co
    Average 96 stars, based on 96 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    93
    Agilent technologies escherichia coli e coli bl21 codonplus
    Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli <t>BL21/pETSip2</t> (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P
    Escherichia Coli E Coli Bl21 Codonplus, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 93/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli e coli bl21 codonplus/product/Agilent technologies
    Average 93 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    escherichia coli e coli bl21 codonplus - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    99
    Agilent technologies e coli bl21
    Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli <t>BL21/pETSip2</t> (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P
    E Coli Bl21, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 99/100, based on 534 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/Agilent technologies
    Average 99 stars, based on 534 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    ATCC e coli strain mre600
    Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli <t>BL21/pETSip2</t> (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P
    E Coli Strain Mre600, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli strain mre600/product/ATCC
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    e coli strain mre600 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    88
    Millipore escherichia coli e coli bl21 de3 star cells
    Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli <t>BL21/pETSip2</t> (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P
    Escherichia Coli E Coli Bl21 De3 Star Cells, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli e coli bl21 de3 star cells/product/Millipore
    Average 88 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    escherichia coli e coli bl21 de3 star cells - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    93
    GenScript e coli bl21
    Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli <t>BL21/pETSip2</t> (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P
    E Coli Bl21, supplied by GenScript, used in various techniques. Bioz Stars score: 93/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/GenScript
    Average 93 stars, based on 49 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher host escherichia coli bl21
    Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli <t>BL21/pETSip2</t> (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P
    Host Escherichia Coli Bl21, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/host escherichia coli bl21/product/Thermo Fisher
    Average 99 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    host escherichia coli bl21 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Recombinant c3B protein expression, purification, and detection. (A) Coomassie blue-stained polyacrylamide gel of recombinant MBP-c3B protein expressed in BL21  E. coli  and affinity purified using amylose resin. Lane M, molecular mass markers (Mark 12;

    Journal: Journal of Clinical Microbiology

    Article Title: Pan-Serotype Diagnostic for Foot-and-Mouth Disease Using the Consensus Antigen of Nonstructural Protein 3B

    doi: 10.1128/JCM.03491-14

    Figure Lengend Snippet: Recombinant c3B protein expression, purification, and detection. (A) Coomassie blue-stained polyacrylamide gel of recombinant MBP-c3B protein expressed in BL21 E. coli and affinity purified using amylose resin. Lane M, molecular mass markers (Mark 12;

    Article Snippet: Chemically competent BL21 E. coli (NEB) was transformed with 10 ng pMAL-c5e or pMAL-c3B for overexpression of recombinant MBP or MBP-c3B fusion protein, according to the manufacturer's instructions.

    Techniques: Recombinant, Expressing, Purification, Staining, Affinity Purification

    SDS–PAGE analysis of glutathione-S-transferase (GST)-tagged recombinant Apl_avian β-defensin (Apl_AvBD) proteins expressed in E. coli BL21 (DE3) cells. (A) total protein from BL21 containing Apl_AvBD1, 3, 5, 6, 16, and GST with IPTG induction, respectively; (B) inclusion bodies with Apl_AvBD1, 3, 5, 6, 16, and GST respectively; (C) purified proteins of Apl_AvBD1, 3, 5, 6, 16, and GST with IPTG induction, respectively. IPTG, isopropyl-beta-D-thiogalactoside.

    Journal: PLoS ONE

    Article Title: Identification, Expression and Activity Analyses of Five Novel Duck Beta-Defensins

    doi: 10.1371/journal.pone.0047743

    Figure Lengend Snippet: SDS–PAGE analysis of glutathione-S-transferase (GST)-tagged recombinant Apl_avian β-defensin (Apl_AvBD) proteins expressed in E. coli BL21 (DE3) cells. (A) total protein from BL21 containing Apl_AvBD1, 3, 5, 6, 16, and GST with IPTG induction, respectively; (B) inclusion bodies with Apl_AvBD1, 3, 5, 6, 16, and GST respectively; (C) purified proteins of Apl_AvBD1, 3, 5, 6, 16, and GST with IPTG induction, respectively. IPTG, isopropyl-beta-D-thiogalactoside.

    Article Snippet: Antibacterial Activity Colony counting assays were performed according to the methods used in previous studies to investigate the antimicrobial activities of glutathione-S-transferase (GST) and the recombinant AvBDs (rAvBDs), and synthetic AvBDs (sAvBDs) from ducks against four strains of Gram-positive bacteria: Micrococcus tetragenus (ATCC2835), Lactobacillus (ATCC33222), Staphylococcus aureus (ATCC 29213), and Bacillus cereus (ATCC 9193); and eight strains of Gram-negative bacteria: Bordetella bronchiseptica (S80103), Proteus mirabilis (ATCC29245), Pseudomonas aeruginosa (ATCC 9027), Pasteurella multocida (ATCC 6529), E. coli BL21 (DE3), Salmonella pullorum (C79-11-S11), Salmonella choleraesuis (CVCC 2140), and Salmonella enteritidis (ATCC 3021).

    Techniques: SDS Page, Recombinant, Purification

    Liquid extraction surface analysis (LESA) mass spectra of seven bacterial strains: Escherichia coli K-12, Escherichia coli BL21 mCherry, Pseudomonas aeruginosa PS1054, Staphylococcus aureus MSSA476, Streptococcus pneumoniae D39, Streptococcus oralis ATCC 35037, and Streptococcus gordonii ATCC 35105. All mass spectra were acquired immediately following incubation of the colonies at 37 °C, with use of the 40:60:1 acetonitrile–water–formic acid solvent system for Gram-negative bacteria and the 50:45:5 variant for Gram-positive bacteria. The streptococci were incubated under semianaerobic conditions for optimum growth; the remaining strains were grown in open air

    Journal: Journal of the American Society for Mass Spectrometry

    Article Title: Top-Down LESA Mass Spectrometry Protein Analysis of Gram-Positive and Gram-Negative Bacteria

    doi: 10.1007/s13361-017-1718-8

    Figure Lengend Snippet: Liquid extraction surface analysis (LESA) mass spectra of seven bacterial strains: Escherichia coli K-12, Escherichia coli BL21 mCherry, Pseudomonas aeruginosa PS1054, Staphylococcus aureus MSSA476, Streptococcus pneumoniae D39, Streptococcus oralis ATCC 35037, and Streptococcus gordonii ATCC 35105. All mass spectra were acquired immediately following incubation of the colonies at 37 °C, with use of the 40:60:1 acetonitrile–water–formic acid solvent system for Gram-negative bacteria and the 50:45:5 variant for Gram-positive bacteria. The streptococci were incubated under semianaerobic conditions for optimum growth; the remaining strains were grown in open air

    Article Snippet: General Overview of the Mass Spectra Figure shows representative mass spectra of seven bacterial colonies corresponding to seven strains: Gram-negative E. coli K-12, E. coli BL21 mCherry, and P. aeruginosa PS1054, and Gram-positive S. aureus MSSA476, S. pneumoniae D39, S. oralis ATCC 35037, and S. gordonii ATCC 35105.

    Techniques: Incubation, Variant Assay

    (A) SDS-PAGE profile of an expressed recombinant Omp29 protein. M, molecular mass markers; lane 1, E. coli strain BL21; lane 2, E. coli strain BL21 transformed with the pET21a/Omp29 plasmid but uninduced; lane 3, E. coli strain BL21 transformed with the pET21a/Omp29 plasmid and induced with 0.4 mM IPTG. Note the thick 29-kDa protein demonstrated in lane 3. (B) Immunoblotting of SDS-PAGE gel using anti-Omp29 hyperimmune serum (1:10,000 diluted). M, molecular mass markers; P, cell lysate of E. coli BL21 expressing Omp29 protein; N, cell lysate of E. coli BL21; lane 1, cell lysate of ATCC 43504, the parent strain of Omp29 protein; lane 2, cell lysate of SS1; lane 3, cell lysate of OMU116; lane 4, cell lysate of OMU131; lane 5, cell lysate of OMU73; lane 6, cell lysate of OMU14; lane 7, cell lysate of OMU125; lane 8, cell lysate of OMU142; lane 9, cell lysate of OMU136; lane 10, cell lysate of OMU143. (C) Immunoblotting of SDS-PAGE gel separating cell lysate of E. coli BL21 expressing Omp29 protein using eight distinct sera from patients with H. pylori infection (1:5,000 diluted). Each number represents serum from a patient from whom the H. pylori clinical strain of the same number in panel B was isolated. M, molecular mass markers.

    Journal: Infection and Immunity

    Article Title: Comparison of Genomic Structures and Antigenic Reactivities of Orthologous 29-Kilodalton Outer Membrane Proteins of Helicobacter pylori

    doi: 10.1128/IAI.69.11.6846-6852.2001

    Figure Lengend Snippet: (A) SDS-PAGE profile of an expressed recombinant Omp29 protein. M, molecular mass markers; lane 1, E. coli strain BL21; lane 2, E. coli strain BL21 transformed with the pET21a/Omp29 plasmid but uninduced; lane 3, E. coli strain BL21 transformed with the pET21a/Omp29 plasmid and induced with 0.4 mM IPTG. Note the thick 29-kDa protein demonstrated in lane 3. (B) Immunoblotting of SDS-PAGE gel using anti-Omp29 hyperimmune serum (1:10,000 diluted). M, molecular mass markers; P, cell lysate of E. coli BL21 expressing Omp29 protein; N, cell lysate of E. coli BL21; lane 1, cell lysate of ATCC 43504, the parent strain of Omp29 protein; lane 2, cell lysate of SS1; lane 3, cell lysate of OMU116; lane 4, cell lysate of OMU131; lane 5, cell lysate of OMU73; lane 6, cell lysate of OMU14; lane 7, cell lysate of OMU125; lane 8, cell lysate of OMU142; lane 9, cell lysate of OMU136; lane 10, cell lysate of OMU143. (C) Immunoblotting of SDS-PAGE gel separating cell lysate of E. coli BL21 expressing Omp29 protein using eight distinct sera from patients with H. pylori infection (1:5,000 diluted). Each number represents serum from a patient from whom the H. pylori clinical strain of the same number in panel B was isolated. M, molecular mass markers.

    Article Snippet: In immunoblot analysis with anti-Omp29 hyperimmune serum, the homologous lysate of E. coli BL21 expressing Omp29 protein and the lysate of H. pylori ATCC 43504, the parent strain of Omp29 protein, showed a 29-kDa mobility band.

    Techniques: SDS Page, Recombinant, Transformation Assay, Plasmid Preparation, Expressing, Infection, Isolation

    RP-HPLC separation of the heated cellular extract. Cellular extract of E. coli BL21 [DE3] (pMA24) were treated as described in Section 2.4 . Chromatogram was monitored at (A) λ = 220 nm and (B) λ = 280 nm. Peaks were collected and individually analyzed by MALDI-TOF MS.

    Journal: FEBS Open Bio

    Article Title: A new hybrid bacteriocin, Ent35-MccV, displays antimicrobial activity against pathogenic Gram-positive and Gram-negative bacteria

    doi: 10.1016/j.fob.2012.01.002

    Figure Lengend Snippet: RP-HPLC separation of the heated cellular extract. Cellular extract of E. coli BL21 [DE3] (pMA24) were treated as described in Section 2.4 . Chromatogram was monitored at (A) λ = 220 nm and (B) λ = 280 nm. Peaks were collected and individually analyzed by MALDI-TOF MS.

    Article Snippet: 2.3 Gene expression and bacteriocins purification for activity determinations Ent35–MccV was expressed from pMA24 in E. coli BL21 [DE3] (pLysS) grown in LB (Sigma) at 37 °C.

    Techniques: High Performance Liquid Chromatography, Mass Spectrometry

    Recombinant AfIlv3A expression, purification and DHAD activity. A. Expression of recombinant Ilv3A protein. E. coli BL21 DE3 cells were transformed with pET30_Ilv3A, grown until OD600 > 0.5 and then incubated in the presence and absence of 0.5 mM IPTG for 20 h at 20°C. Ilv3A was purified from the bacterial lysate by immobilized metal ion affinity chromatography (IMAC). Protein fractions were separated by polyacrylamide gel electrophoresis on 4–12% Bis-Tris NuPage gels (Invitrogen) followed by staining with GelCode Blue staining reagent (Pierce). The molecular weights in kilo Daltons of marker proteins are indicated. Lane 1, E. coli cell lysate; lane 2, E. coli cell lysate following IPTG induction; lane 3, Ilv3A protein purified by IMAC. B. Dihydroxyacid dehydratase activity of recombinant Ilv3A. 2 µg Ilv3A was assayed in the presence of 0–60 mM L-threonic acid. Initial reaction velocities were calculated and plotted versus substrate concentration.

    Journal: PLoS ONE

    Article Title: The Aspergillus fumigatus Dihydroxyacid Dehydratase Ilv3A/IlvC Is Required for Full Virulence

    doi: 10.1371/journal.pone.0043559

    Figure Lengend Snippet: Recombinant AfIlv3A expression, purification and DHAD activity. A. Expression of recombinant Ilv3A protein. E. coli BL21 DE3 cells were transformed with pET30_Ilv3A, grown until OD600 > 0.5 and then incubated in the presence and absence of 0.5 mM IPTG for 20 h at 20°C. Ilv3A was purified from the bacterial lysate by immobilized metal ion affinity chromatography (IMAC). Protein fractions were separated by polyacrylamide gel electrophoresis on 4–12% Bis-Tris NuPage gels (Invitrogen) followed by staining with GelCode Blue staining reagent (Pierce). The molecular weights in kilo Daltons of marker proteins are indicated. Lane 1, E. coli cell lysate; lane 2, E. coli cell lysate following IPTG induction; lane 3, Ilv3A protein purified by IMAC. B. Dihydroxyacid dehydratase activity of recombinant Ilv3A. 2 µg Ilv3A was assayed in the presence of 0–60 mM L-threonic acid. Initial reaction velocities were calculated and plotted versus substrate concentration.

    Article Snippet: Sequencing confirmed that the resulting vector, pET30_Ilv3A, was correctly constructed. pET30_Ilv3A was transformed into E. coli BL21 DE3 (Novagen) and expression was induced by IPTG as directed in the manufacturers protocol.

    Techniques: Recombinant, Expressing, Purification, Activity Assay, Transformation Assay, Incubation, Affinity Chromatography, Polyacrylamide Gel Electrophoresis, Staining, Marker, Concentration Assay

    Purification of GafD from E. coli BL21 λDE3(pKJ1) periplasm by affinity chromatography and analysis of the reactivities of fimbrial preparations with anti-G-fimbria and anti-GafD antibodies. (A) Binding of 14 C-labeled GafD to GlcNAc-agarose. Lane 1, pulse-labeled periplasmic peptides from rifampin-treated E. coli BL21 λDE3(pKJ1); lane 2, peptides not bound to GlcNAc-agarose; lane 3, peptides bound to GlcNAc-agarose. (B) Coomassie blue-stained SDS-PAGE gel of GafD peptides eluted with 5% (wt/vol) GlcNAc from the GlcNAc-agarose column. The peptides were prepared from periplasm of nonlabeled E. coli BL21 λDE3(pKJ1) (lane 1) and E. coli BL21 λDE3 expressing the truncated GafD1-178 (lane 2). (C) Western blot of fimbrial preparations. Lanes 1 to 3, reactivities of fimbrial peptides with anti-G-fimbria antibodies; lanes 4 to 6, reactivities with anti-GafD antibodies. The fimbrial preparations were the G fimbria isolated from E. coli HB101(pRR-5) (lanes 1 and 4), the mutated G fimbria without lectin activity isolated from E. coli HB101(pHUB110) (lanes 2 and 5), and the type 1 fimbria from E. coli EH826 (lanes 3 and 6). The migration distances of molecular weight markers are indicated on the left; those of the GafD and the GafA peptides are indicated on the right.

    Journal: Journal of Bacteriology

    Article Title: The gaf Fimbrial Gene Cluster of Escherichia coli Expresses a Full-Size and a Truncated Soluble Adhesin Protein

    doi: 10.1128/JB.183.2.512-519.2001

    Figure Lengend Snippet: Purification of GafD from E. coli BL21 λDE3(pKJ1) periplasm by affinity chromatography and analysis of the reactivities of fimbrial preparations with anti-G-fimbria and anti-GafD antibodies. (A) Binding of 14 C-labeled GafD to GlcNAc-agarose. Lane 1, pulse-labeled periplasmic peptides from rifampin-treated E. coli BL21 λDE3(pKJ1); lane 2, peptides not bound to GlcNAc-agarose; lane 3, peptides bound to GlcNAc-agarose. (B) Coomassie blue-stained SDS-PAGE gel of GafD peptides eluted with 5% (wt/vol) GlcNAc from the GlcNAc-agarose column. The peptides were prepared from periplasm of nonlabeled E. coli BL21 λDE3(pKJ1) (lane 1) and E. coli BL21 λDE3 expressing the truncated GafD1-178 (lane 2). (C) Western blot of fimbrial preparations. Lanes 1 to 3, reactivities of fimbrial peptides with anti-G-fimbria antibodies; lanes 4 to 6, reactivities with anti-GafD antibodies. The fimbrial preparations were the G fimbria isolated from E. coli HB101(pRR-5) (lanes 1 and 4), the mutated G fimbria without lectin activity isolated from E. coli HB101(pHUB110) (lanes 2 and 5), and the type 1 fimbria from E. coli EH826 (lanes 3 and 6). The migration distances of molecular weight markers are indicated on the left; those of the GafD and the GafA peptides are indicated on the right.

    Article Snippet: Expression of the gafD constructs in E. coli BL21 λDE3 was performed essentially as described by Studier and coworkers ( ) and the manufacturer's instructions (Novagen Inc.).

    Techniques: Purification, Affinity Chromatography, Binding Assay, Labeling, Staining, SDS Page, Expressing, Western Blot, Isolation, Activity Assay, Migration, Molecular Weight

    Proteomic analysis of T. aestivum pAPX gene . SDS-PAGE analysis representing the Ta pAPX protein expression in E. coli BL21 strain grown at different time periods after IPTG induction (A) . Western blot analysis of Ta pAPX protein using Anti-His antibody showing its deduced band of 32 kDa (B) . His-tag purification using Ni-NTA column. E- purified recombinant fusion Ta pAPX protein from E. coli BL21 (pET28a- TapAPX) , M-Marker (C) . PMF of the over-expressed APX protein using MALDI-TOF/TOF (D) .

    Journal: BMC Research Notes

    Article Title: Molecular cloning and in-silico characterization of high temperature stress responsive pAPX gene isolated from heat tolerant Indian wheat cv. Raj 3765

    doi: 10.1186/1756-0500-7-713

    Figure Lengend Snippet: Proteomic analysis of T. aestivum pAPX gene . SDS-PAGE analysis representing the Ta pAPX protein expression in E. coli BL21 strain grown at different time periods after IPTG induction (A) . Western blot analysis of Ta pAPX protein using Anti-His antibody showing its deduced band of 32 kDa (B) . His-tag purification using Ni-NTA column. E- purified recombinant fusion Ta pAPX protein from E. coli BL21 (pET28a- TapAPX) , M-Marker (C) . PMF of the over-expressed APX protein using MALDI-TOF/TOF (D) .

    Article Snippet: The expression study of TapAPX gene in prokaryotic system was done by transforming the pET-28a-TapAPX recombinant plasmid in E. coli BL21 cells (Novagen, USA) using heat shock method [ ].

    Techniques: SDS Page, Expressing, Western Blot, Purification, Recombinant, Marker, Peptide Mass Fingerprinting

    Heat stress study of recombinant E. coli BL21 (pET28a- TapAPX ) cells. OD reading of E. coli BL21 (pET28) cells and E. coli BL21 (pET28- TapAPX ) cells grown at different temperatures after IPTG induction (A) . SDS-PAGE analysis of total protein (10 μg) of E. coli BL21 (pET28) cells and E. coli BL21 (pET28- T a pAPX ) cells subjected to heat stress, M-Marker (B) . *indicates significant difference as determined by simple pair wise t-test comparison (α = 0.05).

    Journal: BMC Research Notes

    Article Title: Molecular cloning and in-silico characterization of high temperature stress responsive pAPX gene isolated from heat tolerant Indian wheat cv. Raj 3765

    doi: 10.1186/1756-0500-7-713

    Figure Lengend Snippet: Heat stress study of recombinant E. coli BL21 (pET28a- TapAPX ) cells. OD reading of E. coli BL21 (pET28) cells and E. coli BL21 (pET28- TapAPX ) cells grown at different temperatures after IPTG induction (A) . SDS-PAGE analysis of total protein (10 μg) of E. coli BL21 (pET28) cells and E. coli BL21 (pET28- T a pAPX ) cells subjected to heat stress, M-Marker (B) . *indicates significant difference as determined by simple pair wise t-test comparison (α = 0.05).

    Article Snippet: The expression study of TapAPX gene in prokaryotic system was done by transforming the pET-28a-TapAPX recombinant plasmid in E. coli BL21 cells (Novagen, USA) using heat shock method [ ].

    Techniques: Recombinant, SDS Page, Marker

    Cascade-mediated interference activity with extended and shortened crRNAs. Shown is the efficiency of plaquing of Type I-Fv CRISPR-Cas system variants expressed in E. coli . The 32 nt spacer sequence (0) was modulated by removal or addition of the indicated number of nucleotides (−18 to +18) while maintaining complementarity to the lambda phage sequence. These arrays were co-expressed in E. coli BL21-AI with pCas6 (in checkers) or pCas7 (Cas3 HD mutant, white bars), which was then subjected to plaque assays with lambda phage. Bars represent mean ± SEM of three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: Modulating the Cascade architecture of a minimal Type I-F CRISPR-Cas system

    doi: 10.1093/nar/gkw469

    Figure Lengend Snippet: Cascade-mediated interference activity with extended and shortened crRNAs. Shown is the efficiency of plaquing of Type I-Fv CRISPR-Cas system variants expressed in E. coli . The 32 nt spacer sequence (0) was modulated by removal or addition of the indicated number of nucleotides (−18 to +18) while maintaining complementarity to the lambda phage sequence. These arrays were co-expressed in E. coli BL21-AI with pCas6 (in checkers) or pCas7 (Cas3 HD mutant, white bars), which was then subjected to plaque assays with lambda phage. Bars represent mean ± SEM of three independent experiments.

    Article Snippet: Briefly, a 1/100 dilution of an E. coli BL21-AI overnight culture was grown until OD600 nm = 0.3 and induced with 0.2% arabinose (Sigma-Aldrich) and 0.1 mM IPTG for 30 min. Then, cells were pelleted and resuspended in 10 mM MgSO4 .

    Techniques: Activity Assay, CRISPR, Sequencing, Mutagenesis

    The S. putrefaciens Type I-Fv CRISPR-Cas system provides heterologous protection against lambda phage infection in E. coli . ( A ) Plaque formation by lambda phage was observed in E. coli BL21-AI strains carrying two plasmids: a first plasmid encoding a crRNA with a spacer of 32 nt complementarity to the lambda phage genome flanked either by a ‘GG’ or ‘GA’ PAM (targeting crRNA) and a second plasmid encoding all Cas proteins (pCas6) or pCas7 (Cas3 HD mutant). ( B ) Quantification of plaque formation was performed in triplicate (represented as efficiency of plaquing, EOP) of strains carrying the WT or the Cas3 HD mutant plasmid, in addition to a second plasmid producing either the targeting crRNA (in the presence of a target ‘GG’ PAM or a target ‘GA’ PAM) or a crRNA with a 32 nt non-targeting random spacer without complementarity to the phage genome. EOP is defined as the ratio between the plaque count of the strain of interest and the strain carrying empty plasmids. Bars represent mean ± SEM.

    Journal: Nucleic Acids Research

    Article Title: Modulating the Cascade architecture of a minimal Type I-F CRISPR-Cas system

    doi: 10.1093/nar/gkw469

    Figure Lengend Snippet: The S. putrefaciens Type I-Fv CRISPR-Cas system provides heterologous protection against lambda phage infection in E. coli . ( A ) Plaque formation by lambda phage was observed in E. coli BL21-AI strains carrying two plasmids: a first plasmid encoding a crRNA with a spacer of 32 nt complementarity to the lambda phage genome flanked either by a ‘GG’ or ‘GA’ PAM (targeting crRNA) and a second plasmid encoding all Cas proteins (pCas6) or pCas7 (Cas3 HD mutant). ( B ) Quantification of plaque formation was performed in triplicate (represented as efficiency of plaquing, EOP) of strains carrying the WT or the Cas3 HD mutant plasmid, in addition to a second plasmid producing either the targeting crRNA (in the presence of a target ‘GG’ PAM or a target ‘GA’ PAM) or a crRNA with a 32 nt non-targeting random spacer without complementarity to the phage genome. EOP is defined as the ratio between the plaque count of the strain of interest and the strain carrying empty plasmids. Bars represent mean ± SEM.

    Article Snippet: Briefly, a 1/100 dilution of an E. coli BL21-AI overnight culture was grown until OD600 nm = 0.3 and induced with 0.2% arabinose (Sigma-Aldrich) and 0.1 mM IPTG for 30 min. Then, cells were pelleted and resuspended in 10 mM MgSO4 .

    Techniques: CRISPR, Infection, Plasmid Preparation, Mutagenesis

    Overexpression of the recombinant T. pallidum Gpd and analysis of anti-Gpd immunoreactivity. (A) Coomassie blue-stained SDS-PAGE analysis of E. coli BL21 (DE3) pLysS expressing either the Gpd-pET-3a construct (lane 1, crude lysate; lane 2, soluble fraction; lane 3, insoluble fraction) or the pET-3a vector alone (lane 4, insoluble fraction). (B) Immunoblot analysis of anti-Gpd immunoreactivity on purified inclusion bodies from E. coli BL21 (DE3) pLysS expressing the Gpd-pET-3a construct. Lanes: 1, anti-Gpd polyclonal antiserum, 2, E. coli -adsorbed anti-Gpd polyclonal antiserum. Each lane contains approximately 2 μg of total bacterial lysate and soluble or insoluble bacterial fractions, and molecular mass standards in kilodaltons are indicated at the left of each panel. In each panel, the recombinant T. pallidum Gpd is indicated by an arrow.

    Journal: Infection and Immunity

    Article Title: Function and Protective Capacity of Treponema pallidum subsp. pallidum Glycerophosphodiester Phosphodiesterase

    doi:

    Figure Lengend Snippet: Overexpression of the recombinant T. pallidum Gpd and analysis of anti-Gpd immunoreactivity. (A) Coomassie blue-stained SDS-PAGE analysis of E. coli BL21 (DE3) pLysS expressing either the Gpd-pET-3a construct (lane 1, crude lysate; lane 2, soluble fraction; lane 3, insoluble fraction) or the pET-3a vector alone (lane 4, insoluble fraction). (B) Immunoblot analysis of anti-Gpd immunoreactivity on purified inclusion bodies from E. coli BL21 (DE3) pLysS expressing the Gpd-pET-3a construct. Lanes: 1, anti-Gpd polyclonal antiserum, 2, E. coli -adsorbed anti-Gpd polyclonal antiserum. Each lane contains approximately 2 μg of total bacterial lysate and soluble or insoluble bacterial fractions, and molecular mass standards in kilodaltons are indicated at the left of each panel. In each panel, the recombinant T. pallidum Gpd is indicated by an arrow.

    Article Snippet: Anti-Gpd polyclonal antiserum was raised in a New Zealand White rabbit by immunizing three times with 100 μg of each of the inclusion bodies purified from E. coli BL21 (DE3) pLysS transformed with the Gpd-pET-3a construct, emulsified in the Ribi adjuvant MPL + TDM + CWS (monophosphoryl lipid A + trehalose dicorynomycolate + cell wall skeleton) (Sigma).

    Techniques: Over Expression, Recombinant, Staining, SDS Page, Expressing, Positron Emission Tomography, Construct, Plasmid Preparation, Purification

    Immunoblot analyses of the Ig-binding capability of recombinant T. pallidum Gpd. Shown are inclusion bodies purified from E. coli BL21 (DE3) pLysS transformed with either the pET-3a-Gpd construct (lanes 1, 3, 5, and 7) or with the pET-3a vector alone (lanes 2, 4, 6, and 8). Molecular mass standards in kilodaltons are indicated on the left of each panel. (A) Specificity of recombinant T. pallidum Gpd for binding various Ig classes. Lanes: 1 and 2, human IgA and goat F(ab′) 2 anti-human IgA (alpha chain specific); 3 and 4, human IgD and goat F(ab′) 2 anti-human IgD (delta chain specific); 5 and 6, human IgG and goat F(ab′) 2 anti-human IgG (gamma chain specific); 7 and 8, human IgM and goat F(ab′) 2 anti-human IgM (mu chain specific). (B) Investigation of the binding specificity of recombinant T. pallidum Gpd for human IgG. In all cases the secondary antibody used was goat F(ab′) 2 anti-human IgG (gamma chain specific). Lanes: 1 and 2, intact human IgG; 3 and 4, human IgG Fc fragment; 5 and 6, human IgG Fab fragment; 7 and 8, no primary Ig.

    Journal: Infection and Immunity

    Article Title: Function and Protective Capacity of Treponema pallidum subsp. pallidum Glycerophosphodiester Phosphodiesterase

    doi:

    Figure Lengend Snippet: Immunoblot analyses of the Ig-binding capability of recombinant T. pallidum Gpd. Shown are inclusion bodies purified from E. coli BL21 (DE3) pLysS transformed with either the pET-3a-Gpd construct (lanes 1, 3, 5, and 7) or with the pET-3a vector alone (lanes 2, 4, 6, and 8). Molecular mass standards in kilodaltons are indicated on the left of each panel. (A) Specificity of recombinant T. pallidum Gpd for binding various Ig classes. Lanes: 1 and 2, human IgA and goat F(ab′) 2 anti-human IgA (alpha chain specific); 3 and 4, human IgD and goat F(ab′) 2 anti-human IgD (delta chain specific); 5 and 6, human IgG and goat F(ab′) 2 anti-human IgG (gamma chain specific); 7 and 8, human IgM and goat F(ab′) 2 anti-human IgM (mu chain specific). (B) Investigation of the binding specificity of recombinant T. pallidum Gpd for human IgG. In all cases the secondary antibody used was goat F(ab′) 2 anti-human IgG (gamma chain specific). Lanes: 1 and 2, intact human IgG; 3 and 4, human IgG Fc fragment; 5 and 6, human IgG Fab fragment; 7 and 8, no primary Ig.

    Article Snippet: Anti-Gpd polyclonal antiserum was raised in a New Zealand White rabbit by immunizing three times with 100 μg of each of the inclusion bodies purified from E. coli BL21 (DE3) pLysS transformed with the Gpd-pET-3a construct, emulsified in the Ribi adjuvant MPL + TDM + CWS (monophosphoryl lipid A + trehalose dicorynomycolate + cell wall skeleton) (Sigma).

    Techniques: Binding Assay, Recombinant, Purification, Transformation Assay, Positron Emission Tomography, Construct, Plasmid Preparation

    Recombinant AnnexinA2 interacted with ClfA35-559. ( A ) Purification of recombinant AnnexinA2. lane1: purified GST-AnnexinA2 (arrow), lane2–3: cell lysate of bacteria BL21-RIL harbouring the plasmid GST-AnnexinA2, lane4: Protein marker P7702S (BioLabs), kDa unit, lane5: The flow-through after overnight cleavage by TEV, two bands showed AnnexinA2 (36 Kda) and TEV (24 Kda) (arrow), lane6–7: Purified AnnexinA2 (arrow) after removal of the GST tag by TEV. ( B ) Purification of recombinant GST-ClfA35-559 and the complex GST-ClfA35-559/fibrinogen. Lane 1: protein marker P7702S (BioLabs), kDa unit, 2–3: cell lysate of bacteria BL21-RIL harbouring the plasmid GST-ClfA35-559, 4: purified GST-ClfA35-559 (arrow), 5: purified GST-ClfA35-559 mixed with bovine blood plasma, 6: flow-through of 5, 7: the last wash of 5, 8: the complex of GST-ClfA35-559/fibrinogen. Arrows pointing the three weak bands are fibrinogen α (63.5 Kda), β (56 Kda) and γ chain (47 Kda) and the arrow pointing to the strong band is GST-ClfA35-559. ( C ) In vitro binding assay confirmed ClfA35-559 interacted with AnnexinA2. The interaction was not dependent on whether ClfA was free or forming the complex with fibrinogen. Similarly the presence or absence of 0.1 mM Ca2+ did not influence the interaction. Lane 1: protein marker P7702S (BioLabs), kDa unit, 2: the control GST (26 Kda) (arrow) mixed with AnnexinA2 (36 Kda) (arrow), 3–4: GST-ClfA35-559 (arrow) mixed with AnnexinA2, without and with 0.1 mM Ca2+ respectively, 5: the complex GST-ClfA35-559/fibrinogen mixed with AnnexinA2, 6, 7, 8, 9: the flow-through from 2, 3, 4, 5 respectively, 10, 11, 12, 13: the first wash from 2, 3, 4, 5 respectively, 14, 15, 16, 17: the second wash from 2, 3, 4, 5 respectively, 18, 19, 20: the third wash from 2, 3, 5 respectively, 21, 22, 23, 24 (arrows): the elute from 2, 3, 4, 5 respectively. The elute in lane 21 contains GST alone whereas lane 22, 23 and 24 contain GST-ClfA35-559 and AnnexinA2 indicative of an interaction.

    Journal: Scientific Reports

    Article Title: Clumping factor A of Staphylococcus aureus interacts with AnnexinA2 on mammary epithelial cells

    doi: 10.1038/srep40608

    Figure Lengend Snippet: Recombinant AnnexinA2 interacted with ClfA35-559. ( A ) Purification of recombinant AnnexinA2. lane1: purified GST-AnnexinA2 (arrow), lane2–3: cell lysate of bacteria BL21-RIL harbouring the plasmid GST-AnnexinA2, lane4: Protein marker P7702S (BioLabs), kDa unit, lane5: The flow-through after overnight cleavage by TEV, two bands showed AnnexinA2 (36 Kda) and TEV (24 Kda) (arrow), lane6–7: Purified AnnexinA2 (arrow) after removal of the GST tag by TEV. ( B ) Purification of recombinant GST-ClfA35-559 and the complex GST-ClfA35-559/fibrinogen. Lane 1: protein marker P7702S (BioLabs), kDa unit, 2–3: cell lysate of bacteria BL21-RIL harbouring the plasmid GST-ClfA35-559, 4: purified GST-ClfA35-559 (arrow), 5: purified GST-ClfA35-559 mixed with bovine blood plasma, 6: flow-through of 5, 7: the last wash of 5, 8: the complex of GST-ClfA35-559/fibrinogen. Arrows pointing the three weak bands are fibrinogen α (63.5 Kda), β (56 Kda) and γ chain (47 Kda) and the arrow pointing to the strong band is GST-ClfA35-559. ( C ) In vitro binding assay confirmed ClfA35-559 interacted with AnnexinA2. The interaction was not dependent on whether ClfA was free or forming the complex with fibrinogen. Similarly the presence or absence of 0.1 mM Ca2+ did not influence the interaction. Lane 1: protein marker P7702S (BioLabs), kDa unit, 2: the control GST (26 Kda) (arrow) mixed with AnnexinA2 (36 Kda) (arrow), 3–4: GST-ClfA35-559 (arrow) mixed with AnnexinA2, without and with 0.1 mM Ca2+ respectively, 5: the complex GST-ClfA35-559/fibrinogen mixed with AnnexinA2, 6, 7, 8, 9: the flow-through from 2, 3, 4, 5 respectively, 10, 11, 12, 13: the first wash from 2, 3, 4, 5 respectively, 14, 15, 16, 17: the second wash from 2, 3, 4, 5 respectively, 18, 19, 20: the third wash from 2, 3, 5 respectively, 21, 22, 23, 24 (arrows): the elute from 2, 3, 4, 5 respectively. The elute in lane 21 contains GST alone whereas lane 22, 23 and 24 contain GST-ClfA35-559 and AnnexinA2 indicative of an interaction.

    Article Snippet: Protein expression and purification The constructs were transformed into E. coli BL21(DE3)-RIL (Novagen).

    Techniques: Recombinant, Purification, Plasmid Preparation, Marker, Flow Cytometry, In Vitro, Binding Assay

    Expression and purification of rDer p 2/Der p 1 mosaic proteins. Coomassie-stained SDS-PAGE–containing protein extracts of BL21 (DE3) expressing Der p 2/1C and Der p 2/1S (lanes 1) , purified Der p 2/1C and Der p 2/1S ( lanes 2 ; A ), and purified

    Journal: The Journal of allergy and clinical immunology

    Article Title: Hypoallergenic Der p 1/Der p 2 combination vaccines for immunotherapy of house dust mite allergy

    doi: 10.1016/j.jaci.2012.05.035

    Figure Lengend Snippet: Expression and purification of rDer p 2/Der p 1 mosaic proteins. Coomassie-stained SDS-PAGE–containing protein extracts of BL21 (DE3) expressing Der p 2/1C and Der p 2/1S (lanes 1) , purified Der p 2/1C and Der p 2/1S ( lanes 2 ; A ), and purified

    Article Snippet: Expression plasmids containing the Der p 2/1 constructs were transformed into E coli strain BL21 (DE3; Novagen, Merck).

    Techniques: Expressing, Purification, Staining, SDS Page

    Recombinant enolase1 from C. albicans has TGase activity. The C. albicans ENO1 gene was cloned in the pCold II plasmid and transformed into E. coli BL21 (DE3) pLysS-competent cells; protein production was induced at 23 °C for 24 h. A , Eno1 protein was purified by IMAC with a Ni 2+ -NTA–agarose column in native conditions as described, and elution fractions were evaluated by 12% SDS-PAGE; MWM , protein molecular weight markers. Empty vector was also transformed in bacteria and passed through the same IMAC column, and the fractions obtained were also analyzed as a negative control (data not shown). B , Western blot of purified recombinant protein using anti-His–tag polyclonal antibodies ( lane 2 ) and rabbit anti-rCaEno1 protein ( lane 3 ). C , Western blot of C. albicans cell fractions using anti-rCaEno1 polyclonal antibodies. WPE , whole-protein extracts; CW , cell wall fraction; MMF , mixed membrane fraction; S-35K , soluble cytosolic fraction. Arrows indicate Eno1 protein. D , enolase activity was determined with purified rCaEno1 protein. E , TGase activity determined with purified rCaEno1 protein. These results allowed us to conclude that rCaEno1 protein has both enolase and transglutaminase activities. Statistical unpaired t test. *, p

    Journal: The Journal of Biological Chemistry

    Article Title: The Candida albicans ENO1 gene encodes a transglutaminase involved in growth, cell division, morphogenesis, and osmotic protection

    doi: 10.1074/jbc.M117.810440

    Figure Lengend Snippet: Recombinant enolase1 from C. albicans has TGase activity. The C. albicans ENO1 gene was cloned in the pCold II plasmid and transformed into E. coli BL21 (DE3) pLysS-competent cells; protein production was induced at 23 °C for 24 h. A , Eno1 protein was purified by IMAC with a Ni 2+ -NTA–agarose column in native conditions as described, and elution fractions were evaluated by 12% SDS-PAGE; MWM , protein molecular weight markers. Empty vector was also transformed in bacteria and passed through the same IMAC column, and the fractions obtained were also analyzed as a negative control (data not shown). B , Western blot of purified recombinant protein using anti-His–tag polyclonal antibodies ( lane 2 ) and rabbit anti-rCaEno1 protein ( lane 3 ). C , Western blot of C. albicans cell fractions using anti-rCaEno1 polyclonal antibodies. WPE , whole-protein extracts; CW , cell wall fraction; MMF , mixed membrane fraction; S-35K , soluble cytosolic fraction. Arrows indicate Eno1 protein. D , enolase activity was determined with purified rCaEno1 protein. E , TGase activity determined with purified rCaEno1 protein. These results allowed us to conclude that rCaEno1 protein has both enolase and transglutaminase activities. Statistical unpaired t test. *, p

    Article Snippet: It was then subcloned into the pColdII (Takara) plasmid in the mentioned restriction sites to generate the pColdII/CaEno1 plasmid, which was transformed into E. coli BL21 (DE3)pLysS (Invitrogen) competent cells.

    Techniques: Recombinant, Activity Assay, Clone Assay, Plasmid Preparation, Transformation Assay, Purification, SDS Page, Molecular Weight, Negative Control, Western Blot

    Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in BL21 bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.

    Journal: Oncotarget

    Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells

    doi: 10.18632/oncotarget.9179

    Figure Lengend Snippet: Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in BL21 bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.

    Article Snippet: To clone wild-type FHIT and the truncated forms, the following primers containing a BamHI restriction site were used: FHIT forward: 5′- GGATCCTCGTTCAGATTTGGCCAA-3′ FHIT rev TR1: 5′- GGATCCGTCATTCCTGTGAAAGTCTCCAGCCTT - 3′ FHIT rev TR2: 5′-GGATCC-CCCATGGAAATGTTTTTCCACCACTGT-3′ FHIT rev TR3: 5′-GGATCC-CACAAGGACATGTCCTGGTACCACAGGTT-3′ PGEX-2T plasmid, E. coli BL21, and Glutathione Sepharose 4B resin were from Amersham.

    Techniques: Mutagenesis, Amplification, Recombinant, Purification, Incubation, Immunoprecipitation

    SDS-PAGE analysis of purified protein recombinant SllB in E. coli BL21 cells. Lane M: Takara Protein Marker; lane 1, SDS-PAGE analysis of the recombinant S-layer protein before purification; lane 2, SDS-PAGE analysis of the purified recombinant protein.

    Journal: International Journal of Molecular Medicine

    Article Title: Cloning of the surface layer gene sllB from Bacillus sphaericus ATCC 14577 and its heterologous expression and purification

    doi: 10.3892/ijmm.2012.890

    Figure Lengend Snippet: SDS-PAGE analysis of purified protein recombinant SllB in E. coli BL21 cells. Lane M: Takara Protein Marker; lane 1, SDS-PAGE analysis of the recombinant S-layer protein before purification; lane 2, SDS-PAGE analysis of the purified recombinant protein.

    Article Snippet: 2.0 (Takara, no. DV801A), from which 0.5 μl was used to transform 100 μl of E. coli BL21 (DE3, Stratagene).

    Techniques: SDS Page, Purification, Recombinant, Marker

    A transmission electron microscopic observation on the E. coli BL21 with recombinant protein. (A) Normal E. coli BL21 was treated as control. (B) The E. coli BL21 cells recombinant S-layer protein. (C) Crystal lattice structures on surface of the E. coli BL21 cells recombinant S-layer protein.

    Journal: International Journal of Molecular Medicine

    Article Title: Cloning of the surface layer gene sllB from Bacillus sphaericus ATCC 14577 and its heterologous expression and purification

    doi: 10.3892/ijmm.2012.890

    Figure Lengend Snippet: A transmission electron microscopic observation on the E. coli BL21 with recombinant protein. (A) Normal E. coli BL21 was treated as control. (B) The E. coli BL21 cells recombinant S-layer protein. (C) Crystal lattice structures on surface of the E. coli BL21 cells recombinant S-layer protein.

    Article Snippet: 2.0 (Takara, no. DV801A), from which 0.5 μl was used to transform 100 μl of E. coli BL21 (DE3, Stratagene).

    Techniques: Transmission Assay, Recombinant

    Expression of sllB in E. coli BL21 cells. (A) SDS-PAGE analysis of rSllB protein; lane 1, the whole cell lysate of E. coli BL21 cells containing pET28a(+); lane 2, the supernatant of cells containing pET28a(+); lane 3, the pellet of cells containing pET28a(+); lane 4, the whole cell lysate of E. coli BL21 cells containing pET28a(+)- sllB ; lane 5, the supernatant of cell containing pET28a(+)- sllB ; lane 6, the pellet of cells containing pET28a(+)- sllB ; lane M represent Takara Protein Marker (Broad). (B) Western blot analysis of rSllB protein; lane 1, the whole cell lysate of E. coli BL21 cells containing pET28a(+); lane 2, the supernatant of cells containing pET28a(+); lane 3, the pellet of cells containing pET28a(+); lane 4, the whole cell lysate of E. coli BL21 cells containing pET28a(+)- sllB ; lane 5, the supernatant of cell containing pET28a(+)- sllB ; lane 6, the pellet of cells containing pET28a(+)- sllB ; M, Takara Protein Marker (Broad). Lane M1, Precision plus protein standards; lane M2, perfect protein marker. Note the band pointed with arrows is the recombinant S-layer protein.

    Journal: International Journal of Molecular Medicine

    Article Title: Cloning of the surface layer gene sllB from Bacillus sphaericus ATCC 14577 and its heterologous expression and purification

    doi: 10.3892/ijmm.2012.890

    Figure Lengend Snippet: Expression of sllB in E. coli BL21 cells. (A) SDS-PAGE analysis of rSllB protein; lane 1, the whole cell lysate of E. coli BL21 cells containing pET28a(+); lane 2, the supernatant of cells containing pET28a(+); lane 3, the pellet of cells containing pET28a(+); lane 4, the whole cell lysate of E. coli BL21 cells containing pET28a(+)- sllB ; lane 5, the supernatant of cell containing pET28a(+)- sllB ; lane 6, the pellet of cells containing pET28a(+)- sllB ; lane M represent Takara Protein Marker (Broad). (B) Western blot analysis of rSllB protein; lane 1, the whole cell lysate of E. coli BL21 cells containing pET28a(+); lane 2, the supernatant of cells containing pET28a(+); lane 3, the pellet of cells containing pET28a(+); lane 4, the whole cell lysate of E. coli BL21 cells containing pET28a(+)- sllB ; lane 5, the supernatant of cell containing pET28a(+)- sllB ; lane 6, the pellet of cells containing pET28a(+)- sllB ; M, Takara Protein Marker (Broad). Lane M1, Precision plus protein standards; lane M2, perfect protein marker. Note the band pointed with arrows is the recombinant S-layer protein.

    Article Snippet: 2.0 (Takara, no. DV801A), from which 0.5 μl was used to transform 100 μl of E. coli BL21 (DE3, Stratagene).

    Techniques: Expressing, SDS Page, Marker, Western Blot, Recombinant

    SDS-PAGE analysis of the purified xylanases obtained from E.coli BL21. Lane 1: 100 mM imidazole wash of the recombined protein XYNB to Ni-nitrilotriacetic acid resin; Lane2: 100 mM imidazole wash of the recombined protein XYNA1 to Ni-nitrilotriacetic acid resin; M: Standard protein molecular weight. The protein gels were stained with Coomasie Brilliant Blue R250. →:interest proteins

    Journal: Brazilian Journal of Microbiology

    Article Title: Hyperexpression of two Aspergillus Niger Xylanase Genes in Escherichia Coli and Characterization of the Gene Products

    doi: 10.1590/S1517-83822010000300030

    Figure Lengend Snippet: SDS-PAGE analysis of the purified xylanases obtained from E.coli BL21. Lane 1: 100 mM imidazole wash of the recombined protein XYNB to Ni-nitrilotriacetic acid resin; Lane2: 100 mM imidazole wash of the recombined protein XYNA1 to Ni-nitrilotriacetic acid resin; M: Standard protein molecular weight. The protein gels were stained with Coomasie Brilliant Blue R250. →:interest proteins

    Article Snippet: E. coli BL21 was used to express recombinant protein using the expression vector pET32a (Novagen/Merck, America).

    Techniques: SDS Page, Purification, Molecular Weight, Staining

    SDS-PAGE analysis of the recombinant xylanases produced by E.coli BL21 .lanes 1 and 2: recombined proteins: XYNA1 and XYNB, respectively; Lane3: pET32a host; M: Standard protein molecular weight. The protein gels were stained with Coomasie Brilliant Blue R250; →: interest proteins

    Journal: Brazilian Journal of Microbiology

    Article Title: Hyperexpression of two Aspergillus Niger Xylanase Genes in Escherichia Coli and Characterization of the Gene Products

    doi: 10.1590/S1517-83822010000300030

    Figure Lengend Snippet: SDS-PAGE analysis of the recombinant xylanases produced by E.coli BL21 .lanes 1 and 2: recombined proteins: XYNA1 and XYNB, respectively; Lane3: pET32a host; M: Standard protein molecular weight. The protein gels were stained with Coomasie Brilliant Blue R250; →: interest proteins

    Article Snippet: E. coli BL21 was used to express recombinant protein using the expression vector pET32a (Novagen/Merck, America).

    Techniques: SDS Page, Recombinant, Produced, Molecular Weight, Staining

    SDS-PAGE (a) and western blot (b) analyses of the recombinant BirA protein expressed via pET24-BirA vector in BL21 E. coli cells by addition of IPTG to the final concentration of 1 mM. (a) Lane 1: Protein molecular weight marker (Unstained protein molecular weight marker, Fermentas, Lithuania). Different induced colonies (lane 3–7) showed the same size of BirA (36.6 kDa) expression compared with un-induced sample (lane 2) (b) Western blot analysis of recombinant BirA protein by anti-His antibody specific for C-terminal polyhistidine tag indicated the specific 36.6 kDa protein band. Lane 1: Protein marker (PrestainedProtein Ladder, CinnaGen, Iran) Lane 2: Un-induced bacterial lysate. Lane 3: Recombinant BirA protein (36.6 kDa). Arrows indicate the target protein bands

    Journal: Advanced Biomedical Research

    Article Title: Isolation, cloning, and expression of E. coli BirA gene for biotinylation applications

    doi: 10.4103/2277-9175.161576

    Figure Lengend Snippet: SDS-PAGE (a) and western blot (b) analyses of the recombinant BirA protein expressed via pET24-BirA vector in BL21 E. coli cells by addition of IPTG to the final concentration of 1 mM. (a) Lane 1: Protein molecular weight marker (Unstained protein molecular weight marker, Fermentas, Lithuania). Different induced colonies (lane 3–7) showed the same size of BirA (36.6 kDa) expression compared with un-induced sample (lane 2) (b) Western blot analysis of recombinant BirA protein by anti-His antibody specific for C-terminal polyhistidine tag indicated the specific 36.6 kDa protein band. Lane 1: Protein marker (PrestainedProtein Ladder, CinnaGen, Iran) Lane 2: Un-induced bacterial lysate. Lane 3: Recombinant BirA protein (36.6 kDa). Arrows indicate the target protein bands

    Article Snippet: E. coli BL21 (DE3) and pET-24a(+) plasmid (Merck KGaA, Darmstadt, Germany) were used as expression host and vector, respectively.

    Techniques: SDS Page, Western Blot, Recombinant, Plasmid Preparation, Concentration Assay, Molecular Weight, Marker, Expressing

    Expression of rDer f 5 in Escherichia coli BL21 cells. E. coli BL21 cells were transformed with either pET28a(+)-Der f 5 or empty vector pET28a(+) as control. A , SDS-PAGE analysis of the rDer f 5 protein. Lane M 1 = TaKaRa protein marker (Broad); lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = supernatant of cells containing pET28a; lane 3 = pellet of cells containing pET28a; lane 4 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5; lane 5 = supernatant of cells containing pET28a(+)-Der f 5; lane 6 = pellet of cells containing pET28a(+)-Der f 5. B , Western blotting analysis of the rDer f 5 protein. Lane M 2 = Precision Plus Protein Standards; lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5. Arrows point to the band of rDer f 5.

    Journal: Brazilian Journal of Medical and Biological Research

    Article Title: Cloning, bioinformatics analysis, and expression of the dust mite allergen Der f 5 of Dermatophagoides farinae

    doi: 10.1590/S0100-879X2012007500077

    Figure Lengend Snippet: Expression of rDer f 5 in Escherichia coli BL21 cells. E. coli BL21 cells were transformed with either pET28a(+)-Der f 5 or empty vector pET28a(+) as control. A , SDS-PAGE analysis of the rDer f 5 protein. Lane M 1 = TaKaRa protein marker (Broad); lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = supernatant of cells containing pET28a; lane 3 = pellet of cells containing pET28a; lane 4 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5; lane 5 = supernatant of cells containing pET28a(+)-Der f 5; lane 6 = pellet of cells containing pET28a(+)-Der f 5. B , Western blotting analysis of the rDer f 5 protein. Lane M 2 = Precision Plus Protein Standards; lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5. Arrows point to the band of rDer f 5.

    Article Snippet: Expression of recombinant Der f 5 (rDer f 5) in E. coli BL21 (DE3) A 0.5-µL amount of the pET28a-(+)-Der f 5 plasmid was prepared using the MiniBEST Plasmid Purification Kit 2.0 (DV801A; TaKaRa Biotech) and used to transform 100 µL E. coli BL21 (DE3, Stratagene, USA).

    Techniques: Expressing, Transformation Assay, Plasmid Preparation, SDS Page, Marker, Western Blot

    Cloning, expression, and large-scale cultivation of dimeric thymosin beta 4 (DTβ4) engineered bacteria. ( A ) Two entire complementary DNA sequences of thymosin beta 4 (Tβ4) were constructed into a prokaryotic expression plasmid with a small DNA linker (GGTTCT). The results show a 267 bp fragment with correct sequence as expected (arrow). ( B ) Five colonies obtained after the transformation of Escherichia coli were randomly picked to test the protein expression on a small scale with sodium dodecyl sulfate polyacrylamide gel electrophoresis. After isopropyl β-D-1-thiogalactopyranoside (IPTG) induction, a new protein (arrow) appeared in each culture pellet and accounted for over 15% of all the bacteria proteins (1: molecular ladder; 2–6: protein expression of picked five clones; 7: protein expression without IPTG induction). ( C ) Bacterial growth curve of BL21/DTβ4 in a 10 L fermenter (the arrow indicates the induction time). ( D ) DTβ4 expression (arrow) during fermentation (1: DTβ4 expression without IPTG induction; 2–6: DTβ4 expression every hour after IPTG induction). Abbreviation: DNA, deoxyribonucleic acid.

    Journal: Drug Design, Development and Therapy

    Article Title: A novel dimeric thymosin beta 4 with enhanced activities accelerates the rate of wound healing

    doi: 10.2147/DDDT.S50183

    Figure Lengend Snippet: Cloning, expression, and large-scale cultivation of dimeric thymosin beta 4 (DTβ4) engineered bacteria. ( A ) Two entire complementary DNA sequences of thymosin beta 4 (Tβ4) were constructed into a prokaryotic expression plasmid with a small DNA linker (GGTTCT). The results show a 267 bp fragment with correct sequence as expected (arrow). ( B ) Five colonies obtained after the transformation of Escherichia coli were randomly picked to test the protein expression on a small scale with sodium dodecyl sulfate polyacrylamide gel electrophoresis. After isopropyl β-D-1-thiogalactopyranoside (IPTG) induction, a new protein (arrow) appeared in each culture pellet and accounted for over 15% of all the bacteria proteins (1: molecular ladder; 2–6: protein expression of picked five clones; 7: protein expression without IPTG induction). ( C ) Bacterial growth curve of BL21/DTβ4 in a 10 L fermenter (the arrow indicates the induction time). ( D ) DTβ4 expression (arrow) during fermentation (1: DTβ4 expression without IPTG induction; 2–6: DTβ4 expression every hour after IPTG induction). Abbreviation: DNA, deoxyribonucleic acid.

    Article Snippet: Expression of DTβ4 and large-scale cultivation of engineered bacteria The pET22b-DTβ4 plasmid was transformed into E. coli BL21 (DE3; Promega) using the calcium chloride method.

    Techniques: Clone Assay, Expressing, Construct, Plasmid Preparation, Sequencing, Transformation Assay, Polyacrylamide Gel Electrophoresis

    Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli BL21/pETSip2 (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P

    Journal: Frontiers in Microbiology

    Article Title: Edwardsiella tarda Sip2: A Serum-Induced Protein That Is Essential to Serum Survival, Acid Resistance, Intracellular Replication, and Host Infection

    doi: 10.3389/fmicb.2018.01084

    Figure Lengend Snippet: Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli BL21/pETSip2 (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P

    Article Snippet: E. coli BL21 (DE3) and DH5α were purchased from TransGen Biotech (Beijing, China); E. coli S17-1λpir was purchased from Biomedal (Sevilla, Spain).

    Techniques: Expressing