e. coli bl21 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore e coli bl 21
    Comparison of expression levels of TNFR ED, EPO and SK in different hosts at 37 °C on induction with 1 mM IPTG for E. coli <t>BL21</t> (DE3) and BL21 (DE3) pLys S strains and 0.3 M NaCl for E. coli GJ1158 strains at (A) 0.6 OD 600 , (B) 1.0 OD. Basal level expression was given a minimal value of 0.5%.
    E Coli Bl 21, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 758 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl 21/product/Millipore
    Average 99 stars, based on 758 article reviews
    Price from $9.99 to $1999.99
    e coli bl 21 - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    85
    Thermo Fisher escherichia coli e coli bl21
    Production and purification of recombinant Zika virus envelope protein domain III (rZE3) and recombinant lipidated Zika virus envelope protein domain III (rLZE3). The plasmid maps of pZE3 ( a ) and pLZE3 ( d ) for the production of rZE3 and rLZE3, respectively. The purification of rZE3 ( b , c ) and rLZE3 ( e , f ) was monitored by 10% reducing Tricine-SDS-PAGE followed by Coomassie Blue staining and immunoblotting with anti-His-tag antibodies. rZE3 and rLZE3 were expressed in the E. coli strains <t>BL21</t> (DE3) and C43 (DE3), respectively. Lanes 1, 5, 9, and 13: protein expression without IPTG induction; lanes 2, 6, 10, and 14: protein expression after IPTG induction; lanes 3 and 7: extraction of rZE3 from inclusion bodies; lanes 11 and 15: soluble fraction of rLZE3; and lanes 4, 8, 12, and 16: purified proteins. Lanes 5–8 and lanes 13–16 show the induction and purification processes for rZE3 and rLZE3, respectively, evaluated by immunoblotting. The arrows show the electrophoretic positions of rZE3 or rLZE3. g Mass spectrum analysis of rLZE3. The N-terminus of the rLZE3 fragments was obtained by trypsin digestion and further examined with a WatersR MALDI micro MX™ mass spectrometer. MALDI-TOF MS spectra revealed lipid peptide signals with three m/z value peaks of 1452.129, 1466.144, and 1480.160
    Escherichia Coli E Coli Bl21, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli e coli bl21/product/Thermo Fisher
    Average 85 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    escherichia coli e coli bl21 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    93
    Stratagene e coli bl21
    SDS-PAGE analysis of purified protein recombinant SllB in E. coli <t>BL21</t> cells. Lane M: Takara Protein Marker; lane 1, SDS-PAGE analysis of the recombinant S-layer protein before purification; lane 2, SDS-PAGE analysis of the purified recombinant protein.
    E Coli Bl21, supplied by Stratagene, used in various techniques. Bioz Stars score: 93/100, based on 3182 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/Stratagene
    Average 93 stars, based on 3182 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    93
    GE Healthcare e coli bl21
    Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in <t>BL21</t> bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.
    E Coli Bl21, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 2146 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/GE Healthcare
    Average 93 stars, based on 2146 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    93
    Merck KGaA e coli bl21
    SDS-PAGE (a) and western blot (b) analyses of the recombinant BirA protein expressed via pET24-BirA vector in <t>BL21</t> E. coli cells by addition of IPTG to the final concentration of 1 mM. (a) Lane 1: Protein molecular weight marker (Unstained protein molecular weight marker, Fermentas, Lithuania). Different induced colonies (lane 3–7) showed the same size of BirA (36.6 kDa) expression compared with un-induced sample (lane 2) (b) Western blot analysis of recombinant BirA protein by anti-His antibody specific for C-terminal polyhistidine tag indicated the specific 36.6 kDa protein band. Lane 1: Protein marker (PrestainedProtein Ladder, CinnaGen, Iran) Lane 2: Un-induced bacterial lysate. Lane 3: Recombinant BirA protein (36.6 kDa). Arrows indicate the target protein bands
    E Coli Bl21, supplied by Merck KGaA, used in various techniques. Bioz Stars score: 93/100, based on 305 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/Merck KGaA
    Average 93 stars, based on 305 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    93
    Agilent technologies e coli bl21
    SDS-PAGE (a) and western blot (b) analyses of the recombinant BirA protein expressed via pET24-BirA vector in <t>BL21</t> E. coli cells by addition of IPTG to the final concentration of 1 mM. (a) Lane 1: Protein molecular weight marker (Unstained protein molecular weight marker, Fermentas, Lithuania). Different induced colonies (lane 3–7) showed the same size of BirA (36.6 kDa) expression compared with un-induced sample (lane 2) (b) Western blot analysis of recombinant BirA protein by anti-His antibody specific for C-terminal polyhistidine tag indicated the specific 36.6 kDa protein band. Lane 1: Protein marker (PrestainedProtein Ladder, CinnaGen, Iran) Lane 2: Un-induced bacterial lysate. Lane 3: Recombinant BirA protein (36.6 kDa). Arrows indicate the target protein bands
    E Coli Bl21, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 93/100, based on 620 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/Agilent technologies
    Average 93 stars, based on 620 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    92
    Merck & Co e coli bl21
    SDS-PAGE analysis of the purified xylanases obtained from E.coli <t>BL21.</t> Lane 1: 100 mM imidazole wash of the recombined protein XYNB to Ni-nitrilotriacetic acid resin; Lane2: 100 mM imidazole wash of the recombined protein XYNA1 to Ni-nitrilotriacetic acid resin; M: Standard protein molecular weight. The protein gels were stained with Coomasie Brilliant Blue R250. →:interest proteins
    E Coli Bl21, supplied by Merck & Co, used in various techniques. Bioz Stars score: 92/100, based on 136 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/Merck & Co
    Average 92 stars, based on 136 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    93
    TaKaRa e coli bl21
    Expression of rDer f 5 in Escherichia coli <t>BL21</t> cells. E. coli BL21 cells were transformed with either pET28a(+)-Der f 5 or empty vector pET28a(+) as control. A , SDS-PAGE analysis of the rDer f 5 protein. Lane M 1 = TaKaRa protein marker (Broad); lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = supernatant of cells containing pET28a; lane 3 = pellet of cells containing pET28a; lane 4 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5; lane 5 = supernatant of cells containing pET28a(+)-Der f 5; lane 6 = pellet of cells containing pET28a(+)-Der f 5. B , Western blotting analysis of the rDer f 5 protein. Lane M 2 = Precision Plus Protein Standards; lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5. Arrows point to the band of rDer f 5.
    E Coli Bl21, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 753 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/TaKaRa
    Average 93 stars, based on 753 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    90
    Beijing ComWin Biotech Co e coli bl21
    Expression of rDer f 5 in Escherichia coli <t>BL21</t> cells. E. coli BL21 cells were transformed with either pET28a(+)-Der f 5 or empty vector pET28a(+) as control. A , SDS-PAGE analysis of the rDer f 5 protein. Lane M 1 = TaKaRa protein marker (Broad); lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = supernatant of cells containing pET28a; lane 3 = pellet of cells containing pET28a; lane 4 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5; lane 5 = supernatant of cells containing pET28a(+)-Der f 5; lane 6 = pellet of cells containing pET28a(+)-Der f 5. B , Western blotting analysis of the rDer f 5 protein. Lane M 2 = Precision Plus Protein Standards; lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5. Arrows point to the band of rDer f 5.
    E Coli Bl21, supplied by Beijing ComWin Biotech Co, used in various techniques. Bioz Stars score: 90/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/Beijing ComWin Biotech Co
    Average 90 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    90
    TransGen biotech co e coli bl21
    Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli <t>BL21/pETSip2</t> (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P
    E Coli Bl21, supplied by TransGen biotech co, used in various techniques. Bioz Stars score: 90/100, based on 99 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/TransGen biotech co
    Average 90 stars, based on 99 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    93
    AMS Biotechnology e coli bl21
    Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli <t>BL21/pETSip2</t> (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P
    E Coli Bl21, supplied by AMS Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/AMS Biotechnology
    Average 93 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    92
    tiangen biotech co e coli bl21
    Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli <t>BL21/pETSip2</t> (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P
    E Coli Bl21, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 92/100, based on 206 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/tiangen biotech co
    Average 92 stars, based on 206 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    93
    Promega e coli bl21
    Cloning, expression, and large-scale cultivation of dimeric thymosin beta 4 (DTβ4) engineered bacteria. ( A ) Two entire complementary DNA sequences of thymosin beta 4 (Tβ4) were constructed into a prokaryotic expression plasmid with a small DNA linker (GGTTCT). The results show a 267 bp fragment with correct sequence as expected (arrow). ( B ) Five colonies obtained after the transformation of Escherichia coli were randomly picked to test the protein expression on a small scale with sodium dodecyl sulfate polyacrylamide gel electrophoresis. After isopropyl β-D-1-thiogalactopyranoside (IPTG) induction, a new protein (arrow) appeared in each culture pellet and accounted for over 15% of all the bacteria proteins (1: molecular ladder; 2–6: protein expression of picked five clones; 7: protein expression without IPTG induction). ( C ) Bacterial growth curve of <t>BL21/DTβ4</t> in a 10 L fermenter (the arrow indicates the induction time). ( D ) DTβ4 expression (arrow) during fermentation (1: DTβ4 expression without IPTG induction; 2–6: DTβ4 expression every hour after IPTG induction). Abbreviation: DNA, deoxyribonucleic acid.
    E Coli Bl21, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 747 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/Promega
    Average 93 stars, based on 747 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    91
    Beyotime e coli bl21
    Cloning, expression, and large-scale cultivation of dimeric thymosin beta 4 (DTβ4) engineered bacteria. ( A ) Two entire complementary DNA sequences of thymosin beta 4 (Tβ4) were constructed into a prokaryotic expression plasmid with a small DNA linker (GGTTCT). The results show a 267 bp fragment with correct sequence as expected (arrow). ( B ) Five colonies obtained after the transformation of Escherichia coli were randomly picked to test the protein expression on a small scale with sodium dodecyl sulfate polyacrylamide gel electrophoresis. After isopropyl β-D-1-thiogalactopyranoside (IPTG) induction, a new protein (arrow) appeared in each culture pellet and accounted for over 15% of all the bacteria proteins (1: molecular ladder; 2–6: protein expression of picked five clones; 7: protein expression without IPTG induction). ( C ) Bacterial growth curve of <t>BL21/DTβ4</t> in a 10 L fermenter (the arrow indicates the induction time). ( D ) DTβ4 expression (arrow) during fermentation (1: DTβ4 expression without IPTG induction; 2–6: DTβ4 expression every hour after IPTG induction). Abbreviation: DNA, deoxyribonucleic acid.
    E Coli Bl21, supplied by Beyotime, used in various techniques. Bioz Stars score: 91/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/Beyotime
    Average 91 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    92
    Meridian Life Science e coli bl21
    Cloning, expression, and large-scale cultivation of dimeric thymosin beta 4 (DTβ4) engineered bacteria. ( A ) Two entire complementary DNA sequences of thymosin beta 4 (Tβ4) were constructed into a prokaryotic expression plasmid with a small DNA linker (GGTTCT). The results show a 267 bp fragment with correct sequence as expected (arrow). ( B ) Five colonies obtained after the transformation of Escherichia coli were randomly picked to test the protein expression on a small scale with sodium dodecyl sulfate polyacrylamide gel electrophoresis. After isopropyl β-D-1-thiogalactopyranoside (IPTG) induction, a new protein (arrow) appeared in each culture pellet and accounted for over 15% of all the bacteria proteins (1: molecular ladder; 2–6: protein expression of picked five clones; 7: protein expression without IPTG induction). ( C ) Bacterial growth curve of <t>BL21/DTβ4</t> in a 10 L fermenter (the arrow indicates the induction time). ( D ) DTβ4 expression (arrow) during fermentation (1: DTβ4 expression without IPTG induction; 2–6: DTβ4 expression every hour after IPTG induction). Abbreviation: DNA, deoxyribonucleic acid.
    E Coli Bl21, supplied by Meridian Life Science, used in various techniques. Bioz Stars score: 92/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21/product/Meridian Life Science
    Average 92 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    99
    Millipore e coli bl21 gold
    Cloning, expression, and large-scale cultivation of dimeric thymosin beta 4 (DTβ4) engineered bacteria. ( A ) Two entire complementary DNA sequences of thymosin beta 4 (Tβ4) were constructed into a prokaryotic expression plasmid with a small DNA linker (GGTTCT). The results show a 267 bp fragment with correct sequence as expected (arrow). ( B ) Five colonies obtained after the transformation of Escherichia coli were randomly picked to test the protein expression on a small scale with sodium dodecyl sulfate polyacrylamide gel electrophoresis. After isopropyl β-D-1-thiogalactopyranoside (IPTG) induction, a new protein (arrow) appeared in each culture pellet and accounted for over 15% of all the bacteria proteins (1: molecular ladder; 2–6: protein expression of picked five clones; 7: protein expression without IPTG induction). ( C ) Bacterial growth curve of <t>BL21/DTβ4</t> in a 10 L fermenter (the arrow indicates the induction time). ( D ) DTβ4 expression (arrow) during fermentation (1: DTβ4 expression without IPTG induction; 2–6: DTβ4 expression every hour after IPTG induction). Abbreviation: DNA, deoxyribonucleic acid.
    E Coli Bl21 Gold, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 64 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21 gold/product/Millipore
    Average 99 stars, based on 64 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 gold - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    Comparison of expression levels of TNFR ED, EPO and SK in different hosts at 37 °C on induction with 1 mM IPTG for E. coli BL21 (DE3) and BL21 (DE3) pLys S strains and 0.3 M NaCl for E. coli GJ1158 strains at (A) 0.6 OD 600 , (B) 1.0 OD. Basal level expression was given a minimal value of 0.5%.

    Journal: Journal of Genetic Engineering & Biotechnology

    Article Title: Chemical complexity of protein determines optimal E. coli expression host; A comparative study using Erythropoietin, Streptokinase and Tumor Necrosis Factor Receptor

    doi: 10.1016/j.jgeb.2016.12.006

    Figure Lengend Snippet: Comparison of expression levels of TNFR ED, EPO and SK in different hosts at 37 °C on induction with 1 mM IPTG for E. coli BL21 (DE3) and BL21 (DE3) pLys S strains and 0.3 M NaCl for E. coli GJ1158 strains at (A) 0.6 OD 600 , (B) 1.0 OD. Basal level expression was given a minimal value of 0.5%.

    Article Snippet: E. coli BL21 (DE3), E. coli BL21 (DE3) pLys S, E. coli BL21 Rosetta (DE3) pLys S (Novagen,) are IPTG inducible strains in which the T7 RNA Polymerase gene is under the control of a Lac UV5 promoter.

    Techniques: Expressing

    Immunoblot analysis of total protein of induced E. coli BL21 (DE3) cellsharboring the recombinant plasmids using anti-His antibodies . Lanes 1 – Protein marker, 2 – pRSET A vector control induced, 3 – pRSET-TNFR ED uninduced, 4 – pRSET-TNFR ED induced, 5 – pRSET EPO-uninduced, 6 – pRSET EPO-induced, 7 – pRSET SK uninduced, 8 – pRSET SK induced.

    Journal: Journal of Genetic Engineering & Biotechnology

    Article Title: Chemical complexity of protein determines optimal E. coli expression host; A comparative study using Erythropoietin, Streptokinase and Tumor Necrosis Factor Receptor

    doi: 10.1016/j.jgeb.2016.12.006

    Figure Lengend Snippet: Immunoblot analysis of total protein of induced E. coli BL21 (DE3) cellsharboring the recombinant plasmids using anti-His antibodies . Lanes 1 – Protein marker, 2 – pRSET A vector control induced, 3 – pRSET-TNFR ED uninduced, 4 – pRSET-TNFR ED induced, 5 – pRSET EPO-uninduced, 6 – pRSET EPO-induced, 7 – pRSET SK uninduced, 8 – pRSET SK induced.

    Article Snippet: E. coli BL21 (DE3), E. coli BL21 (DE3) pLys S, E. coli BL21 Rosetta (DE3) pLys S (Novagen,) are IPTG inducible strains in which the T7 RNA Polymerase gene is under the control of a Lac UV5 promoter.

    Techniques: Recombinant, Marker, Plasmid Preparation

    Recombinant AfIlv3A expression, purification and DHAD activity. A. Expression of recombinant Ilv3A protein. E. coli BL21 DE3 cells were transformed with pET30_Ilv3A, grown until OD600 > 0.5 and then incubated in the presence and absence of 0.5 mM IPTG for 20 h at 20°C. Ilv3A was purified from the bacterial lysate by immobilized metal ion affinity chromatography (IMAC). Protein fractions were separated by polyacrylamide gel electrophoresis on 4–12% Bis-Tris NuPage gels (Invitrogen) followed by staining with GelCode Blue staining reagent (Pierce). The molecular weights in kilo Daltons of marker proteins are indicated. Lane 1, E. coli cell lysate; lane 2, E. coli cell lysate following IPTG induction; lane 3, Ilv3A protein purified by IMAC. B. Dihydroxyacid dehydratase activity of recombinant Ilv3A. 2 µg Ilv3A was assayed in the presence of 0–60 mM L-threonic acid. Initial reaction velocities were calculated and plotted versus substrate concentration.

    Journal: PLoS ONE

    Article Title: The Aspergillus fumigatus Dihydroxyacid Dehydratase Ilv3A/IlvC Is Required for Full Virulence

    doi: 10.1371/journal.pone.0043559

    Figure Lengend Snippet: Recombinant AfIlv3A expression, purification and DHAD activity. A. Expression of recombinant Ilv3A protein. E. coli BL21 DE3 cells were transformed with pET30_Ilv3A, grown until OD600 > 0.5 and then incubated in the presence and absence of 0.5 mM IPTG for 20 h at 20°C. Ilv3A was purified from the bacterial lysate by immobilized metal ion affinity chromatography (IMAC). Protein fractions were separated by polyacrylamide gel electrophoresis on 4–12% Bis-Tris NuPage gels (Invitrogen) followed by staining with GelCode Blue staining reagent (Pierce). The molecular weights in kilo Daltons of marker proteins are indicated. Lane 1, E. coli cell lysate; lane 2, E. coli cell lysate following IPTG induction; lane 3, Ilv3A protein purified by IMAC. B. Dihydroxyacid dehydratase activity of recombinant Ilv3A. 2 µg Ilv3A was assayed in the presence of 0–60 mM L-threonic acid. Initial reaction velocities were calculated and plotted versus substrate concentration.

    Article Snippet: Sequencing confirmed that the resulting vector, pET30_Ilv3A, was correctly constructed. pET30_Ilv3A was transformed into E. coli BL21 DE3 (Novagen) and expression was induced by IPTG as directed in the manufacturers protocol.

    Techniques: Recombinant, Expressing, Purification, Activity Assay, Transformation Assay, Incubation, Affinity Chromatography, Polyacrylamide Gel Electrophoresis, Staining, Marker, Concentration Assay

    Production and purification of recombinant Zika virus envelope protein domain III (rZE3) and recombinant lipidated Zika virus envelope protein domain III (rLZE3). The plasmid maps of pZE3 ( a ) and pLZE3 ( d ) for the production of rZE3 and rLZE3, respectively. The purification of rZE3 ( b , c ) and rLZE3 ( e , f ) was monitored by 10% reducing Tricine-SDS-PAGE followed by Coomassie Blue staining and immunoblotting with anti-His-tag antibodies. rZE3 and rLZE3 were expressed in the E. coli strains BL21 (DE3) and C43 (DE3), respectively. Lanes 1, 5, 9, and 13: protein expression without IPTG induction; lanes 2, 6, 10, and 14: protein expression after IPTG induction; lanes 3 and 7: extraction of rZE3 from inclusion bodies; lanes 11 and 15: soluble fraction of rLZE3; and lanes 4, 8, 12, and 16: purified proteins. Lanes 5–8 and lanes 13–16 show the induction and purification processes for rZE3 and rLZE3, respectively, evaluated by immunoblotting. The arrows show the electrophoretic positions of rZE3 or rLZE3. g Mass spectrum analysis of rLZE3. The N-terminus of the rLZE3 fragments was obtained by trypsin digestion and further examined with a WatersR MALDI micro MX™ mass spectrometer. MALDI-TOF MS spectra revealed lipid peptide signals with three m/z value peaks of 1452.129, 1466.144, and 1480.160

    Journal: Journal of Biomedical Science

    Article Title: Recombinant lipidated Zika virus envelope protein domain III elicits durable neutralizing antibody responses against Zika virus in mice

    doi: 10.1186/s12929-020-00646-x

    Figure Lengend Snippet: Production and purification of recombinant Zika virus envelope protein domain III (rZE3) and recombinant lipidated Zika virus envelope protein domain III (rLZE3). The plasmid maps of pZE3 ( a ) and pLZE3 ( d ) for the production of rZE3 and rLZE3, respectively. The purification of rZE3 ( b , c ) and rLZE3 ( e , f ) was monitored by 10% reducing Tricine-SDS-PAGE followed by Coomassie Blue staining and immunoblotting with anti-His-tag antibodies. rZE3 and rLZE3 were expressed in the E. coli strains BL21 (DE3) and C43 (DE3), respectively. Lanes 1, 5, 9, and 13: protein expression without IPTG induction; lanes 2, 6, 10, and 14: protein expression after IPTG induction; lanes 3 and 7: extraction of rZE3 from inclusion bodies; lanes 11 and 15: soluble fraction of rLZE3; and lanes 4, 8, 12, and 16: purified proteins. Lanes 5–8 and lanes 13–16 show the induction and purification processes for rZE3 and rLZE3, respectively, evaluated by immunoblotting. The arrows show the electrophoretic positions of rZE3 or rLZE3. g Mass spectrum analysis of rLZE3. The N-terminus of the rLZE3 fragments was obtained by trypsin digestion and further examined with a WatersR MALDI micro MX™ mass spectrometer. MALDI-TOF MS spectra revealed lipid peptide signals with three m/z value peaks of 1452.129, 1466.144, and 1480.160

    Article Snippet: For expression of rZE3, pZE3 was transformed into E. coli BL21 (Invitrogen, Carlsbad, CA).

    Techniques: Purification, Recombinant, Plasmid Preparation, SDS Page, Staining, Expressing, Mass Spectrometry

    SDS-PAGE analysis of purified protein recombinant SllB in E. coli BL21 cells. Lane M: Takara Protein Marker; lane 1, SDS-PAGE analysis of the recombinant S-layer protein before purification; lane 2, SDS-PAGE analysis of the purified recombinant protein.

    Journal: International Journal of Molecular Medicine

    Article Title: Cloning of the surface layer gene sllB from Bacillus sphaericus ATCC 14577 and its heterologous expression and purification

    doi: 10.3892/ijmm.2012.890

    Figure Lengend Snippet: SDS-PAGE analysis of purified protein recombinant SllB in E. coli BL21 cells. Lane M: Takara Protein Marker; lane 1, SDS-PAGE analysis of the recombinant S-layer protein before purification; lane 2, SDS-PAGE analysis of the purified recombinant protein.

    Article Snippet: 2.0 (Takara, no. DV801A), from which 0.5 μl was used to transform 100 μl of E. coli BL21 (DE3, Stratagene).

    Techniques: SDS Page, Purification, Recombinant, Marker

    A transmission electron microscopic observation on the E. coli BL21 with recombinant protein. (A) Normal E. coli BL21 was treated as control. (B) The E. coli BL21 cells recombinant S-layer protein. (C) Crystal lattice structures on surface of the E. coli BL21 cells recombinant S-layer protein.

    Journal: International Journal of Molecular Medicine

    Article Title: Cloning of the surface layer gene sllB from Bacillus sphaericus ATCC 14577 and its heterologous expression and purification

    doi: 10.3892/ijmm.2012.890

    Figure Lengend Snippet: A transmission electron microscopic observation on the E. coli BL21 with recombinant protein. (A) Normal E. coli BL21 was treated as control. (B) The E. coli BL21 cells recombinant S-layer protein. (C) Crystal lattice structures on surface of the E. coli BL21 cells recombinant S-layer protein.

    Article Snippet: 2.0 (Takara, no. DV801A), from which 0.5 μl was used to transform 100 μl of E. coli BL21 (DE3, Stratagene).

    Techniques: Transmission Assay, Recombinant

    Expression of sllB in E. coli BL21 cells. (A) SDS-PAGE analysis of rSllB protein; lane 1, the whole cell lysate of E. coli BL21 cells containing pET28a(+); lane 2, the supernatant of cells containing pET28a(+); lane 3, the pellet of cells containing pET28a(+); lane 4, the whole cell lysate of E. coli BL21 cells containing pET28a(+)- sllB ; lane 5, the supernatant of cell containing pET28a(+)- sllB ; lane 6, the pellet of cells containing pET28a(+)- sllB ; lane M represent Takara Protein Marker (Broad). (B) Western blot analysis of rSllB protein; lane 1, the whole cell lysate of E. coli BL21 cells containing pET28a(+); lane 2, the supernatant of cells containing pET28a(+); lane 3, the pellet of cells containing pET28a(+); lane 4, the whole cell lysate of E. coli BL21 cells containing pET28a(+)- sllB ; lane 5, the supernatant of cell containing pET28a(+)- sllB ; lane 6, the pellet of cells containing pET28a(+)- sllB ; M, Takara Protein Marker (Broad). Lane M1, Precision plus protein standards; lane M2, perfect protein marker. Note the band pointed with arrows is the recombinant S-layer protein.

    Journal: International Journal of Molecular Medicine

    Article Title: Cloning of the surface layer gene sllB from Bacillus sphaericus ATCC 14577 and its heterologous expression and purification

    doi: 10.3892/ijmm.2012.890

    Figure Lengend Snippet: Expression of sllB in E. coli BL21 cells. (A) SDS-PAGE analysis of rSllB protein; lane 1, the whole cell lysate of E. coli BL21 cells containing pET28a(+); lane 2, the supernatant of cells containing pET28a(+); lane 3, the pellet of cells containing pET28a(+); lane 4, the whole cell lysate of E. coli BL21 cells containing pET28a(+)- sllB ; lane 5, the supernatant of cell containing pET28a(+)- sllB ; lane 6, the pellet of cells containing pET28a(+)- sllB ; lane M represent Takara Protein Marker (Broad). (B) Western blot analysis of rSllB protein; lane 1, the whole cell lysate of E. coli BL21 cells containing pET28a(+); lane 2, the supernatant of cells containing pET28a(+); lane 3, the pellet of cells containing pET28a(+); lane 4, the whole cell lysate of E. coli BL21 cells containing pET28a(+)- sllB ; lane 5, the supernatant of cell containing pET28a(+)- sllB ; lane 6, the pellet of cells containing pET28a(+)- sllB ; M, Takara Protein Marker (Broad). Lane M1, Precision plus protein standards; lane M2, perfect protein marker. Note the band pointed with arrows is the recombinant S-layer protein.

    Article Snippet: 2.0 (Takara, no. DV801A), from which 0.5 μl was used to transform 100 μl of E. coli BL21 (DE3, Stratagene).

    Techniques: Expressing, SDS Page, Marker, Western Blot, Recombinant

    Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in BL21 bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.

    Journal: Oncotarget

    Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells

    doi: 10.18632/oncotarget.9179

    Figure Lengend Snippet: Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in BL21 bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.

    Article Snippet: To clone wild-type FHIT and the truncated forms, the following primers containing a BamHI restriction site were used: FHIT forward: 5′- GGATCCTCGTTCAGATTTGGCCAA-3′ FHIT rev TR1: 5′- GGATCCGTCATTCCTGTGAAAGTCTCCAGCCTT - 3′ FHIT rev TR2: 5′-GGATCC-CCCATGGAAATGTTTTTCCACCACTGT-3′ FHIT rev TR3: 5′-GGATCC-CACAAGGACATGTCCTGGTACCACAGGTT-3′ PGEX-2T plasmid, E. coli BL21, and Glutathione Sepharose 4B resin were from Amersham.

    Techniques: Mutagenesis, Amplification, Recombinant, Purification, Incubation, Immunoprecipitation

    SDS-PAGE (a) and western blot (b) analyses of the recombinant BirA protein expressed via pET24-BirA vector in BL21 E. coli cells by addition of IPTG to the final concentration of 1 mM. (a) Lane 1: Protein molecular weight marker (Unstained protein molecular weight marker, Fermentas, Lithuania). Different induced colonies (lane 3–7) showed the same size of BirA (36.6 kDa) expression compared with un-induced sample (lane 2) (b) Western blot analysis of recombinant BirA protein by anti-His antibody specific for C-terminal polyhistidine tag indicated the specific 36.6 kDa protein band. Lane 1: Protein marker (PrestainedProtein Ladder, CinnaGen, Iran) Lane 2: Un-induced bacterial lysate. Lane 3: Recombinant BirA protein (36.6 kDa). Arrows indicate the target protein bands

    Journal: Advanced Biomedical Research

    Article Title: Isolation, cloning, and expression of E. coli BirA gene for biotinylation applications

    doi: 10.4103/2277-9175.161576

    Figure Lengend Snippet: SDS-PAGE (a) and western blot (b) analyses of the recombinant BirA protein expressed via pET24-BirA vector in BL21 E. coli cells by addition of IPTG to the final concentration of 1 mM. (a) Lane 1: Protein molecular weight marker (Unstained protein molecular weight marker, Fermentas, Lithuania). Different induced colonies (lane 3–7) showed the same size of BirA (36.6 kDa) expression compared with un-induced sample (lane 2) (b) Western blot analysis of recombinant BirA protein by anti-His antibody specific for C-terminal polyhistidine tag indicated the specific 36.6 kDa protein band. Lane 1: Protein marker (PrestainedProtein Ladder, CinnaGen, Iran) Lane 2: Un-induced bacterial lysate. Lane 3: Recombinant BirA protein (36.6 kDa). Arrows indicate the target protein bands

    Article Snippet: E. coli BL21 (DE3) and pET-24a(+) plasmid (Merck KGaA, Darmstadt, Germany) were used as expression host and vector, respectively.

    Techniques: SDS Page, Western Blot, Recombinant, Plasmid Preparation, Concentration Assay, Molecular Weight, Marker, Expressing

    SDS-PAGE analysis of the purified xylanases obtained from E.coli BL21. Lane 1: 100 mM imidazole wash of the recombined protein XYNB to Ni-nitrilotriacetic acid resin; Lane2: 100 mM imidazole wash of the recombined protein XYNA1 to Ni-nitrilotriacetic acid resin; M: Standard protein molecular weight. The protein gels were stained with Coomasie Brilliant Blue R250. →:interest proteins

    Journal: Brazilian Journal of Microbiology

    Article Title: Hyperexpression of two Aspergillus Niger Xylanase Genes in Escherichia Coli and Characterization of the Gene Products

    doi: 10.1590/S1517-83822010000300030

    Figure Lengend Snippet: SDS-PAGE analysis of the purified xylanases obtained from E.coli BL21. Lane 1: 100 mM imidazole wash of the recombined protein XYNB to Ni-nitrilotriacetic acid resin; Lane2: 100 mM imidazole wash of the recombined protein XYNA1 to Ni-nitrilotriacetic acid resin; M: Standard protein molecular weight. The protein gels were stained with Coomasie Brilliant Blue R250. →:interest proteins

    Article Snippet: E. coli BL21 was used to express recombinant protein using the expression vector pET32a (Novagen/Merck, America).

    Techniques: SDS Page, Purification, Molecular Weight, Staining

    SDS-PAGE analysis of the recombinant xylanases produced by E.coli BL21 .lanes 1 and 2: recombined proteins: XYNA1 and XYNB, respectively; Lane3: pET32a host; M: Standard protein molecular weight. The protein gels were stained with Coomasie Brilliant Blue R250; →: interest proteins

    Journal: Brazilian Journal of Microbiology

    Article Title: Hyperexpression of two Aspergillus Niger Xylanase Genes in Escherichia Coli and Characterization of the Gene Products

    doi: 10.1590/S1517-83822010000300030

    Figure Lengend Snippet: SDS-PAGE analysis of the recombinant xylanases produced by E.coli BL21 .lanes 1 and 2: recombined proteins: XYNA1 and XYNB, respectively; Lane3: pET32a host; M: Standard protein molecular weight. The protein gels were stained with Coomasie Brilliant Blue R250; →: interest proteins

    Article Snippet: E. coli BL21 was used to express recombinant protein using the expression vector pET32a (Novagen/Merck, America).

    Techniques: SDS Page, Recombinant, Produced, Molecular Weight, Staining

    Expression of rDer f 5 in Escherichia coli BL21 cells. E. coli BL21 cells were transformed with either pET28a(+)-Der f 5 or empty vector pET28a(+) as control. A , SDS-PAGE analysis of the rDer f 5 protein. Lane M 1 = TaKaRa protein marker (Broad); lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = supernatant of cells containing pET28a; lane 3 = pellet of cells containing pET28a; lane 4 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5; lane 5 = supernatant of cells containing pET28a(+)-Der f 5; lane 6 = pellet of cells containing pET28a(+)-Der f 5. B , Western blotting analysis of the rDer f 5 protein. Lane M 2 = Precision Plus Protein Standards; lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5. Arrows point to the band of rDer f 5.

    Journal: Brazilian Journal of Medical and Biological Research

    Article Title: Cloning, bioinformatics analysis, and expression of the dust mite allergen Der f 5 of Dermatophagoides farinae

    doi: 10.1590/S0100-879X2012007500077

    Figure Lengend Snippet: Expression of rDer f 5 in Escherichia coli BL21 cells. E. coli BL21 cells were transformed with either pET28a(+)-Der f 5 or empty vector pET28a(+) as control. A , SDS-PAGE analysis of the rDer f 5 protein. Lane M 1 = TaKaRa protein marker (Broad); lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = supernatant of cells containing pET28a; lane 3 = pellet of cells containing pET28a; lane 4 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5; lane 5 = supernatant of cells containing pET28a(+)-Der f 5; lane 6 = pellet of cells containing pET28a(+)-Der f 5. B , Western blotting analysis of the rDer f 5 protein. Lane M 2 = Precision Plus Protein Standards; lane 1 = whole cell lysate of E. coli BL21 cells containing pET28a; lane 2 = whole cell lysate of E. coli BL21 cells containing pET28a(+)-Der f 5. Arrows point to the band of rDer f 5.

    Article Snippet: Expression of recombinant Der f 5 (rDer f 5) in E. coli BL21 (DE3) A 0.5-µL amount of the pET28a-(+)-Der f 5 plasmid was prepared using the MiniBEST Plasmid Purification Kit 2.0 (DV801A; TaKaRa Biotech) and used to transform 100 µL E. coli BL21 (DE3, Stratagene, USA).

    Techniques: Expressing, Transformation Assay, Plasmid Preparation, SDS Page, Marker, Western Blot

    Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli BL21/pETSip2 (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P

    Journal: Frontiers in Microbiology

    Article Title: Edwardsiella tarda Sip2: A Serum-Induced Protein That Is Essential to Serum Survival, Acid Resistance, Intracellular Replication, and Host Infection

    doi: 10.3389/fmicb.2018.01084

    Figure Lengend Snippet: Effect of Sip2 on bacterial resistance against serum damage. (A) Escherichia coli BL21/pETSip2 (expressing Sip2) and BL21/pET259 (control) were treated with normal or inactivated tongue sole serum for 1 h, and bacterial survival was determined. (B) Edwardsiella tarda TX01, TX01Δ sip2 , and TX01Δ sip2 / sip2 were treated with tongue sole serum as above, and bacterial survival rate was determined. Data are the means of three independent experiments and presented as means ± SEM. Values with different letters indicate significantly different ( P

    Article Snippet: E. coli BL21 (DE3) and DH5α were purchased from TransGen Biotech (Beijing, China); E. coli S17-1λpir was purchased from Biomedal (Sevilla, Spain).

    Techniques: Expressing

    Cloning, expression, and large-scale cultivation of dimeric thymosin beta 4 (DTβ4) engineered bacteria. ( A ) Two entire complementary DNA sequences of thymosin beta 4 (Tβ4) were constructed into a prokaryotic expression plasmid with a small DNA linker (GGTTCT). The results show a 267 bp fragment with correct sequence as expected (arrow). ( B ) Five colonies obtained after the transformation of Escherichia coli were randomly picked to test the protein expression on a small scale with sodium dodecyl sulfate polyacrylamide gel electrophoresis. After isopropyl β-D-1-thiogalactopyranoside (IPTG) induction, a new protein (arrow) appeared in each culture pellet and accounted for over 15% of all the bacteria proteins (1: molecular ladder; 2–6: protein expression of picked five clones; 7: protein expression without IPTG induction). ( C ) Bacterial growth curve of BL21/DTβ4 in a 10 L fermenter (the arrow indicates the induction time). ( D ) DTβ4 expression (arrow) during fermentation (1: DTβ4 expression without IPTG induction; 2–6: DTβ4 expression every hour after IPTG induction). Abbreviation: DNA, deoxyribonucleic acid.

    Journal: Drug Design, Development and Therapy

    Article Title: A novel dimeric thymosin beta 4 with enhanced activities accelerates the rate of wound healing

    doi: 10.2147/DDDT.S50183

    Figure Lengend Snippet: Cloning, expression, and large-scale cultivation of dimeric thymosin beta 4 (DTβ4) engineered bacteria. ( A ) Two entire complementary DNA sequences of thymosin beta 4 (Tβ4) were constructed into a prokaryotic expression plasmid with a small DNA linker (GGTTCT). The results show a 267 bp fragment with correct sequence as expected (arrow). ( B ) Five colonies obtained after the transformation of Escherichia coli were randomly picked to test the protein expression on a small scale with sodium dodecyl sulfate polyacrylamide gel electrophoresis. After isopropyl β-D-1-thiogalactopyranoside (IPTG) induction, a new protein (arrow) appeared in each culture pellet and accounted for over 15% of all the bacteria proteins (1: molecular ladder; 2–6: protein expression of picked five clones; 7: protein expression without IPTG induction). ( C ) Bacterial growth curve of BL21/DTβ4 in a 10 L fermenter (the arrow indicates the induction time). ( D ) DTβ4 expression (arrow) during fermentation (1: DTβ4 expression without IPTG induction; 2–6: DTβ4 expression every hour after IPTG induction). Abbreviation: DNA, deoxyribonucleic acid.

    Article Snippet: Expression of DTβ4 and large-scale cultivation of engineered bacteria The pET22b-DTβ4 plasmid was transformed into E. coli BL21 (DE3; Promega) using the calcium chloride method.

    Techniques: Clone Assay, Expressing, Construct, Plasmid Preparation, Sequencing, Transformation Assay, Polyacrylamide Gel Electrophoresis