e coli bl21 Ge Healthcare Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    GE Healthcare escherichia coli e coli bl21
    Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in <t>BL21</t> bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.
    Escherichia Coli E Coli Bl21, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 85/100, based on 148 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli e coli bl21/product/GE Healthcare
    Average 85 stars, based on 148 article reviews
    Price from $9.99 to $1999.99
    escherichia coli e coli bl21 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    92
    GE Healthcare escherichia coli e coli bl21 de3 strain
    Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in <t>BL21</t> bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.
    Escherichia Coli E Coli Bl21 De3 Strain, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 60 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli e coli bl21 de3 strain/product/GE Healthcare
    Average 92 stars, based on 60 article reviews
    Price from $9.99 to $1999.99
    escherichia coli e coli bl21 de3 strain - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    94
    GE Healthcare escherichia coli
    Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in <t>BL21</t> bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.
    Escherichia Coli, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 94/100, based on 4985 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli/product/GE Healthcare
    Average 94 stars, based on 4985 article reviews
    Price from $9.99 to $1999.99
    escherichia coli - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    86
    GE Healthcare competent bl21 star escherichia coli
    Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in <t>BL21</t> bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.
    Competent Bl21 Star Escherichia Coli, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 86/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/competent bl21 star escherichia coli/product/GE Healthcare
    Average 86 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    competent bl21 star escherichia coli - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    92
    GE Healthcare e coli strain bl21
    BdUev1s physically interact with BdUbc13s. (A) Physical interaction between BdUev1s and BdUbc13s in a yeast two-hybrid assay. PJ69-4a cells were transformed with BdUEV1 s and BdUBC13 s genes and the transformants carrying one Gal4 BD (pGBT9) and one Gal4 AD (pGAD424) plasmid were then selected, replicated onto various plates as indicated and incubated for 3 days before being photographed. The result is representative of at least five independent transformants from each treatment. (B) Protein interactions between BdUev1s and BdUbc13s by an affinity pull-down assay. <t>BL21</t> (DE3) cells were transformed with pGEX-BdUEV1s, and target gene expression was induced by adding 0.2 mM IPTG. Crude cell extracts were loaded on Glutathione Sepharose TM 4B beads and 10 μg of purified His 6 -BdUbc13.
    E Coli Strain Bl21, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 463 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli strain bl21/product/GE Healthcare
    Average 92 stars, based on 463 article reviews
    Price from $9.99 to $1999.99
    e coli strain bl21 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    GE Healthcare e coli bl21 de3
    BdUev1s physically interact with BdUbc13s. (A) Physical interaction between BdUev1s and BdUbc13s in a yeast two-hybrid assay. PJ69-4a cells were transformed with BdUEV1 s and BdUBC13 s genes and the transformants carrying one Gal4 BD (pGBT9) and one Gal4 AD (pGAD424) plasmid were then selected, replicated onto various plates as indicated and incubated for 3 days before being photographed. The result is representative of at least five independent transformants from each treatment. (B) Protein interactions between BdUev1s and BdUbc13s by an affinity pull-down assay. <t>BL21</t> (DE3) cells were transformed with pGEX-BdUEV1s, and target gene expression was induced by adding 0.2 mM IPTG. Crude cell extracts were loaded on Glutathione Sepharose TM 4B beads and 10 μg of purified His 6 -BdUbc13.
    E Coli Bl21 De3, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 590 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21 de3/product/GE Healthcare
    Average 92 stars, based on 590 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 de3 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    93
    GE Healthcare escherichia coli bl21 de3 cells
    BdUev1s physically interact with BdUbc13s. (A) Physical interaction between BdUev1s and BdUbc13s in a yeast two-hybrid assay. PJ69-4a cells were transformed with BdUEV1 s and BdUBC13 s genes and the transformants carrying one Gal4 BD (pGBT9) and one Gal4 AD (pGAD424) plasmid were then selected, replicated onto various plates as indicated and incubated for 3 days before being photographed. The result is representative of at least five independent transformants from each treatment. (B) Protein interactions between BdUev1s and BdUbc13s by an affinity pull-down assay. <t>BL21</t> (DE3) cells were transformed with pGEX-BdUEV1s, and target gene expression was induced by adding 0.2 mM IPTG. Crude cell extracts were loaded on Glutathione Sepharose TM 4B beads and 10 μg of purified His 6 -BdUbc13.
    Escherichia Coli Bl21 De3 Cells, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 579 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli bl21 de3 cells/product/GE Healthcare
    Average 93 stars, based on 579 article reviews
    Price from $9.99 to $1999.99
    escherichia coli bl21 de3 cells - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    86
    GE Healthcare bl21 plyss e coli
    BdUev1s physically interact with BdUbc13s. (A) Physical interaction between BdUev1s and BdUbc13s in a yeast two-hybrid assay. PJ69-4a cells were transformed with BdUEV1 s and BdUBC13 s genes and the transformants carrying one Gal4 BD (pGBT9) and one Gal4 AD (pGAD424) plasmid were then selected, replicated onto various plates as indicated and incubated for 3 days before being photographed. The result is representative of at least five independent transformants from each treatment. (B) Protein interactions between BdUev1s and BdUbc13s by an affinity pull-down assay. <t>BL21</t> (DE3) cells were transformed with pGEX-BdUEV1s, and target gene expression was induced by adding 0.2 mM IPTG. Crude cell extracts were loaded on Glutathione Sepharose TM 4B beads and 10 μg of purified His 6 -BdUbc13.
    Bl21 Plyss E Coli, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 86/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 plyss e coli/product/GE Healthcare
    Average 86 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    bl21 plyss e coli - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    88
    GE Healthcare bl21 de3 plyss e coli
    Production of GST-ROP2 fusion protein. (A) Design of fragmentation of cDNA of ROP2. Eight fragments of ROP2 were cloned as BL21 (DE3) pLysS E. coli transformed with pGEX-4T-1/GRA2 31-71 ; "R2", that with pGEX-4T-1/ROP2 324-561 ; and "LR", that with pGEX-4T-1/GRA2 31-71 -ROP2 324-561 . The expression was confirmed by western blot with anti-GST antibody. (F) Antigenicity of recombinant linker ROP2 antigens. It was tested by western blot against patient serum. (G) Solubility of recombinant linker ROP2 antigens. Soluble and insoluble fractions of rGST-GRA2 31-71 -ROP2 324-561 protein were tested by western blot. " width="250" height="auto" />
    Bl21 De3 Plyss E Coli, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 88/100, based on 47 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 de3 plyss e coli/product/GE Healthcare
    Average 88 stars, based on 47 article reviews
    Price from $9.99 to $1999.99
    bl21 de3 plyss e coli - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    92
    GE Healthcare escherichia coli strain
    Production of GST-ROP2 fusion protein. (A) Design of fragmentation of cDNA of ROP2. Eight fragments of ROP2 were cloned as BL21 (DE3) pLysS E. coli transformed with pGEX-4T-1/GRA2 31-71 ; "R2", that with pGEX-4T-1/ROP2 324-561 ; and "LR", that with pGEX-4T-1/GRA2 31-71 -ROP2 324-561 . The expression was confirmed by western blot with anti-GST antibody. (F) Antigenicity of recombinant linker ROP2 antigens. It was tested by western blot against patient serum. (G) Solubility of recombinant linker ROP2 antigens. Soluble and insoluble fractions of rGST-GRA2 31-71 -ROP2 324-561 protein were tested by western blot. " width="250" height="auto" />
    Escherichia Coli Strain, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli strain/product/GE Healthcare
    Average 92 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    escherichia coli strain - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    GE Healthcare escherichia coli bl21 gold
    Production of GST-ROP2 fusion protein. (A) Design of fragmentation of cDNA of ROP2. Eight fragments of ROP2 were cloned as BL21 (DE3) pLysS E. coli transformed with pGEX-4T-1/GRA2 31-71 ; "R2", that with pGEX-4T-1/ROP2 324-561 ; and "LR", that with pGEX-4T-1/GRA2 31-71 -ROP2 324-561 . The expression was confirmed by western blot with anti-GST antibody. (F) Antigenicity of recombinant linker ROP2 antigens. It was tested by western blot against patient serum. (G) Solubility of recombinant linker ROP2 antigens. Soluble and insoluble fractions of rGST-GRA2 31-71 -ROP2 324-561 protein were tested by western blot. " width="250" height="auto" />
    Escherichia Coli Bl21 Gold, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli bl21 gold/product/GE Healthcare
    Average 92 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    escherichia coli bl21 gold - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    GE Healthcare e coli bl21 component cells
    Analysis pattern of SDS-PAGE (12%) from expression of MPT83 recombinant protein in E coli strain <t>BL21.</t>
    E Coli Bl21 Component Cells, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli bl21 component cells/product/GE Healthcare
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    e coli bl21 component cells - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    Image Search Results


    Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in BL21 bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.

    Journal: Oncotarget

    Article Title: A Fhit-mimetic peptide suppresses annexin A4-mediated chemoresistance to paclitaxel in lung cancer cells

    doi: 10.18632/oncotarget.9179

    Figure Lengend Snippet: Fhit peptide interacts with Annexin 4 A. GST-Fhit fusion protein and three deletion mutant proteins. Fhit was deleted from the C-terminal site. B. GST- FHIT plasmids were amplified in BL21 bacteria by stimulation with IPTG 0.5 μM for 6 h at 30°C. Recombinant GST-Fhit fusion proteins were purified with GSH resin beads and added to A549 total lysates. 12 h after incubation at 4°C, GSH resin beads were washed and proteins eluted. Proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with antibodies raised against Annexin 4 or GST. C. A549 cells were treated with Tat-scrambled peptide or Tat-Fhit 7-13 peptide (150 μM) 24 h after Tat-Fhit 7-13 peptide administration, cell lysates enriched in membrane fraction were co-immunoprecipitated with a Tat monoclonal antibody, proteins were separated on a polyacrylamide gel, transferred to nitrocellulose filters and probed with an Annexin 4 antibody. Inputs were run as control for equal immunoprecipitated protein amounts.

    Article Snippet: To clone wild-type FHIT and the truncated forms, the following primers containing a BamHI restriction site were used: FHIT forward: 5′- GGATCCTCGTTCAGATTTGGCCAA-3′ FHIT rev TR1: 5′- GGATCCGTCATTCCTGTGAAAGTCTCCAGCCTT - 3′ FHIT rev TR2: 5′-GGATCC-CCCATGGAAATGTTTTTCCACCACTGT-3′ FHIT rev TR3: 5′-GGATCC-CACAAGGACATGTCCTGGTACCACAGGTT-3′ PGEX-2T plasmid, E. coli BL21, and Glutathione Sepharose 4B resin were from Amersham.

    Techniques: Mutagenesis, Amplification, Recombinant, Purification, Incubation, Immunoprecipitation

    MSP58 interacts with importin α1 and α6. A . Interaction of MSP58 with importins in a yeast two-hybrid assay. Yeast transformants with bait and prey as indicated were spotted on histidine-containing (−TULL), without histidine (−TULLH), and both histidine- and X-Gal-containing (−TULL + X-Gal) media (left) in plates. LexA-lamin served as a negative control. Yeast cotransformed were analyzed by quantitative β-Gal assays (middle). Data represent the mean ± the standard deviation of three separate experiments. A Western blot shows expression levels of different importins in yeast cells (right). B . Coimmunoprecipitation assays. Whole cell lysates from HT1080 cell lines stably expressing HA-MSP58 were subjected to immunoprecipitation (IP) experiments followed by a Western blot analysis with the indicated antibodies. IP by mouse immunoglobulin G (IgG) was used as a negative control. C . GST and fusion proteins GST-importins α1 and α6 were expressed in Escherichia coli BL21 cells and immobilized on glutathione-Sepharose. The MSP58 was obtained with a cell-free transcription and translation system in vitro and incubated with GST, GST-importin α1, or α6 proteins. Bound proteins were detected by immunoblotting with an anti-HA antibody. Coomassie blue-stained gel shows the input of GST-fusion proteins used. D . Schematic presentation of wild-type and different mutants of MSP58 tested in yeast two-hybrid assays (left). Numbers indicate the amino acid position. Yeast cotransformed with bait and prey as indicated were analyzed by quantitative β-Gal assays (right). Data represent the mean ± the standard deviation of three separate experiments. LexA-lamin served as a negative control. Immunoblotting shows the expression levels of different LexA-MSP58 fusion proteins in yeast. E . GST and GST-importin α1 or α6 proteins were immobilized on glutathione-Sepharose and incubated with cell lysates containing EGFP MSP58 1–100 or EGFP MSP58 102–300. Bound proteins were resolved by SDS–PAGE followed by Western blot analysis using anti-GFP antibodies.

    Journal: Journal of Biomedical Science

    Article Title: Identification and characterization of nuclear and nucleolar localization signals in 58-kDa microspherule protein (MSP58)

    doi: 10.1186/s12929-015-0136-0

    Figure Lengend Snippet: MSP58 interacts with importin α1 and α6. A . Interaction of MSP58 with importins in a yeast two-hybrid assay. Yeast transformants with bait and prey as indicated were spotted on histidine-containing (−TULL), without histidine (−TULLH), and both histidine- and X-Gal-containing (−TULL + X-Gal) media (left) in plates. LexA-lamin served as a negative control. Yeast cotransformed were analyzed by quantitative β-Gal assays (middle). Data represent the mean ± the standard deviation of three separate experiments. A Western blot shows expression levels of different importins in yeast cells (right). B . Coimmunoprecipitation assays. Whole cell lysates from HT1080 cell lines stably expressing HA-MSP58 were subjected to immunoprecipitation (IP) experiments followed by a Western blot analysis with the indicated antibodies. IP by mouse immunoglobulin G (IgG) was used as a negative control. C . GST and fusion proteins GST-importins α1 and α6 were expressed in Escherichia coli BL21 cells and immobilized on glutathione-Sepharose. The MSP58 was obtained with a cell-free transcription and translation system in vitro and incubated with GST, GST-importin α1, or α6 proteins. Bound proteins were detected by immunoblotting with an anti-HA antibody. Coomassie blue-stained gel shows the input of GST-fusion proteins used. D . Schematic presentation of wild-type and different mutants of MSP58 tested in yeast two-hybrid assays (left). Numbers indicate the amino acid position. Yeast cotransformed with bait and prey as indicated were analyzed by quantitative β-Gal assays (right). Data represent the mean ± the standard deviation of three separate experiments. LexA-lamin served as a negative control. Immunoblotting shows the expression levels of different LexA-MSP58 fusion proteins in yeast. E . GST and GST-importin α1 or α6 proteins were immobilized on glutathione-Sepharose and incubated with cell lysates containing EGFP MSP58 1–100 or EGFP MSP58 102–300. Bound proteins were resolved by SDS–PAGE followed by Western blot analysis using anti-GFP antibodies.

    Article Snippet: The recombinant GST, GST-importin α1 and α6 proteins were purified from lysates of Escherichia coli BL21 cells with glutathione-Sepharose 4B (GE Healthcare) under native conditions following the protocols described before [ ].

    Techniques: Y2H Assay, Negative Control, Standard Deviation, Western Blot, Expressing, Stable Transfection, Immunoprecipitation, In Vitro, Incubation, Staining, SDS Page

    BdUev1s physically interact with BdUbc13s. (A) Physical interaction between BdUev1s and BdUbc13s in a yeast two-hybrid assay. PJ69-4a cells were transformed with BdUEV1 s and BdUBC13 s genes and the transformants carrying one Gal4 BD (pGBT9) and one Gal4 AD (pGAD424) plasmid were then selected, replicated onto various plates as indicated and incubated for 3 days before being photographed. The result is representative of at least five independent transformants from each treatment. (B) Protein interactions between BdUev1s and BdUbc13s by an affinity pull-down assay. BL21 (DE3) cells were transformed with pGEX-BdUEV1s, and target gene expression was induced by adding 0.2 mM IPTG. Crude cell extracts were loaded on Glutathione Sepharose TM 4B beads and 10 μg of purified His 6 -BdUbc13.

    Journal: Frontiers in Plant Science

    Article Title: Three Brachypodium distachyon Uev1s Promote Ubc13-Mediated Lys63-Linked Polyubiquitination and Confer Different Functions

    doi: 10.3389/fpls.2016.01551

    Figure Lengend Snippet: BdUev1s physically interact with BdUbc13s. (A) Physical interaction between BdUev1s and BdUbc13s in a yeast two-hybrid assay. PJ69-4a cells were transformed with BdUEV1 s and BdUBC13 s genes and the transformants carrying one Gal4 BD (pGBT9) and one Gal4 AD (pGAD424) plasmid were then selected, replicated onto various plates as indicated and incubated for 3 days before being photographed. The result is representative of at least five independent transformants from each treatment. (B) Protein interactions between BdUev1s and BdUbc13s by an affinity pull-down assay. BL21 (DE3) cells were transformed with pGEX-BdUEV1s, and target gene expression was induced by adding 0.2 mM IPTG. Crude cell extracts were loaded on Glutathione Sepharose TM 4B beads and 10 μg of purified His 6 -BdUbc13.

    Article Snippet: The His6 and GST fusion constructs were transformed into E. coli strain BL21 (DE3) and the recombinant proteins were purified with Ni Sepharose and glutathione (Amersham Pharmacia), respectively.

    Techniques: Y2H Assay, Transformation Assay, Plasmid Preparation, Incubation, Pull Down Assay, Expressing, Purification

    UTKO1 inhibits 14-3-3εa interacting and colocalizing with ERM. ( A ) His-tagged ERM was purified from E. coli and mixed with Ciona lysate. His-ERM–binding proteins were captured using Ni-beads, eluted with imidazole, and subjected to SDS/PAGE. ( B and C ) Purified His-tagged ERM protein was preincubated with or without UTKO1/UTKO10, mixed with GST/GST14-3-3εa, precipitated with glutathione–sepharose (GSH) beads, and subjected to SDS/PAGE. ( D ) Schematic illustrations of deletion mutants of 14-3-3εa purified from the E. coli BL21 strain. ( E ) Deletion mutants of GST-14-3-3εa were incubated with B-UTKO1ox or biotin, precipitated with avidin beads, and subjected to SDS/PAGE. ( F ) Purified His-tagged ERM protein was mixed with GST-14-3-3 deletion mutants, precipitated by GSH beads, and subjected to SDS/PAGE. ( G ) Confocal images of the immunostaining of 14-3-3εa (green), ERM (red), and the merged image at 15 hpf in the control and UTKO1 (10 µM)-treated larvae. White arrowheads indicate the accumulation of 14-3-3εa in the basal contractile ring. (Scale bars: 10 μm.) ( H ) Colocalizations between 14-3-3εa and ERM, expressed as Pearson’s coefficients, measured for the basal contractile rings. Data presented as mean ± SD ( n = 31, 21, and 18 for UTKO1 0 µM, 3 µM, and 10 µM, respectively; ** P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: 14-3-3εa directs the pulsatile transport of basal factors toward the apical domain for lumen growth in tubulogenesis

    doi: 10.1073/pnas.1808756115

    Figure Lengend Snippet: UTKO1 inhibits 14-3-3εa interacting and colocalizing with ERM. ( A ) His-tagged ERM was purified from E. coli and mixed with Ciona lysate. His-ERM–binding proteins were captured using Ni-beads, eluted with imidazole, and subjected to SDS/PAGE. ( B and C ) Purified His-tagged ERM protein was preincubated with or without UTKO1/UTKO10, mixed with GST/GST14-3-3εa, precipitated with glutathione–sepharose (GSH) beads, and subjected to SDS/PAGE. ( D ) Schematic illustrations of deletion mutants of 14-3-3εa purified from the E. coli BL21 strain. ( E ) Deletion mutants of GST-14-3-3εa were incubated with B-UTKO1ox or biotin, precipitated with avidin beads, and subjected to SDS/PAGE. ( F ) Purified His-tagged ERM protein was mixed with GST-14-3-3 deletion mutants, precipitated by GSH beads, and subjected to SDS/PAGE. ( G ) Confocal images of the immunostaining of 14-3-3εa (green), ERM (red), and the merged image at 15 hpf in the control and UTKO1 (10 µM)-treated larvae. White arrowheads indicate the accumulation of 14-3-3εa in the basal contractile ring. (Scale bars: 10 μm.) ( H ) Colocalizations between 14-3-3εa and ERM, expressed as Pearson’s coefficients, measured for the basal contractile rings. Data presented as mean ± SD ( n = 31, 21, and 18 for UTKO1 0 µM, 3 µM, and 10 µM, respectively; ** P

    Article Snippet: Lysates of Ciona larvae at 15 hpf, or GST fusion proteins, which were expressed in the E. coli BL21 strain and purified using Glutathione Sepharose 4B (GE Healthcare), were incubated with B-UTKO1ox/B-UTKO1ph and avidin beads in immunoprecipitation (IP) buffer (50 mM Hepes, pH 7.5, 150 mM NaCl, 1 mM EDTA, 2.5 mM EGTA, 1 mM DTT, 10% glycerol, and protease inhibitor mixture).

    Techniques: Purification, Binding Assay, SDS Page, Incubation, Avidin-Biotin Assay, Immunostaining

    Production of GST-ROP2 fusion protein. (A) Design of fragmentation of cDNA of ROP2. Eight fragments of ROP2 were cloned as

    Journal: The Korean Journal of Parasitology

    Article Title: High Expression of Water-Soluble Recombinant Antigenic Domains of Toxoplasma gondii Secretory Organelles

    doi: 10.3347/kjp.2014.52.4.367

    Figure Lengend Snippet: Production of GST-ROP2 fusion protein. (A) Design of fragmentation of cDNA of ROP2. Eight fragments of ROP2 were cloned as "A", full sequence of ROP2 without signal sequence; "B", 1/2 Nt sequence of ROP2; "C", 1/2 Ct containing kinase domain; "D", 1/4 Nt; "E", middle 1/4 Ct; "G", 1/4Ct; "H", 1/2 Nt of kinase domain; and "I", 1/2 Ct of kinase domain. (B) Expression of recombinant ROP2 antigens. All recombinant proteins were well induced and tested by western blot with anti-GST antibody. (C) Antigenicity of recombinant ROP2 antigens. The antigenicity was tested by western blot against patient serum. (D) Solubility of recombinant ROP2 antigens. Solubility of rGST-ROP2 324-561 induced was confirmed by western blot with anti-GST antibody. (E) Expression of recombinant linker ROP2 antigens. "L", lysate of BL21 (DE3) pLysS E. coli transformed with pGEX-4T-1/GRA2 31-71 ; "R2", that with pGEX-4T-1/ROP2 324-561 ; and "LR", that with pGEX-4T-1/GRA2 31-71 -ROP2 324-561 . The expression was confirmed by western blot with anti-GST antibody. (F) Antigenicity of recombinant linker ROP2 antigens. It was tested by western blot against patient serum. (G) Solubility of recombinant linker ROP2 antigens. Soluble and insoluble fractions of rGST-GRA2 31-71 -ROP2 324-561 protein were tested by western blot.

    Article Snippet: The pGEX-4T-1 and recombinant plasmids were transformed into BL21 (DE3) pLysS E. coli .

    Techniques: Clone Assay, Sequencing, Expressing, Recombinant, Western Blot, Solubility, Transformation Assay

    Production of GST-GRA2 fusion protein.

    Journal: The Korean Journal of Parasitology

    Article Title: High Expression of Water-Soluble Recombinant Antigenic Domains of Toxoplasma gondii Secretory Organelles

    doi: 10.3347/kjp.2014.52.4.367

    Figure Lengend Snippet: Production of GST-GRA2 fusion protein. "N" indicates lysate of BL21 (DE3) pLysS E. coli without induction; "G", lysate of E. coli transformed with vector after induction; "R", Toxoplasma lysate antigen (TLA) of RH strain; "T", total lysates of E. coli ; "S", soluble fraction; and "P", insoluble fraction. The meaning of abbreviations is the same in the following context without extra illustration. (A) Design of fragmentation of cDNA of GRA2; 7 fragments of GRA2 were cloned. The name of clones and amino acid regions are indicated. "F", full sequence of GRA2 without signal sequence; "A", 2/3 N-terminal (Nt); "B", 2/3 C-terminal (Ct); "C", half Nt; "D", half Ct; "E", middle 1/3 sequence; and "L", linker, is the high disorder sequence of Nt. (B) Expression of recombinant GRA2 antigens induced at 30℃, 0.5 mM IPTG. Target bands against GST by western blot were marked with asterisks. (C) Antigenicity of recombinant GRA2 antigens. Patient serum was applied to detect the antigenicity of recombinant proteins against human IgG by western blot. The detectable signal was marked with asterisks. (D) Solubility of recombinant GRA2 antigens. The solubility of rGST-GRA2 25-105 was tested by western blot against GST.

    Article Snippet: The pGEX-4T-1 and recombinant plasmids were transformed into BL21 (DE3) pLysS E. coli .

    Techniques: Transformation Assay, Plasmid Preparation, Clone Assay, Sequencing, Expressing, Recombinant, Western Blot, Solubility

    Production of GST-MIC2 fusion protein. (A) Design of fragmentation of cDNA of MIC2. Ten fragments of MIC2 were cloned as

    Journal: The Korean Journal of Parasitology

    Article Title: High Expression of Water-Soluble Recombinant Antigenic Domains of Toxoplasma gondii Secretory Organelles

    doi: 10.3347/kjp.2014.52.4.367

    Figure Lengend Snippet: Production of GST-MIC2 fusion protein. (A) Design of fragmentation of cDNA of MIC2. Ten fragments of MIC2 were cloned as "F", full sequence of MIC2; "A", full sequence without Ct transmembrane region; "B", 2/3 Nt; "C", 2/3 Ct; "D", 1/3 Nt; "E", middle 1/3; "G", 1/3 Ct; "H", half Nt of D; "I", half Ct of D; and "J", middle 1/3 of D. (B) Expression of recombinant MIC2 antigens. All recombinant proteins were well induced and tested by western blot against anti-GST antibody. (C) Antigenicity of recombinant MIC2 antigens. The antigenicity of GST-MIC2 was tested by western blot against patient serum. (D) Solubility of recombinant MIC2 antigens. Total lysate, soluble, and insoluble fractions of rGST-MIC2 1-284 were detected against GST antibody. (E) Expression of recombinant linker MIC2 antigens. BL21 (DE3) pLysS E. coli containing GST and GST linker MIC2 1-284 recombinant plasmids were induced; "L", lysate transformed with pGEX-4T-1/GRA2 31-71 ; "M2", that with pGEX-4T-1/MIC2 1-284 ; and "LM", that with pGEX-4T-1/GRA2 31-71 -MIC2 1-284 . The expression was confirmed against anti-GST antibody. (F) Antigenicity of recombinant linker MIC2 antigens. It was tested against patient serum. (G) Solubility of recombinant linker MIC2 antigens. The soluble and insoluble fractions of rGST-GRA2 31-71 -MIC2 1-284 protein were tested by western blot.

    Article Snippet: The pGEX-4T-1 and recombinant plasmids were transformed into BL21 (DE3) pLysS E. coli .

    Techniques: Clone Assay, Sequencing, Expressing, Recombinant, Western Blot, Solubility, Transformation Assay

    Analysis pattern of SDS-PAGE (12%) from expression of MPT83 recombinant protein in E coli strain BL21.

    Journal: Journal of Genetic Engineering & Biotechnology

    Article Title: Cloning and expression of MPT83 gene from Mycobacterium tuberculosis in E. coli BL21 as vaccine candidate of tuberculosis: A preliminary study

    doi: 10.1016/j.jgeb.2018.04.001

    Figure Lengend Snippet: Analysis pattern of SDS-PAGE (12%) from expression of MPT83 recombinant protein in E coli strain BL21.

    Article Snippet: Signed written informed consent was obtained according to Ethics Committee from Hasanuddin University Hospital, Makassar, Indonesia. pGEX-2TK vector and E. coli BL21 component cells were purchased from Amersham Pharmacia Biotech. pGEM-T Easy vector and E. coli JM109 cells was purchased from Promega, USA.

    Techniques: SDS Page, Expressing, Recombinant