dynal streptavidin beads Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher streptavidin
    Schematic of ELISA assay to determine efficiency of capturing PSA, detection antibody, and <t>streptavidin.</t> Row 1, ELISA assay of sample with known concentration of biotin-labeled PSA. Row 2, ELISA assay of supernatant from row 1 assay. Reduction in ELISA
    Streptavidin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 8270 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin/product/Thermo Fisher
    Average 90 stars, based on 8270 article reviews
    Price from $9.99 to $1999.99
    streptavidin - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    93
    Thermo Fisher streptavidin dynal beads
    Flow chart of DNase-seq protocol. Briefly, cells are lysed with detergent to release nuclei, and the nuclei are digested with optimal concentrations of DNase I. DNase I digested DNA is embedded in low-melt gel agarose plugs to reduce additional random shearing. DNA (while still in the plugs) are then blunt-ended, extracted and ligated to biotinylated linker 1 (represented by red bars in the figure). Excess linker is removed by gel purification, and biotinylated fragments (Linker 1 plus 20 bases of genomic DNA) are digested with MmeI, and captured by <t>streptavidin-coated</t> <t>Dynal</t> beads (represented by brown balls). Linker 2 (represented by the blue bars) is ligated to the 2 base overhang generated by MmeI, and the ditagged 20 bp DNAs are amplified by PCR and sequenced by Illumina/Solexa.
    Streptavidin Dynal Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 195 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin dynal beads/product/Thermo Fisher
    Average 93 stars, based on 195 article reviews
    Price from $9.99 to $1999.99
    streptavidin dynal beads - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    97
    Thermo Fisher streptavidin dyna beads
    Recruitment of the transcription machinery into the PIC. (A) Complexes were assembled on <t>M280-streptavidin</t> <t>Dynabeads</t> carrying a biotinylated DNA fragment from the plasmid pA4xMLΔ53, which contained four copies of the HNF-4 cognate site A and the adenovirus major late core promoter. After PIC formation, beads were washed and bound complexes were analyzed for their factor content by immunoblotting. PICs were formed with GTFs only (TBP, TFIIB, TFIIE, TFIIF, TFIIH, Pol II (lane 3); with GTFs and HNF-4 (lane 4); or with GTFs, HNF-4, and PC4 (lanes 2 and 5). Lane 2, control in which the indicated factors were incubated with beads only (no template DNA); lane 1, GTFs only (input). (B) Immobilized-template recruitment assays are as for panel A, except that all reaction mixtures contained TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, Pol II, and TRAP/SMCC/Mediator, as shown in input lane 1. HNF-4 (lanes 3 and 5) and PC4 (lanes 4 and 5) were additionally added as indicated. (C) Immobilized-template recruitment assays are as for panel B, except that reaction mixtures in lanes 6 and 7 did not contain TFIID. HNF-4 (lanes 3, 5, and 7) and PC4 (lanes 4 to 7) were additionally added as indicated.
    Streptavidin Dyna Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 259 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin dyna beads/product/Thermo Fisher
    Average 97 stars, based on 259 article reviews
    Price from $9.99 to $1999.99
    streptavidin dyna beads - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    88
    Thermo Fisher streptavidin coated dyna beads
    Recruitment of the transcription machinery into the PIC. (A) Complexes were assembled on <t>M280-streptavidin</t> <t>Dynabeads</t> carrying a biotinylated DNA fragment from the plasmid pA4xMLΔ53, which contained four copies of the HNF-4 cognate site A and the adenovirus major late core promoter. After PIC formation, beads were washed and bound complexes were analyzed for their factor content by immunoblotting. PICs were formed with GTFs only (TBP, TFIIB, TFIIE, TFIIF, TFIIH, Pol II (lane 3); with GTFs and HNF-4 (lane 4); or with GTFs, HNF-4, and PC4 (lanes 2 and 5). Lane 2, control in which the indicated factors were incubated with beads only (no template DNA); lane 1, GTFs only (input). (B) Immobilized-template recruitment assays are as for panel A, except that all reaction mixtures contained TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, Pol II, and TRAP/SMCC/Mediator, as shown in input lane 1. HNF-4 (lanes 3 and 5) and PC4 (lanes 4 and 5) were additionally added as indicated. (C) Immobilized-template recruitment assays are as for panel B, except that reaction mixtures in lanes 6 and 7 did not contain TFIID. HNF-4 (lanes 3, 5, and 7) and PC4 (lanes 4 to 7) were additionally added as indicated.
    Streptavidin Coated Dyna Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin coated dyna beads/product/Thermo Fisher
    Average 88 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    streptavidin coated dyna beads - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    87
    Thermo Fisher dynalm 280 streptavidin beads
    Recruitment of the transcription machinery into the PIC. (A) Complexes were assembled on <t>M280-streptavidin</t> <t>Dynabeads</t> carrying a biotinylated DNA fragment from the plasmid pA4xMLΔ53, which contained four copies of the HNF-4 cognate site A and the adenovirus major late core promoter. After PIC formation, beads were washed and bound complexes were analyzed for their factor content by immunoblotting. PICs were formed with GTFs only (TBP, TFIIB, TFIIE, TFIIF, TFIIH, Pol II (lane 3); with GTFs and HNF-4 (lane 4); or with GTFs, HNF-4, and PC4 (lanes 2 and 5). Lane 2, control in which the indicated factors were incubated with beads only (no template DNA); lane 1, GTFs only (input). (B) Immobilized-template recruitment assays are as for panel A, except that all reaction mixtures contained TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, Pol II, and TRAP/SMCC/Mediator, as shown in input lane 1. HNF-4 (lanes 3 and 5) and PC4 (lanes 4 and 5) were additionally added as indicated. (C) Immobilized-template recruitment assays are as for panel B, except that reaction mixtures in lanes 6 and 7 did not contain TFIID. HNF-4 (lanes 3, 5, and 7) and PC4 (lanes 4 to 7) were additionally added as indicated.
    Dynalm 280 Streptavidin Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dynalm 280 streptavidin beads/product/Thermo Fisher
    Average 87 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    dynalm 280 streptavidin beads - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    92
    Thermo Fisher streptavidin coated dynai beads
    Recruitment of the transcription machinery into the PIC. (A) Complexes were assembled on <t>M280-streptavidin</t> <t>Dynabeads</t> carrying a biotinylated DNA fragment from the plasmid pA4xMLΔ53, which contained four copies of the HNF-4 cognate site A and the adenovirus major late core promoter. After PIC formation, beads were washed and bound complexes were analyzed for their factor content by immunoblotting. PICs were formed with GTFs only (TBP, TFIIB, TFIIE, TFIIF, TFIIH, Pol II (lane 3); with GTFs and HNF-4 (lane 4); or with GTFs, HNF-4, and PC4 (lanes 2 and 5). Lane 2, control in which the indicated factors were incubated with beads only (no template DNA); lane 1, GTFs only (input). (B) Immobilized-template recruitment assays are as for panel A, except that all reaction mixtures contained TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, Pol II, and TRAP/SMCC/Mediator, as shown in input lane 1. HNF-4 (lanes 3 and 5) and PC4 (lanes 4 and 5) were additionally added as indicated. (C) Immobilized-template recruitment assays are as for panel B, except that reaction mixtures in lanes 6 and 7 did not contain TFIID. HNF-4 (lanes 3, 5, and 7) and PC4 (lanes 4 to 7) were additionally added as indicated.
    Streptavidin Coated Dynai Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin coated dynai beads/product/Thermo Fisher
    Average 92 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    streptavidin coated dynai beads - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    92
    Thermo Fisher streptavidin dyna beads m280
    Recruitment of the transcription machinery into the PIC. (A) Complexes were assembled on <t>M280-streptavidin</t> <t>Dynabeads</t> carrying a biotinylated DNA fragment from the plasmid pA4xMLΔ53, which contained four copies of the HNF-4 cognate site A and the adenovirus major late core promoter. After PIC formation, beads were washed and bound complexes were analyzed for their factor content by immunoblotting. PICs were formed with GTFs only (TBP, TFIIB, TFIIE, TFIIF, TFIIH, Pol II (lane 3); with GTFs and HNF-4 (lane 4); or with GTFs, HNF-4, and PC4 (lanes 2 and 5). Lane 2, control in which the indicated factors were incubated with beads only (no template DNA); lane 1, GTFs only (input). (B) Immobilized-template recruitment assays are as for panel A, except that all reaction mixtures contained TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, Pol II, and TRAP/SMCC/Mediator, as shown in input lane 1. HNF-4 (lanes 3 and 5) and PC4 (lanes 4 and 5) were additionally added as indicated. (C) Immobilized-template recruitment assays are as for panel B, except that reaction mixtures in lanes 6 and 7 did not contain TFIID. HNF-4 (lanes 3, 5, and 7) and PC4 (lanes 4 to 7) were additionally added as indicated.
    Streptavidin Dyna Beads M280, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin dyna beads m280/product/Thermo Fisher
    Average 92 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    streptavidin dyna beads m280 - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    96
    Thermo Fisher dynal m 280 streptavidin beads
    Recruitment of the transcription machinery into the PIC. (A) Complexes were assembled on <t>M280-streptavidin</t> <t>Dynabeads</t> carrying a biotinylated DNA fragment from the plasmid pA4xMLΔ53, which contained four copies of the HNF-4 cognate site A and the adenovirus major late core promoter. After PIC formation, beads were washed and bound complexes were analyzed for their factor content by immunoblotting. PICs were formed with GTFs only (TBP, TFIIB, TFIIE, TFIIF, TFIIH, Pol II (lane 3); with GTFs and HNF-4 (lane 4); or with GTFs, HNF-4, and PC4 (lanes 2 and 5). Lane 2, control in which the indicated factors were incubated with beads only (no template DNA); lane 1, GTFs only (input). (B) Immobilized-template recruitment assays are as for panel A, except that all reaction mixtures contained TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, Pol II, and TRAP/SMCC/Mediator, as shown in input lane 1. HNF-4 (lanes 3 and 5) and PC4 (lanes 4 and 5) were additionally added as indicated. (C) Immobilized-template recruitment assays are as for panel B, except that reaction mixtures in lanes 6 and 7 did not contain TFIID. HNF-4 (lanes 3, 5, and 7) and PC4 (lanes 4 to 7) were additionally added as indicated.
    Dynal M 280 Streptavidin Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dynal m 280 streptavidin beads/product/Thermo Fisher
    Average 96 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    dynal m 280 streptavidin beads - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    86
    Thermo Fisher dynai streptavidin beads
    Recruitment of the transcription machinery into the PIC. (A) Complexes were assembled on <t>M280-streptavidin</t> <t>Dynabeads</t> carrying a biotinylated DNA fragment from the plasmid pA4xMLΔ53, which contained four copies of the HNF-4 cognate site A and the adenovirus major late core promoter. After PIC formation, beads were washed and bound complexes were analyzed for their factor content by immunoblotting. PICs were formed with GTFs only (TBP, TFIIB, TFIIE, TFIIF, TFIIH, Pol II (lane 3); with GTFs and HNF-4 (lane 4); or with GTFs, HNF-4, and PC4 (lanes 2 and 5). Lane 2, control in which the indicated factors were incubated with beads only (no template DNA); lane 1, GTFs only (input). (B) Immobilized-template recruitment assays are as for panel A, except that all reaction mixtures contained TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, Pol II, and TRAP/SMCC/Mediator, as shown in input lane 1. HNF-4 (lanes 3 and 5) and PC4 (lanes 4 and 5) were additionally added as indicated. (C) Immobilized-template recruitment assays are as for panel B, except that reaction mixtures in lanes 6 and 7 did not contain TFIID. HNF-4 (lanes 3, 5, and 7) and PC4 (lanes 4 to 7) were additionally added as indicated.
    Dynai Streptavidin Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dynai streptavidin beads/product/Thermo Fisher
    Average 86 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    dynai streptavidin beads - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    87
    Thermo Fisher streptavidin coated dynal beads
    Cloning of active chromatin sequences. We developed a strategy to create genomic DNA libraries containing sequences flanking DNaseI cut sites introduced into nuclear chromatin under limiting (hypersensitive) conditions. After DNA purification, free DNA ends are enzymatically repaired and ligated to a biotinylated linker adaptor. The DNA sample is then fragmented further with a four-cutter enzyme ( Nla III). At this stage, the genome has been partitioned into two predominant fragment populations: Nla III– Nla III fragments (derived from the non-DNaseI cut background) and Nla III-adaptor fragments (carrying for DNaseI cut sites). Adapted DNA is efficiently isolated on paramagnetic <t>streptavidin-coated</t> beads, whereas Nla III– Nla III background fragments are cleansed. A second linker adaptor is then appended to the Nla III end of captured DNA, and the product is released from the beads. This DNaseI cut site-enriched population is enriched and is retained for the subsequent subtraction step. A DNaseI cut site-depleted population is prepared by further fragmenting DNaseI-treated genomic DNA with a four-cutter that leaves a 3′ overhang (e.g., Nla III). Further digestion of this sample with Exonuclease III followed by mung bean nuclease will preserve the Nla III– Nla III fragments (which are resistant to processive degradation), whereas fragments with DNaseI cut ends will be efficiently eliminated. The residual remaining population of DNaseI cut site-depleted DNA is then heavily biotinylated. An excess of this population is mixed with the DNaseI cut site-enriched population, and the sample is denatured and is slowly reannealed. Nonbiotinylated fragments generated by repeated DNaseI cleavage events at or around the same genomic coordinate (i.e., a hypersensitive site) will be more likely to self-anneal than find a partner in the DNaseI cut site-depleted population. Sites that have only been cut once (i.e., due to non-HS-specific cutting or to genomic shear) will form heteroduplexes. Extraction of the mixture with paramagnetic beads isolates the nonbiotinylated homoduplexes that are now further enriched in DNaseI hypersensitive sites. This population is PCR-amplified and cloned to make the genomic ACS libraries.
    Streptavidin Coated Dynal Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 121 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin coated dynal beads/product/Thermo Fisher
    Average 87 stars, based on 121 article reviews
    Price from $9.99 to $1999.99
    streptavidin coated dynal beads - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    87
    Thermo Fisher streptavidin c1 dynal beads
    Cloning of active chromatin sequences. We developed a strategy to create genomic DNA libraries containing sequences flanking DNaseI cut sites introduced into nuclear chromatin under limiting (hypersensitive) conditions. After DNA purification, free DNA ends are enzymatically repaired and ligated to a biotinylated linker adaptor. The DNA sample is then fragmented further with a four-cutter enzyme ( Nla III). At this stage, the genome has been partitioned into two predominant fragment populations: Nla III– Nla III fragments (derived from the non-DNaseI cut background) and Nla III-adaptor fragments (carrying for DNaseI cut sites). Adapted DNA is efficiently isolated on paramagnetic <t>streptavidin-coated</t> beads, whereas Nla III– Nla III background fragments are cleansed. A second linker adaptor is then appended to the Nla III end of captured DNA, and the product is released from the beads. This DNaseI cut site-enriched population is enriched and is retained for the subsequent subtraction step. A DNaseI cut site-depleted population is prepared by further fragmenting DNaseI-treated genomic DNA with a four-cutter that leaves a 3′ overhang (e.g., Nla III). Further digestion of this sample with Exonuclease III followed by mung bean nuclease will preserve the Nla III– Nla III fragments (which are resistant to processive degradation), whereas fragments with DNaseI cut ends will be efficiently eliminated. The residual remaining population of DNaseI cut site-depleted DNA is then heavily biotinylated. An excess of this population is mixed with the DNaseI cut site-enriched population, and the sample is denatured and is slowly reannealed. Nonbiotinylated fragments generated by repeated DNaseI cleavage events at or around the same genomic coordinate (i.e., a hypersensitive site) will be more likely to self-anneal than find a partner in the DNaseI cut site-depleted population. Sites that have only been cut once (i.e., due to non-HS-specific cutting or to genomic shear) will form heteroduplexes. Extraction of the mixture with paramagnetic beads isolates the nonbiotinylated homoduplexes that are now further enriched in DNaseI hypersensitive sites. This population is PCR-amplified and cloned to make the genomic ACS libraries.
    Streptavidin C1 Dynal Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin c1 dynal beads/product/Thermo Fisher
    Average 87 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    streptavidin c1 dynal beads - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    86
    Thermo Fisher dyna beads m 280 streptavidin
    Cloning of active chromatin sequences. We developed a strategy to create genomic DNA libraries containing sequences flanking DNaseI cut sites introduced into nuclear chromatin under limiting (hypersensitive) conditions. After DNA purification, free DNA ends are enzymatically repaired and ligated to a biotinylated linker adaptor. The DNA sample is then fragmented further with a four-cutter enzyme ( Nla III). At this stage, the genome has been partitioned into two predominant fragment populations: Nla III– Nla III fragments (derived from the non-DNaseI cut background) and Nla III-adaptor fragments (carrying for DNaseI cut sites). Adapted DNA is efficiently isolated on paramagnetic <t>streptavidin-coated</t> beads, whereas Nla III– Nla III background fragments are cleansed. A second linker adaptor is then appended to the Nla III end of captured DNA, and the product is released from the beads. This DNaseI cut site-enriched population is enriched and is retained for the subsequent subtraction step. A DNaseI cut site-depleted population is prepared by further fragmenting DNaseI-treated genomic DNA with a four-cutter that leaves a 3′ overhang (e.g., Nla III). Further digestion of this sample with Exonuclease III followed by mung bean nuclease will preserve the Nla III– Nla III fragments (which are resistant to processive degradation), whereas fragments with DNaseI cut ends will be efficiently eliminated. The residual remaining population of DNaseI cut site-depleted DNA is then heavily biotinylated. An excess of this population is mixed with the DNaseI cut site-enriched population, and the sample is denatured and is slowly reannealed. Nonbiotinylated fragments generated by repeated DNaseI cleavage events at or around the same genomic coordinate (i.e., a hypersensitive site) will be more likely to self-anneal than find a partner in the DNaseI cut site-depleted population. Sites that have only been cut once (i.e., due to non-HS-specific cutting or to genomic shear) will form heteroduplexes. Extraction of the mixture with paramagnetic beads isolates the nonbiotinylated homoduplexes that are now further enriched in DNaseI hypersensitive sites. This population is PCR-amplified and cloned to make the genomic ACS libraries.
    Dyna Beads M 280 Streptavidin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dyna beads m 280 streptavidin/product/Thermo Fisher
    Average 86 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    dyna beads m 280 streptavidin - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher streptavidin conjugated dynal beads
    Cloning of active chromatin sequences. We developed a strategy to create genomic DNA libraries containing sequences flanking DNaseI cut sites introduced into nuclear chromatin under limiting (hypersensitive) conditions. After DNA purification, free DNA ends are enzymatically repaired and ligated to a biotinylated linker adaptor. The DNA sample is then fragmented further with a four-cutter enzyme ( Nla III). At this stage, the genome has been partitioned into two predominant fragment populations: Nla III– Nla III fragments (derived from the non-DNaseI cut background) and Nla III-adaptor fragments (carrying for DNaseI cut sites). Adapted DNA is efficiently isolated on paramagnetic <t>streptavidin-coated</t> beads, whereas Nla III– Nla III background fragments are cleansed. A second linker adaptor is then appended to the Nla III end of captured DNA, and the product is released from the beads. This DNaseI cut site-enriched population is enriched and is retained for the subsequent subtraction step. A DNaseI cut site-depleted population is prepared by further fragmenting DNaseI-treated genomic DNA with a four-cutter that leaves a 3′ overhang (e.g., Nla III). Further digestion of this sample with Exonuclease III followed by mung bean nuclease will preserve the Nla III– Nla III fragments (which are resistant to processive degradation), whereas fragments with DNaseI cut ends will be efficiently eliminated. The residual remaining population of DNaseI cut site-depleted DNA is then heavily biotinylated. An excess of this population is mixed with the DNaseI cut site-enriched population, and the sample is denatured and is slowly reannealed. Nonbiotinylated fragments generated by repeated DNaseI cleavage events at or around the same genomic coordinate (i.e., a hypersensitive site) will be more likely to self-anneal than find a partner in the DNaseI cut site-depleted population. Sites that have only been cut once (i.e., due to non-HS-specific cutting or to genomic shear) will form heteroduplexes. Extraction of the mixture with paramagnetic beads isolates the nonbiotinylated homoduplexes that are now further enriched in DNaseI hypersensitive sites. This population is PCR-amplified and cloned to make the genomic ACS libraries.
    Streptavidin Conjugated Dynal Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin conjugated dynal beads/product/Thermo Fisher
    Average 86 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    streptavidin conjugated dynal beads - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    84
    Thermo Fisher streptavidin coated dynal myone beads
    Cloning of active chromatin sequences. We developed a strategy to create genomic DNA libraries containing sequences flanking DNaseI cut sites introduced into nuclear chromatin under limiting (hypersensitive) conditions. After DNA purification, free DNA ends are enzymatically repaired and ligated to a biotinylated linker adaptor. The DNA sample is then fragmented further with a four-cutter enzyme ( Nla III). At this stage, the genome has been partitioned into two predominant fragment populations: Nla III– Nla III fragments (derived from the non-DNaseI cut background) and Nla III-adaptor fragments (carrying for DNaseI cut sites). Adapted DNA is efficiently isolated on paramagnetic <t>streptavidin-coated</t> beads, whereas Nla III– Nla III background fragments are cleansed. A second linker adaptor is then appended to the Nla III end of captured DNA, and the product is released from the beads. This DNaseI cut site-enriched population is enriched and is retained for the subsequent subtraction step. A DNaseI cut site-depleted population is prepared by further fragmenting DNaseI-treated genomic DNA with a four-cutter that leaves a 3′ overhang (e.g., Nla III). Further digestion of this sample with Exonuclease III followed by mung bean nuclease will preserve the Nla III– Nla III fragments (which are resistant to processive degradation), whereas fragments with DNaseI cut ends will be efficiently eliminated. The residual remaining population of DNaseI cut site-depleted DNA is then heavily biotinylated. An excess of this population is mixed with the DNaseI cut site-enriched population, and the sample is denatured and is slowly reannealed. Nonbiotinylated fragments generated by repeated DNaseI cleavage events at or around the same genomic coordinate (i.e., a hypersensitive site) will be more likely to self-anneal than find a partner in the DNaseI cut site-depleted population. Sites that have only been cut once (i.e., due to non-HS-specific cutting or to genomic shear) will form heteroduplexes. Extraction of the mixture with paramagnetic beads isolates the nonbiotinylated homoduplexes that are now further enriched in DNaseI hypersensitive sites. This population is PCR-amplified and cloned to make the genomic ACS libraries.
    Streptavidin Coated Dynal Myone Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin coated dynal myone beads/product/Thermo Fisher
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    streptavidin coated dynal myone beads - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    90
    Thermo Fisher streptavidin coated m280 dyna beads
    Cloning of active chromatin sequences. We developed a strategy to create genomic DNA libraries containing sequences flanking DNaseI cut sites introduced into nuclear chromatin under limiting (hypersensitive) conditions. After DNA purification, free DNA ends are enzymatically repaired and ligated to a biotinylated linker adaptor. The DNA sample is then fragmented further with a four-cutter enzyme ( Nla III). At this stage, the genome has been partitioned into two predominant fragment populations: Nla III– Nla III fragments (derived from the non-DNaseI cut background) and Nla III-adaptor fragments (carrying for DNaseI cut sites). Adapted DNA is efficiently isolated on paramagnetic <t>streptavidin-coated</t> beads, whereas Nla III– Nla III background fragments are cleansed. A second linker adaptor is then appended to the Nla III end of captured DNA, and the product is released from the beads. This DNaseI cut site-enriched population is enriched and is retained for the subsequent subtraction step. A DNaseI cut site-depleted population is prepared by further fragmenting DNaseI-treated genomic DNA with a four-cutter that leaves a 3′ overhang (e.g., Nla III). Further digestion of this sample with Exonuclease III followed by mung bean nuclease will preserve the Nla III– Nla III fragments (which are resistant to processive degradation), whereas fragments with DNaseI cut ends will be efficiently eliminated. The residual remaining population of DNaseI cut site-depleted DNA is then heavily biotinylated. An excess of this population is mixed with the DNaseI cut site-enriched population, and the sample is denatured and is slowly reannealed. Nonbiotinylated fragments generated by repeated DNaseI cleavage events at or around the same genomic coordinate (i.e., a hypersensitive site) will be more likely to self-anneal than find a partner in the DNaseI cut site-depleted population. Sites that have only been cut once (i.e., due to non-HS-specific cutting or to genomic shear) will form heteroduplexes. Extraction of the mixture with paramagnetic beads isolates the nonbiotinylated homoduplexes that are now further enriched in DNaseI hypersensitive sites. This population is PCR-amplified and cloned to make the genomic ACS libraries.
    Streptavidin Coated M280 Dyna Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin coated m280 dyna beads/product/Thermo Fisher
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    streptavidin coated m280 dyna beads - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    91
    Thermo Fisher streptavidin coated dynal magnetic beads
    Schematic representation of the HSAM assay based on self-assembly of <t>DNA-streptavidin</t> nanoparticles. (a) Bis-biotinylated DNA detection probes (2B-DNA) and poly-streptavidin (Poly-STV) form a nanoparticle. (b) The biotinylated capture probe was immobilized onto streptavidin-coated <t>Dynal</t> magnetic beads because of the high-affinity interaction of biotin with streptavidin. (c) IS 6110 was selected as a target site for detection. It is specifically recognized by the capture probe and detection probe. (d) The remaining free biotin binding sites of the surface-bound STV on the beads were blocked with d-Biotin, represented by shaded spheres. (e) The 2B-DNA hybridized to target, and immobilized the nanoparticles to the beads. (f)The reporter molecule (biotinylated-FITC) binds to the nanoparticle. (g)The results of the HSAM assay were obtained using fluorescent microscopy.
    Streptavidin Coated Dynal Magnetic Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 420 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin coated dynal magnetic beads/product/Thermo Fisher
    Average 91 stars, based on 420 article reviews
    Price from $9.99 to $1999.99
    streptavidin coated dynal magnetic beads - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    90
    Thermo Fisher dynal m270 streptavidin magnetic beads
    Schematic representation of the HSAM assay based on self-assembly of <t>DNA-streptavidin</t> nanoparticles. (a) Bis-biotinylated DNA detection probes (2B-DNA) and poly-streptavidin (Poly-STV) form a nanoparticle. (b) The biotinylated capture probe was immobilized onto streptavidin-coated <t>Dynal</t> magnetic beads because of the high-affinity interaction of biotin with streptavidin. (c) IS 6110 was selected as a target site for detection. It is specifically recognized by the capture probe and detection probe. (d) The remaining free biotin binding sites of the surface-bound STV on the beads were blocked with d-Biotin, represented by shaded spheres. (e) The 2B-DNA hybridized to target, and immobilized the nanoparticles to the beads. (f)The reporter molecule (biotinylated-FITC) binds to the nanoparticle. (g)The results of the HSAM assay were obtained using fluorescent microscopy.
    Dynal M270 Streptavidin Magnetic Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dynal m270 streptavidin magnetic beads/product/Thermo Fisher
    Average 90 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    dynal m270 streptavidin magnetic beads - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    85
    Thermo Fisher 109 dynal myone t1 streptavidin beads
    Schematic representation of the HSAM assay based on self-assembly of <t>DNA-streptavidin</t> nanoparticles. (a) Bis-biotinylated DNA detection probes (2B-DNA) and poly-streptavidin (Poly-STV) form a nanoparticle. (b) The biotinylated capture probe was immobilized onto streptavidin-coated <t>Dynal</t> magnetic beads because of the high-affinity interaction of biotin with streptavidin. (c) IS 6110 was selected as a target site for detection. It is specifically recognized by the capture probe and detection probe. (d) The remaining free biotin binding sites of the surface-bound STV on the beads were blocked with d-Biotin, represented by shaded spheres. (e) The 2B-DNA hybridized to target, and immobilized the nanoparticles to the beads. (f)The reporter molecule (biotinylated-FITC) binds to the nanoparticle. (g)The results of the HSAM assay were obtained using fluorescent microscopy.
    109 Dynal Myone T1 Streptavidin Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/109 dynal myone t1 streptavidin beads/product/Thermo Fisher
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    109 dynal myone t1 streptavidin beads - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    91
    Thermo Fisher m 270 dynal paramagnetic streptavidin beads
    Schematic representation of the HSAM assay based on self-assembly of <t>DNA-streptavidin</t> nanoparticles. (a) Bis-biotinylated DNA detection probes (2B-DNA) and poly-streptavidin (Poly-STV) form a nanoparticle. (b) The biotinylated capture probe was immobilized onto streptavidin-coated <t>Dynal</t> magnetic beads because of the high-affinity interaction of biotin with streptavidin. (c) IS 6110 was selected as a target site for detection. It is specifically recognized by the capture probe and detection probe. (d) The remaining free biotin binding sites of the surface-bound STV on the beads were blocked with d-Biotin, represented by shaded spheres. (e) The 2B-DNA hybridized to target, and immobilized the nanoparticles to the beads. (f)The reporter molecule (biotinylated-FITC) binds to the nanoparticle. (g)The results of the HSAM assay were obtained using fluorescent microscopy.
    M 270 Dynal Paramagnetic Streptavidin Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m 270 dynal paramagnetic streptavidin beads/product/Thermo Fisher
    Average 91 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    m 270 dynal paramagnetic streptavidin beads - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    81
    Thermo Fisher magnetic m280 streptavidin dynal beads
    Schematic representation of the HSAM assay based on self-assembly of <t>DNA-streptavidin</t> nanoparticles. (a) Bis-biotinylated DNA detection probes (2B-DNA) and poly-streptavidin (Poly-STV) form a nanoparticle. (b) The biotinylated capture probe was immobilized onto streptavidin-coated <t>Dynal</t> magnetic beads because of the high-affinity interaction of biotin with streptavidin. (c) IS 6110 was selected as a target site for detection. It is specifically recognized by the capture probe and detection probe. (d) The remaining free biotin binding sites of the surface-bound STV on the beads were blocked with d-Biotin, represented by shaded spheres. (e) The 2B-DNA hybridized to target, and immobilized the nanoparticles to the beads. (f)The reporter molecule (biotinylated-FITC) binds to the nanoparticle. (g)The results of the HSAM assay were obtained using fluorescent microscopy.
    Magnetic M280 Streptavidin Dynal Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 81/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/magnetic m280 streptavidin dynal beads/product/Thermo Fisher
    Average 81 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    magnetic m280 streptavidin dynal beads - by Bioz Stars, 2020-04
    81/100 stars
      Buy from Supplier

    99
    Thermo Fisher magnetic dyna beads
    Schematic representation of GEP-DEAN. ( a ) Outline of the assay procedures. ( b ) Structure of molecular translation table (MTT) that connects the target cDNA with a target specific sequence TSS i to the corresponding two-digit DNA-coded number DCN j composed of the common start digit (SD), the first digit D1 j 1 , the second digit D2 j 2 and the common end digit (ED). ( c ) Encoding step. The encoding reaction for the target cDNA strands with TSS i starts with ligation of 5′-MTT i , j and 3′-MTT i , j strands that hybridize adjacently with TSS i . After ligation of the MTT strands, the reaction mixture is subjected to incubation at high temperature and a subsequent quick cooling to dissociate the target cDNA strands and to make 3′-biotinylated cCS (cCS-b) hybridize. The ligation products with cCS-b bound are captured by <t>streptavidin-coupled</t> magnetic beads (SA-beads) and then excess free MTT strands and the dissociated target cDNA strands are washed out. After elution of the ligation products, a primer pair of 5′-b-CS and cED strands is added to the reaction mixture and the ligation products are amplified by PCR to further remove the free 3′-MTT strands. The amplified ligation products are then captured by SA-beads and converted to single strands by alkali wash. ( d ) Amplification step. The DCN region of the single-stranded ligation products is amplified by PCR with a primer pair of 5′-biotinylated SD and cED. The amplified products are then captured by SA-beads and converted to single strands by alkali wash. ( e ) Decoding step. The two-digit DCNs are decoded with respect to the second digit (D2). The solution of the single-stranded amplified products of the sample and that of the reference are divided into N D2 tubes. To the j 2-th tube, a fluorescence-labeled (Cy5- and Cy3-labeled for sample and reference, respectively) cD2 j 2 strand and the mixture of all cD1 strands are added. When a DCN j strand corresponding to the target cDNA with TSS i is present, a cD2 j 2 and a cD1 j 1 strand are joined together by DCN-templated ligation to produce a decoding product cD2 j 2 –cD1 j 1 . The decoding products of the sample and reference are thus labeled with different fluorescence colors. ( f ) Quantification step. The decoding products of the sample and those of the reference in the j 2-th tube are competitively hybridized in the j 2-th capillary of a DNA capillary array (DCA), which is a kind of DNA microarray composed of an array of capillaries with DNA probes immobilized on their inner surface. All capillaries have a common set of DNA probes D1 j 1 ( j 1 = 0, 1, 2 , … , N D1 − 1). The absolute amount of the target cDNA with TSS i is obtained from the Cy5/Cy3 fluorescence intensity ratio measured for a spot of D1 j 1 probe in the j 2-th capillary.
    Magnetic Dyna Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 281 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/magnetic dyna beads/product/Thermo Fisher
    Average 99 stars, based on 281 article reviews
    Price from $9.99 to $1999.99
    magnetic dyna beads - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher dyna myone streptavidin t1 magnetic beads
    Schematic representation of GEP-DEAN. ( a ) Outline of the assay procedures. ( b ) Structure of molecular translation table (MTT) that connects the target cDNA with a target specific sequence TSS i to the corresponding two-digit DNA-coded number DCN j composed of the common start digit (SD), the first digit D1 j 1 , the second digit D2 j 2 and the common end digit (ED). ( c ) Encoding step. The encoding reaction for the target cDNA strands with TSS i starts with ligation of 5′-MTT i , j and 3′-MTT i , j strands that hybridize adjacently with TSS i . After ligation of the MTT strands, the reaction mixture is subjected to incubation at high temperature and a subsequent quick cooling to dissociate the target cDNA strands and to make 3′-biotinylated cCS (cCS-b) hybridize. The ligation products with cCS-b bound are captured by <t>streptavidin-coupled</t> magnetic beads (SA-beads) and then excess free MTT strands and the dissociated target cDNA strands are washed out. After elution of the ligation products, a primer pair of 5′-b-CS and cED strands is added to the reaction mixture and the ligation products are amplified by PCR to further remove the free 3′-MTT strands. The amplified ligation products are then captured by SA-beads and converted to single strands by alkali wash. ( d ) Amplification step. The DCN region of the single-stranded ligation products is amplified by PCR with a primer pair of 5′-biotinylated SD and cED. The amplified products are then captured by SA-beads and converted to single strands by alkali wash. ( e ) Decoding step. The two-digit DCNs are decoded with respect to the second digit (D2). The solution of the single-stranded amplified products of the sample and that of the reference are divided into N D2 tubes. To the j 2-th tube, a fluorescence-labeled (Cy5- and Cy3-labeled for sample and reference, respectively) cD2 j 2 strand and the mixture of all cD1 strands are added. When a DCN j strand corresponding to the target cDNA with TSS i is present, a cD2 j 2 and a cD1 j 1 strand are joined together by DCN-templated ligation to produce a decoding product cD2 j 2 –cD1 j 1 . The decoding products of the sample and reference are thus labeled with different fluorescence colors. ( f ) Quantification step. The decoding products of the sample and those of the reference in the j 2-th tube are competitively hybridized in the j 2-th capillary of a DNA capillary array (DCA), which is a kind of DNA microarray composed of an array of capillaries with DNA probes immobilized on their inner surface. All capillaries have a common set of DNA probes D1 j 1 ( j 1 = 0, 1, 2 , … , N D1 − 1). The absolute amount of the target cDNA with TSS i is obtained from the Cy5/Cy3 fluorescence intensity ratio measured for a spot of D1 j 1 probe in the j 2-th capillary.
    Dyna Myone Streptavidin T1 Magnetic Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 136 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dyna myone streptavidin t1 magnetic beads/product/Thermo Fisher
    Average 90 stars, based on 136 article reviews
    Price from $9.99 to $1999.99
    dyna myone streptavidin t1 magnetic beads - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher streptavidin conjugated magnetic beads
    L-selectin–deficient mice have an intact antigen presentation pathway. ( A ) Epidermal whole mounts from L-selectin–deficient mice show normal numbers and distribution of LC. Whole mounts of abdominal skin were prepared and stained with anti-I-A b ( 41 ). I-A + cells were counted in 30 fields/slide (field = 0.1 mm 2 ), and calculated as the average of cells/mm 2 over two slides. ( B ) LC are present in L-selectin–deficient mice and drain to PLN following skin painting with FITC. Mice were sensitized with FITC and 24 h later PLN and spleens were collected and centrifuged over metrizamide gradients ( 18 ). Cells at the interface were collected and stained with biotinylated anti– mouse I-A followed by <t>streptavidin-PE</t> and analyzed by twocolor FACS ® analysis to detect the presence of draining I-A + / FITC + LC. One of six representative experiments is shown. ( C ) LC from L-selectin–deficient mice can initiate allogeneic responses. LC collected from PLN of FITC-painted wild-type ( squares ) or L-selectin–deficient mice ( triangles ) were irradiated and incubated for 48 h with 2 × 10 5 T cells from either BALB/c (allogeneic; open squares and triangles ) or C57BL/6J (syngeneic; closed squares and triangles ) mice. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting. ( D ) LC can initiate antigen-specific responses. Irradiated PLN cells were used as APCs from wild-type or L-selectin–deficient mice, and were either pulsed with or without DNBS. These cells were incubated for 48 h with increasing concentrations of PLN T cells isolated from wild-type mice sensitized with DNFB 5 d before. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting.
    Streptavidin Conjugated Magnetic Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 875 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin conjugated magnetic beads/product/Thermo Fisher
    Average 90 stars, based on 875 article reviews
    Price from $9.99 to $1999.99
    streptavidin conjugated magnetic beads - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    88
    Thermo Fisher streptavidin coated dynal magnetic bead
    L-selectin–deficient mice have an intact antigen presentation pathway. ( A ) Epidermal whole mounts from L-selectin–deficient mice show normal numbers and distribution of LC. Whole mounts of abdominal skin were prepared and stained with anti-I-A b ( 41 ). I-A + cells were counted in 30 fields/slide (field = 0.1 mm 2 ), and calculated as the average of cells/mm 2 over two slides. ( B ) LC are present in L-selectin–deficient mice and drain to PLN following skin painting with FITC. Mice were sensitized with FITC and 24 h later PLN and spleens were collected and centrifuged over metrizamide gradients ( 18 ). Cells at the interface were collected and stained with biotinylated anti– mouse I-A followed by <t>streptavidin-PE</t> and analyzed by twocolor FACS ® analysis to detect the presence of draining I-A + / FITC + LC. One of six representative experiments is shown. ( C ) LC from L-selectin–deficient mice can initiate allogeneic responses. LC collected from PLN of FITC-painted wild-type ( squares ) or L-selectin–deficient mice ( triangles ) were irradiated and incubated for 48 h with 2 × 10 5 T cells from either BALB/c (allogeneic; open squares and triangles ) or C57BL/6J (syngeneic; closed squares and triangles ) mice. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting. ( D ) LC can initiate antigen-specific responses. Irradiated PLN cells were used as APCs from wild-type or L-selectin–deficient mice, and were either pulsed with or without DNBS. These cells were incubated for 48 h with increasing concentrations of PLN T cells isolated from wild-type mice sensitized with DNFB 5 d before. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting.
    Streptavidin Coated Dynal Magnetic Bead, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin coated dynal magnetic bead/product/Thermo Fisher
    Average 88 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    streptavidin coated dynal magnetic bead - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    99
    Thermo Fisher streptavidin conjugated magnetic beads 2
    L-selectin–deficient mice have an intact antigen presentation pathway. ( A ) Epidermal whole mounts from L-selectin–deficient mice show normal numbers and distribution of LC. Whole mounts of abdominal skin were prepared and stained with anti-I-A b ( 41 ). I-A + cells were counted in 30 fields/slide (field = 0.1 mm 2 ), and calculated as the average of cells/mm 2 over two slides. ( B ) LC are present in L-selectin–deficient mice and drain to PLN following skin painting with FITC. Mice were sensitized with FITC and 24 h later PLN and spleens were collected and centrifuged over metrizamide gradients ( 18 ). Cells at the interface were collected and stained with biotinylated anti– mouse I-A followed by <t>streptavidin-PE</t> and analyzed by twocolor FACS ® analysis to detect the presence of draining I-A + / FITC + LC. One of six representative experiments is shown. ( C ) LC from L-selectin–deficient mice can initiate allogeneic responses. LC collected from PLN of FITC-painted wild-type ( squares ) or L-selectin–deficient mice ( triangles ) were irradiated and incubated for 48 h with 2 × 10 5 T cells from either BALB/c (allogeneic; open squares and triangles ) or C57BL/6J (syngeneic; closed squares and triangles ) mice. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting. ( D ) LC can initiate antigen-specific responses. Irradiated PLN cells were used as APCs from wild-type or L-selectin–deficient mice, and were either pulsed with or without DNBS. These cells were incubated for 48 h with increasing concentrations of PLN T cells isolated from wild-type mice sensitized with DNFB 5 d before. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting.
    Streptavidin Conjugated Magnetic Beads 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin conjugated magnetic beads 2/product/Thermo Fisher
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    streptavidin conjugated magnetic beads 2 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher dynabeads streptavidin
    L-selectin–deficient mice have an intact antigen presentation pathway. ( A ) Epidermal whole mounts from L-selectin–deficient mice show normal numbers and distribution of LC. Whole mounts of abdominal skin were prepared and stained with anti-I-A b ( 41 ). I-A + cells were counted in 30 fields/slide (field = 0.1 mm 2 ), and calculated as the average of cells/mm 2 over two slides. ( B ) LC are present in L-selectin–deficient mice and drain to PLN following skin painting with FITC. Mice were sensitized with FITC and 24 h later PLN and spleens were collected and centrifuged over metrizamide gradients ( 18 ). Cells at the interface were collected and stained with biotinylated anti– mouse I-A followed by <t>streptavidin-PE</t> and analyzed by twocolor FACS ® analysis to detect the presence of draining I-A + / FITC + LC. One of six representative experiments is shown. ( C ) LC from L-selectin–deficient mice can initiate allogeneic responses. LC collected from PLN of FITC-painted wild-type ( squares ) or L-selectin–deficient mice ( triangles ) were irradiated and incubated for 48 h with 2 × 10 5 T cells from either BALB/c (allogeneic; open squares and triangles ) or C57BL/6J (syngeneic; closed squares and triangles ) mice. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting. ( D ) LC can initiate antigen-specific responses. Irradiated PLN cells were used as APCs from wild-type or L-selectin–deficient mice, and were either pulsed with or without DNBS. These cells were incubated for 48 h with increasing concentrations of PLN T cells isolated from wild-type mice sensitized with DNFB 5 d before. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting.
    Dynabeads Streptavidin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 159 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dynabeads streptavidin/product/Thermo Fisher
    Average 99 stars, based on 159 article reviews
    Price from $9.99 to $1999.99
    dynabeads streptavidin - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    Thermo Fisher streptavidin coated magnetic t1 dynal beads
    L-selectin–deficient mice have an intact antigen presentation pathway. ( A ) Epidermal whole mounts from L-selectin–deficient mice show normal numbers and distribution of LC. Whole mounts of abdominal skin were prepared and stained with anti-I-A b ( 41 ). I-A + cells were counted in 30 fields/slide (field = 0.1 mm 2 ), and calculated as the average of cells/mm 2 over two slides. ( B ) LC are present in L-selectin–deficient mice and drain to PLN following skin painting with FITC. Mice were sensitized with FITC and 24 h later PLN and spleens were collected and centrifuged over metrizamide gradients ( 18 ). Cells at the interface were collected and stained with biotinylated anti– mouse I-A followed by <t>streptavidin-PE</t> and analyzed by twocolor FACS ® analysis to detect the presence of draining I-A + / FITC + LC. One of six representative experiments is shown. ( C ) LC from L-selectin–deficient mice can initiate allogeneic responses. LC collected from PLN of FITC-painted wild-type ( squares ) or L-selectin–deficient mice ( triangles ) were irradiated and incubated for 48 h with 2 × 10 5 T cells from either BALB/c (allogeneic; open squares and triangles ) or C57BL/6J (syngeneic; closed squares and triangles ) mice. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting. ( D ) LC can initiate antigen-specific responses. Irradiated PLN cells were used as APCs from wild-type or L-selectin–deficient mice, and were either pulsed with or without DNBS. These cells were incubated for 48 h with increasing concentrations of PLN T cells isolated from wild-type mice sensitized with DNFB 5 d before. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting.
    Streptavidin Coated Magnetic T1 Dynal Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin coated magnetic t1 dynal beads/product/Thermo Fisher
    Average 86 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    streptavidin coated magnetic t1 dynal beads - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher streptavidin labeled dynal magnetic beads
    L-selectin–deficient mice have an intact antigen presentation pathway. ( A ) Epidermal whole mounts from L-selectin–deficient mice show normal numbers and distribution of LC. Whole mounts of abdominal skin were prepared and stained with anti-I-A b ( 41 ). I-A + cells were counted in 30 fields/slide (field = 0.1 mm 2 ), and calculated as the average of cells/mm 2 over two slides. ( B ) LC are present in L-selectin–deficient mice and drain to PLN following skin painting with FITC. Mice were sensitized with FITC and 24 h later PLN and spleens were collected and centrifuged over metrizamide gradients ( 18 ). Cells at the interface were collected and stained with biotinylated anti– mouse I-A followed by <t>streptavidin-PE</t> and analyzed by twocolor FACS ® analysis to detect the presence of draining I-A + / FITC + LC. One of six representative experiments is shown. ( C ) LC from L-selectin–deficient mice can initiate allogeneic responses. LC collected from PLN of FITC-painted wild-type ( squares ) or L-selectin–deficient mice ( triangles ) were irradiated and incubated for 48 h with 2 × 10 5 T cells from either BALB/c (allogeneic; open squares and triangles ) or C57BL/6J (syngeneic; closed squares and triangles ) mice. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting. ( D ) LC can initiate antigen-specific responses. Irradiated PLN cells were used as APCs from wild-type or L-selectin–deficient mice, and were either pulsed with or without DNBS. These cells were incubated for 48 h with increasing concentrations of PLN T cells isolated from wild-type mice sensitized with DNFB 5 d before. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting.
    Streptavidin Labeled Dynal Magnetic Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin labeled dynal magnetic beads/product/Thermo Fisher
    Average 86 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    streptavidin labeled dynal magnetic beads - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    99
    Thermo Fisher dynabeads m270 streptavidin
    L-selectin–deficient mice have an intact antigen presentation pathway. ( A ) Epidermal whole mounts from L-selectin–deficient mice show normal numbers and distribution of LC. Whole mounts of abdominal skin were prepared and stained with anti-I-A b ( 41 ). I-A + cells were counted in 30 fields/slide (field = 0.1 mm 2 ), and calculated as the average of cells/mm 2 over two slides. ( B ) LC are present in L-selectin–deficient mice and drain to PLN following skin painting with FITC. Mice were sensitized with FITC and 24 h later PLN and spleens were collected and centrifuged over metrizamide gradients ( 18 ). Cells at the interface were collected and stained with biotinylated anti– mouse I-A followed by <t>streptavidin-PE</t> and analyzed by twocolor FACS ® analysis to detect the presence of draining I-A + / FITC + LC. One of six representative experiments is shown. ( C ) LC from L-selectin–deficient mice can initiate allogeneic responses. LC collected from PLN of FITC-painted wild-type ( squares ) or L-selectin–deficient mice ( triangles ) were irradiated and incubated for 48 h with 2 × 10 5 T cells from either BALB/c (allogeneic; open squares and triangles ) or C57BL/6J (syngeneic; closed squares and triangles ) mice. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting. ( D ) LC can initiate antigen-specific responses. Irradiated PLN cells were used as APCs from wild-type or L-selectin–deficient mice, and were either pulsed with or without DNBS. These cells were incubated for 48 h with increasing concentrations of PLN T cells isolated from wild-type mice sensitized with DNFB 5 d before. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting.
    Dynabeads M270 Streptavidin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dynabeads m270 streptavidin/product/Thermo Fisher
    Average 99 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    dynabeads m270 streptavidin - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    Thermo Fisher myone dynal streptavidine beads t1
    L-selectin–deficient mice have an intact antigen presentation pathway. ( A ) Epidermal whole mounts from L-selectin–deficient mice show normal numbers and distribution of LC. Whole mounts of abdominal skin were prepared and stained with anti-I-A b ( 41 ). I-A + cells were counted in 30 fields/slide (field = 0.1 mm 2 ), and calculated as the average of cells/mm 2 over two slides. ( B ) LC are present in L-selectin–deficient mice and drain to PLN following skin painting with FITC. Mice were sensitized with FITC and 24 h later PLN and spleens were collected and centrifuged over metrizamide gradients ( 18 ). Cells at the interface were collected and stained with biotinylated anti– mouse I-A followed by <t>streptavidin-PE</t> and analyzed by twocolor FACS ® analysis to detect the presence of draining I-A + / FITC + LC. One of six representative experiments is shown. ( C ) LC from L-selectin–deficient mice can initiate allogeneic responses. LC collected from PLN of FITC-painted wild-type ( squares ) or L-selectin–deficient mice ( triangles ) were irradiated and incubated for 48 h with 2 × 10 5 T cells from either BALB/c (allogeneic; open squares and triangles ) or C57BL/6J (syngeneic; closed squares and triangles ) mice. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting. ( D ) LC can initiate antigen-specific responses. Irradiated PLN cells were used as APCs from wild-type or L-selectin–deficient mice, and were either pulsed with or without DNBS. These cells were incubated for 48 h with increasing concentrations of PLN T cells isolated from wild-type mice sensitized with DNFB 5 d before. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting.
    Myone Dynal Streptavidine Beads T1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/myone dynal streptavidine beads t1/product/Thermo Fisher
    Average 86 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    myone dynal streptavidine beads t1 - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    99
    Thermo Fisher fluorochrome conjugated streptavidin
    L-selectin–deficient mice have an intact antigen presentation pathway. ( A ) Epidermal whole mounts from L-selectin–deficient mice show normal numbers and distribution of LC. Whole mounts of abdominal skin were prepared and stained with anti-I-A b ( 41 ). I-A + cells were counted in 30 fields/slide (field = 0.1 mm 2 ), and calculated as the average of cells/mm 2 over two slides. ( B ) LC are present in L-selectin–deficient mice and drain to PLN following skin painting with FITC. Mice were sensitized with FITC and 24 h later PLN and spleens were collected and centrifuged over metrizamide gradients ( 18 ). Cells at the interface were collected and stained with biotinylated anti– mouse I-A followed by <t>streptavidin-PE</t> and analyzed by twocolor FACS ® analysis to detect the presence of draining I-A + / FITC + LC. One of six representative experiments is shown. ( C ) LC from L-selectin–deficient mice can initiate allogeneic responses. LC collected from PLN of FITC-painted wild-type ( squares ) or L-selectin–deficient mice ( triangles ) were irradiated and incubated for 48 h with 2 × 10 5 T cells from either BALB/c (allogeneic; open squares and triangles ) or C57BL/6J (syngeneic; closed squares and triangles ) mice. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting. ( D ) LC can initiate antigen-specific responses. Irradiated PLN cells were used as APCs from wild-type or L-selectin–deficient mice, and were either pulsed with or without DNBS. These cells were incubated for 48 h with increasing concentrations of PLN T cells isolated from wild-type mice sensitized with DNFB 5 d before. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting.
    Fluorochrome Conjugated Streptavidin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorochrome conjugated streptavidin/product/Thermo Fisher
    Average 99 stars, based on 134 article reviews
    Price from $9.99 to $1999.99
    fluorochrome conjugated streptavidin - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Schematic of ELISA assay to determine efficiency of capturing PSA, detection antibody, and streptavidin. Row 1, ELISA assay of sample with known concentration of biotin-labeled PSA. Row 2, ELISA assay of supernatant from row 1 assay. Reduction in ELISA

    Journal: Biosensors & bioelectronics

    Article Title: TETHERED-BEAD, IMMUNE SANDWICH ASSAY

    doi: 10.1016/j.bios.2014.07.011

    Figure Lengend Snippet: Schematic of ELISA assay to determine efficiency of capturing PSA, detection antibody, and streptavidin. Row 1, ELISA assay of sample with known concentration of biotin-labeled PSA. Row 2, ELISA assay of supernatant from row 1 assay. Reduction in ELISA

    Article Snippet: In our system, 2.8μm beads completely coated with streptavidin (~106 molecules/bead, Dynal, M280 beads) formed tethers with DNAs on flow cell surfaces without noticeable delay upon settling to the surface (i.e. ≤ minutes), which sets an upper limit to delay from this phenomenon of several hours.

    Techniques: Enzyme-linked Immunosorbent Assay, Concentration Assay, Labeling

    3.3 Efficiency of bead capture of PSA, detection antibody, and streptavidin

    Journal: Biosensors & bioelectronics

    Article Title: TETHERED-BEAD, IMMUNE SANDWICH ASSAY

    doi: 10.1016/j.bios.2014.07.011

    Figure Lengend Snippet: 3.3 Efficiency of bead capture of PSA, detection antibody, and streptavidin

    Article Snippet: In our system, 2.8μm beads completely coated with streptavidin (~106 molecules/bead, Dynal, M280 beads) formed tethers with DNAs on flow cell surfaces without noticeable delay upon settling to the surface (i.e. ≤ minutes), which sets an upper limit to delay from this phenomenon of several hours.

    Techniques:

    Flow chart of DNase-seq protocol. Briefly, cells are lysed with detergent to release nuclei, and the nuclei are digested with optimal concentrations of DNase I. DNase I digested DNA is embedded in low-melt gel agarose plugs to reduce additional random shearing. DNA (while still in the plugs) are then blunt-ended, extracted and ligated to biotinylated linker 1 (represented by red bars in the figure). Excess linker is removed by gel purification, and biotinylated fragments (Linker 1 plus 20 bases of genomic DNA) are digested with MmeI, and captured by streptavidin-coated Dynal beads (represented by brown balls). Linker 2 (represented by the blue bars) is ligated to the 2 base overhang generated by MmeI, and the ditagged 20 bp DNAs are amplified by PCR and sequenced by Illumina/Solexa.

    Journal: Cold Spring Harbor protocols

    Article Title: DNase-seq: a high-resolution technique for mapping active gene regulatory elements across the genome from mammalian cells

    doi: 10.1101/pdb.prot5384

    Figure Lengend Snippet: Flow chart of DNase-seq protocol. Briefly, cells are lysed with detergent to release nuclei, and the nuclei are digested with optimal concentrations of DNase I. DNase I digested DNA is embedded in low-melt gel agarose plugs to reduce additional random shearing. DNA (while still in the plugs) are then blunt-ended, extracted and ligated to biotinylated linker 1 (represented by red bars in the figure). Excess linker is removed by gel purification, and biotinylated fragments (Linker 1 plus 20 bases of genomic DNA) are digested with MmeI, and captured by streptavidin-coated Dynal beads (represented by brown balls). Linker 2 (represented by the blue bars) is ligated to the 2 base overhang generated by MmeI, and the ditagged 20 bp DNAs are amplified by PCR and sequenced by Illumina/Solexa.

    Article Snippet: Baker) DNA ladder (25 bp) (Invitrogen) DNA Polymerase Buffer (1X; 10 mM Tris-Cl, pH 8.0, 50 mM NaCl, 10 mM MgCl2 , 1 mM dithiothreitol) DNase I recombinant, RNase free (10 U/μL) and incubation Buffer (10X) (Roche Diagnostics) dNTP, 10 mM (Roche Diagnostics) Dynal Streptavidin beads (Invitrogen Dynal M-280) EDTA (50 mM, pH 8.0) Ethanol (70% and 100%) Ethidium bromide(10 mg/ml) Glycogen (20 mg/mL) (Roche Diagnostics) InCert low melt agarose (1%, melted in sterile 50 mM EDTA pH 8.0 and stored at 4 °C) (Lonza) LIDS Buffer (10 mM Tris-Cl, pH 8.0,1% Lauryl sulfate lithium salt (Sigma), 100 mM EDTA) MmeI (2 U/μL, New England Biolabs) NaOAc (3 M, pH 5.3) NaOH (0.15 M) NEB Buffer 2 (10X; New England Biolabs) NEB Buffer 4 (10X; New England Biolabs) Igepal CA-630 (Sigma) Phenol (Invitrogen) Phenol: chloroform: Isoamyl Alcohol (25:24:1, Invitrogen) Phosphatase alkaline, shrimp (SAP; 1 U/μL, Roche Diagnostics) Phosphate Buffered Saline without Mg2+ /Ca2+ (1X, pH 7.2, GIBCO) Phusion DNA Polymerase (2 U/μL, Finnzymes) and Phusion HF reaction Buffer (5X) RSB Buffer (10 mM Tris-Cl, pH 7.4, 10 mM NaCl, 3 mM MgCl2 ) S-adenosylmethionine (SAM; 500 μM, New England Biolabs) Spin-X filter (Fisher) T4 DNA Polymerase (New England Biolabs) TBE buffer (0.5X; 40 mM Tris-Cl, pH 8.3, 45 mM Boric Acid, 1 mM EDTA) TE Buffer (1X; 10 mM Tris-Cl, pH 8.0, 1 mM EDTA) Tris-HCl buffer (1X, pH8.0) T4 Ligase (5 U/μL) and ligation buffer (10X) (Roche Diagnostics) Trypan blue (Gibco) Ultrapure™ Agarose (Invitrogen) Ultrapure™ L.M.P.

    Techniques: Flow Cytometry, Gel Purification, Generated, Amplification, Polymerase Chain Reaction

    Fig. 9. The transport of endocytosed dextran from early to late endosomes is inhibited in Hrs-overexpressing cells. HEp-2 cells were transfected with myc-tagged Hrs for 6 h and incubated with biotin–dextran for 1 h at 37°C ( A ). The cells were washed and incubated further for 3 h ( B ). ( C ) A non-transfected cell incubated with biotin–dextran for 1 h at 37°C. ( D ) A non-transfected cell after 3 h of chase. The cells were stained with anti-myc (left panels A and B), anti-Hrs (left panels C and D) or streptavidin–Cy3 (middle panels) and studied by confocal fluorescence microscopy. The right panels show the merged images, with yellow indicating co-localization. Bar, 5 µm.

    Journal: The EMBO Journal

    Article Title: Hrs recruits clathrin to early endosomes

    doi: 10.1093/emboj/20.17.5008

    Figure Lengend Snippet: Fig. 9. The transport of endocytosed dextran from early to late endosomes is inhibited in Hrs-overexpressing cells. HEp-2 cells were transfected with myc-tagged Hrs for 6 h and incubated with biotin–dextran for 1 h at 37°C ( A ). The cells were washed and incubated further for 3 h ( B ). ( C ) A non-transfected cell incubated with biotin–dextran for 1 h at 37°C. ( D ) A non-transfected cell after 3 h of chase. The cells were stained with anti-myc (left panels A and B), anti-Hrs (left panels C and D) or streptavidin–Cy3 (middle panels) and studied by confocal fluorescence microscopy. The right panels show the merged images, with yellow indicating co-localization. Bar, 5 µm.

    Article Snippet: Only Tf that is Ru-tag-labelled and still biotinylated is detected in the cell lysate using streptavidin beads (Dynal, Oslo, Norway) and the ORIGEN analyser.

    Techniques: Transfection, Incubation, Staining, Fluorescence, Microscopy

    Recruitment of the transcription machinery into the PIC. (A) Complexes were assembled on M280-streptavidin Dynabeads carrying a biotinylated DNA fragment from the plasmid pA4xMLΔ53, which contained four copies of the HNF-4 cognate site A and the adenovirus major late core promoter. After PIC formation, beads were washed and bound complexes were analyzed for their factor content by immunoblotting. PICs were formed with GTFs only (TBP, TFIIB, TFIIE, TFIIF, TFIIH, Pol II (lane 3); with GTFs and HNF-4 (lane 4); or with GTFs, HNF-4, and PC4 (lanes 2 and 5). Lane 2, control in which the indicated factors were incubated with beads only (no template DNA); lane 1, GTFs only (input). (B) Immobilized-template recruitment assays are as for panel A, except that all reaction mixtures contained TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, Pol II, and TRAP/SMCC/Mediator, as shown in input lane 1. HNF-4 (lanes 3 and 5) and PC4 (lanes 4 and 5) were additionally added as indicated. (C) Immobilized-template recruitment assays are as for panel B, except that reaction mixtures in lanes 6 and 7 did not contain TFIID. HNF-4 (lanes 3, 5, and 7) and PC4 (lanes 4 to 7) were additionally added as indicated.

    Journal: Molecular and Cellular Biology

    Article Title: TRAP/SMCC/Mediator-Dependent Transcriptional Activation from DNA and Chromatin Templates by Orphan Nuclear Receptor Hepatocyte Nuclear Factor 4

    doi: 10.1128/MCB.22.15.5626-5637.2002

    Figure Lengend Snippet: Recruitment of the transcription machinery into the PIC. (A) Complexes were assembled on M280-streptavidin Dynabeads carrying a biotinylated DNA fragment from the plasmid pA4xMLΔ53, which contained four copies of the HNF-4 cognate site A and the adenovirus major late core promoter. After PIC formation, beads were washed and bound complexes were analyzed for their factor content by immunoblotting. PICs were formed with GTFs only (TBP, TFIIB, TFIIE, TFIIF, TFIIH, Pol II (lane 3); with GTFs and HNF-4 (lane 4); or with GTFs, HNF-4, and PC4 (lanes 2 and 5). Lane 2, control in which the indicated factors were incubated with beads only (no template DNA); lane 1, GTFs only (input). (B) Immobilized-template recruitment assays are as for panel A, except that all reaction mixtures contained TFIIA, TFIIB, TFIID, TFIIE, TFIIF, TFIIH, Pol II, and TRAP/SMCC/Mediator, as shown in input lane 1. HNF-4 (lanes 3 and 5) and PC4 (lanes 4 and 5) were additionally added as indicated. (C) Immobilized-template recruitment assays are as for panel B, except that reaction mixtures in lanes 6 and 7 did not contain TFIID. HNF-4 (lanes 3, 5, and 7) and PC4 (lanes 4 to 7) were additionally added as indicated.

    Article Snippet: 600 bp) from plasmid pA4xMLΔ53 ( , ), which contains the HNF-4 cognate sites and the core promoter elements, was filled in with biotinylated dATP by using the Klenow fragment of DNA Pol I, gel purified, and bound to M280-streptavidin Dynabeads (Dynal), as suggested by the manufacturer.

    Techniques: Plasmid Preparation, Incubation

    In vitro target binding specificity of four PNAs designed to interact with the human γ-globin promoter. ( A ) PNA150, PNA116, PNA78, and PNA7 were designed to target the proximal promoter region (-202 to +33) of the human fetal γ-globin gene at specific sites indicated by the filled in boxes. The relative location of known promoter elements within this region are also indicated. Orientation of the PNA molecule relative to the promoter sequence is shown above, with a lys at its 3′-end and a biotin molecule (circle) attached at the 5′-end. ( B ) Different concentrations of PNAs (0–10 μM) were incubated with a constant amount of radioactively labeled DNA oligonucleotide (10 nM) containing either the wild type (WT) or mutated (mut) target sequence followed by incubation with streptavidin Dynabeads and collection with a magnetic particle concentrator. Bound/input ratios were obtained after scintillation counter analysis. ( C ) Permanganate probing confirms the specificity of PNA78 by showing that oxidized and cleaved T bases (lane 3) are accessible within the designated target sequence compared to ‘no PNA’ (dashed line) and PNA7 (as noninteracting PNA) controls. The A+G sequence ladder is shown in lane 1, along with the nucleotide sequence of the γ-globin promoter aligned on the left.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Design of embedded chimeric peptide nucleic acids that efficiently enter and accurately reactivate gene expression in vivo

    doi: 10.1073/pnas.0912896107

    Figure Lengend Snippet: In vitro target binding specificity of four PNAs designed to interact with the human γ-globin promoter. ( A ) PNA150, PNA116, PNA78, and PNA7 were designed to target the proximal promoter region (-202 to +33) of the human fetal γ-globin gene at specific sites indicated by the filled in boxes. The relative location of known promoter elements within this region are also indicated. Orientation of the PNA molecule relative to the promoter sequence is shown above, with a lys at its 3′-end and a biotin molecule (circle) attached at the 5′-end. ( B ) Different concentrations of PNAs (0–10 μM) were incubated with a constant amount of radioactively labeled DNA oligonucleotide (10 nM) containing either the wild type (WT) or mutated (mut) target sequence followed by incubation with streptavidin Dynabeads and collection with a magnetic particle concentrator. Bound/input ratios were obtained after scintillation counter analysis. ( C ) Permanganate probing confirms the specificity of PNA78 by showing that oxidized and cleaved T bases (lane 3) are accessible within the designated target sequence compared to ‘no PNA’ (dashed line) and PNA7 (as noninteracting PNA) controls. The A+G sequence ladder is shown in lane 1, along with the nucleotide sequence of the γ-globin promoter aligned on the left.

    Article Snippet: The resultant material was incubated with equal amount of Dynabeads M280-streptavidin (DYNAL Biotech) for 15 s in 25 °C.

    Techniques: In Vitro, Binding Assay, Sequencing, Incubation, Labeling

    ( A ) Scheme for the specific biotinylation of tagged GATA-1 by BirA biotin ligase in MEL cells. The sequence of the 23-aa peptide tag fused to the N terminus of GATA-1 is shown. The asterisk indicates the lysine residue that becomes specifically biotinylated by BirA. Speckled boxes indicate the positions of the two GATA-1 Zinc-fingers. Tagged GATA-1 and BirA were cloned separately in a mammalian erythroid expression cassette and coexpressed in MEL cells. ( B ) Biotinylation of tagged GATA-1 in MEL cells. ( Left ) Western blot with an anti-GATA-1 antibody to detect endogenous and tagged GATA-1 proteins. ( Right ) Western blot of the same extracts with streptavidin–HRP conjugate to detect biotinylated GATA-1. Nuclear extracts (5 μg per lane) from the double transfectants (lanes 1 and 5) and single transfectants (lanes 2, 3, 6, and 7) for tagged GATA-1 and Bir A were tested. Lanes 4 and 8, nuclear extract from nontransfected MEL cells. Biotinylated GATA-1 (asterisk) is clearly visible in only in the lane of the double transfected cells. Also indicated is the low background detected by streptavidin in MEL nuclear extracts from cells expressing only BirA ( Right , lane 7). ( C ) Efficiency of GATA-1 biotinylation and binding to streptavidin beads. ( Left ) Western blot using anti-GATA-1 antibody to detect binding of tagged GATA-1 to streptavidin beads (lane 2; starting material for the binding was 2.5 times the amount of nuclear extract shown in the input lane). Input and unbound material are shown in lanes 1 and 3. ( Right ) The same filter stripped and reprobed with streptavidin–HRP to detect the binding of biotinylated GATA-1 to streptavidin beads (lane 5). Lane 6 shows that very little tagged GATA-1 remains unbound by streptavidin. In this binding experiment, the beads were washed under stringent conditions (0.5 M NaCl/0.3% Triton X-100 in PBS). In, input (nuclear extract); El, eluted material; Un, unbound material.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Efficient biotinylation and single-step purification of tagged transcription factors in mammalian cells and transgenic mice

    doi: 10.1073/pnas.1332608100

    Figure Lengend Snippet: ( A ) Scheme for the specific biotinylation of tagged GATA-1 by BirA biotin ligase in MEL cells. The sequence of the 23-aa peptide tag fused to the N terminus of GATA-1 is shown. The asterisk indicates the lysine residue that becomes specifically biotinylated by BirA. Speckled boxes indicate the positions of the two GATA-1 Zinc-fingers. Tagged GATA-1 and BirA were cloned separately in a mammalian erythroid expression cassette and coexpressed in MEL cells. ( B ) Biotinylation of tagged GATA-1 in MEL cells. ( Left ) Western blot with an anti-GATA-1 antibody to detect endogenous and tagged GATA-1 proteins. ( Right ) Western blot of the same extracts with streptavidin–HRP conjugate to detect biotinylated GATA-1. Nuclear extracts (5 μg per lane) from the double transfectants (lanes 1 and 5) and single transfectants (lanes 2, 3, 6, and 7) for tagged GATA-1 and Bir A were tested. Lanes 4 and 8, nuclear extract from nontransfected MEL cells. Biotinylated GATA-1 (asterisk) is clearly visible in only in the lane of the double transfected cells. Also indicated is the low background detected by streptavidin in MEL nuclear extracts from cells expressing only BirA ( Right , lane 7). ( C ) Efficiency of GATA-1 biotinylation and binding to streptavidin beads. ( Left ) Western blot using anti-GATA-1 antibody to detect binding of tagged GATA-1 to streptavidin beads (lane 2; starting material for the binding was 2.5 times the amount of nuclear extract shown in the input lane). Input and unbound material are shown in lanes 1 and 3. ( Right ) The same filter stripped and reprobed with streptavidin–HRP to detect the binding of biotinylated GATA-1 to streptavidin beads (lane 5). Lane 6 shows that very little tagged GATA-1 remains unbound by streptavidin. In this binding experiment, the beads were washed under stringent conditions (0.5 M NaCl/0.3% Triton X-100 in PBS). In, input (nuclear extract); El, eluted material; Un, unbound material.

    Article Snippet: Paramagnetic streptavidin beads [Dynabeads M-280, Dynal (Great Neck, NY)] were blocked by washing three times in TBS with 200 ng/μl purified chicken serum albumin (Sigma-Aldrich).

    Techniques: Sequencing, Zinc-Fingers, Clone Assay, Expressing, Western Blot, Transfection, Binding Assay

    Specific biotinylation of tagged EKLF in transgenic mouse embryos. Nuclear extracts from the fetal liver of 13.5-days postcoitum embryos from a tagged EKLF/BirA double transgenic line (lanes 1–3 and 7–9) and from a tagged EKLF transgenic line (lanes 4–6) were bound to streptavidin beads. Tagged and biotinylated EKLF in input nuclear extract, unbound material (sup., supernatant), and bound material was detected by an EKLF antibody ( Left ) or by streptavidin–HRP ( Right ). EKLF biotinylation and binding to the beads is detected only in extracts from double transgenic embryos.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Efficient biotinylation and single-step purification of tagged transcription factors in mammalian cells and transgenic mice

    doi: 10.1073/pnas.1332608100

    Figure Lengend Snippet: Specific biotinylation of tagged EKLF in transgenic mouse embryos. Nuclear extracts from the fetal liver of 13.5-days postcoitum embryos from a tagged EKLF/BirA double transgenic line (lanes 1–3 and 7–9) and from a tagged EKLF transgenic line (lanes 4–6) were bound to streptavidin beads. Tagged and biotinylated EKLF in input nuclear extract, unbound material (sup., supernatant), and bound material was detected by an EKLF antibody ( Left ) or by streptavidin–HRP ( Right ). EKLF biotinylation and binding to the beads is detected only in extracts from double transgenic embryos.

    Article Snippet: Paramagnetic streptavidin beads [Dynabeads M-280, Dynal (Great Neck, NY)] were blocked by washing three times in TBS with 200 ng/μl purified chicken serum albumin (Sigma-Aldrich).

    Techniques: Transgenic Assay, Binding Assay

    ( A ) Binding biotinylated GATA-1 to streptavidin beads specifically pulls down FOG-1, as detected by Western blotting by using a FOG-1 antibody. By contrast, FOG-1 cannot be pulled down by streptavidin in nuclear extracts expressing biotinylated expressing BirA only ( Right ). ( B ) Streptavidin pull-down of βmaj globin promoter sequences from crosslinked chromatin from MEL cells expressing biotinylated GATA-1 ( Left ) or BirA only ( Right ). Triangles indicate increasing amounts of pulled-down crosslinked chromatin used as template in PCR reactions in detecting amplification of the βmaj sequences. Specific enrichment for βmaj sequences is observed in pulled-down chromatin from cells expressing biotinylated GATA-1 but not from cells expressing BirA only.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Efficient biotinylation and single-step purification of tagged transcription factors in mammalian cells and transgenic mice

    doi: 10.1073/pnas.1332608100

    Figure Lengend Snippet: ( A ) Binding biotinylated GATA-1 to streptavidin beads specifically pulls down FOG-1, as detected by Western blotting by using a FOG-1 antibody. By contrast, FOG-1 cannot be pulled down by streptavidin in nuclear extracts expressing biotinylated expressing BirA only ( Right ). ( B ) Streptavidin pull-down of βmaj globin promoter sequences from crosslinked chromatin from MEL cells expressing biotinylated GATA-1 ( Left ) or BirA only ( Right ). Triangles indicate increasing amounts of pulled-down crosslinked chromatin used as template in PCR reactions in detecting amplification of the βmaj sequences. Specific enrichment for βmaj sequences is observed in pulled-down chromatin from cells expressing biotinylated GATA-1 but not from cells expressing BirA only.

    Article Snippet: Paramagnetic streptavidin beads [Dynabeads M-280, Dynal (Great Neck, NY)] were blocked by washing three times in TBS with 200 ng/μl purified chicken serum albumin (Sigma-Aldrich).

    Techniques: Binding Assay, Western Blot, Expressing, Polymerase Chain Reaction, Amplification

    Mutational analyses of the MCAT motif and MCAT-like sequences by reporter and in vitro DNA pulldown assays. (A) HEK293 cells were transfected with the indicated firefly luciferase reporter plasmid, together with the indicated amounts of the expression plasmid for TEAD4 (pCMV-HA-TEAD4) and the Renilla luciferase plasmid. Two days after transfection, the firefly luciferase activity was measured and normalized to the Renilla luciferase activity. The levels of luciferase activity are presented as fold increase compared with that obtained from cells transfected with pA3B−200/+45 without the TEAD4 expression plasmid. The data are the averages of three independent experiments, with the error bars representing standard deviations. (B) Schematic representation of the biotinylated DNA probes used in DNA pulldown assays. The positions and nucleotide sequences of MCAT-like 1 and 2 and MCAT are shown. The mutated nucleotides are underlined, and the nucleotide sequences in the mutated probes are denoted by lowercase letters. (C to F) The indicated biotinylated DNA probes were coupled to Dynabeads/M-280 streptavidin and incubated with the nuclear extract from NIKS-E6; 1/10 or 1/20 volume of input (Input) and entire precipitated fractions were analyzed by immunoblotting using anti-pan-TEAD antibody. (E) Unlabeled oligonucleotide competitors (lines A to D) indicated by the solid lines under the nucleotide sequence of the −141/−96 probe were added to the reaction mixtures, and inhibition of TEADs binding to the −141/−96 probe was examined. The MCAT-like sequences 1 and 2 are boxed, and nucleotides that match the typical MCAT motif are underlined. (G) HEK293 cells were transfected with the indicated firefly luciferase reporter plasmid, together with the indicated amounts of pCMV-HA-TEAD4 and the Renilla luciferase plasmid, and the luciferase activity was measured as described for panel A.

    Journal: Journal of Virology

    Article Title: Human Papillomavirus 16 E6 Upregulates APOBEC3B via the TEAD Transcription Factor

    doi: 10.1128/JVI.02413-16

    Figure Lengend Snippet: Mutational analyses of the MCAT motif and MCAT-like sequences by reporter and in vitro DNA pulldown assays. (A) HEK293 cells were transfected with the indicated firefly luciferase reporter plasmid, together with the indicated amounts of the expression plasmid for TEAD4 (pCMV-HA-TEAD4) and the Renilla luciferase plasmid. Two days after transfection, the firefly luciferase activity was measured and normalized to the Renilla luciferase activity. The levels of luciferase activity are presented as fold increase compared with that obtained from cells transfected with pA3B−200/+45 without the TEAD4 expression plasmid. The data are the averages of three independent experiments, with the error bars representing standard deviations. (B) Schematic representation of the biotinylated DNA probes used in DNA pulldown assays. The positions and nucleotide sequences of MCAT-like 1 and 2 and MCAT are shown. The mutated nucleotides are underlined, and the nucleotide sequences in the mutated probes are denoted by lowercase letters. (C to F) The indicated biotinylated DNA probes were coupled to Dynabeads/M-280 streptavidin and incubated with the nuclear extract from NIKS-E6; 1/10 or 1/20 volume of input (Input) and entire precipitated fractions were analyzed by immunoblotting using anti-pan-TEAD antibody. (E) Unlabeled oligonucleotide competitors (lines A to D) indicated by the solid lines under the nucleotide sequence of the −141/−96 probe were added to the reaction mixtures, and inhibition of TEADs binding to the −141/−96 probe was examined. The MCAT-like sequences 1 and 2 are boxed, and nucleotides that match the typical MCAT motif are underlined. (G) HEK293 cells were transfected with the indicated firefly luciferase reporter plasmid, together with the indicated amounts of pCMV-HA-TEAD4 and the Renilla luciferase plasmid, and the luciferase activity was measured as described for panel A.

    Article Snippet: The biotinylated DNA probes (12.5 pmol) were coupled to 200 μg of Dynabeads/M-280 streptavidin (Dynal Biotech, Oslo, Norway) at room temperature for 30 min in a coupling buffer (10 mM Tris-HCl [pH 8.0], 0.5 mM EDTA, 1 M NaCl).

    Techniques: In Vitro, Transfection, Luciferase, Plasmid Preparation, Expressing, Activity Assay, Incubation, Sequencing, Inhibition, Binding Assay

    Cloning of active chromatin sequences. We developed a strategy to create genomic DNA libraries containing sequences flanking DNaseI cut sites introduced into nuclear chromatin under limiting (hypersensitive) conditions. After DNA purification, free DNA ends are enzymatically repaired and ligated to a biotinylated linker adaptor. The DNA sample is then fragmented further with a four-cutter enzyme ( Nla III). At this stage, the genome has been partitioned into two predominant fragment populations: Nla III– Nla III fragments (derived from the non-DNaseI cut background) and Nla III-adaptor fragments (carrying for DNaseI cut sites). Adapted DNA is efficiently isolated on paramagnetic streptavidin-coated beads, whereas Nla III– Nla III background fragments are cleansed. A second linker adaptor is then appended to the Nla III end of captured DNA, and the product is released from the beads. This DNaseI cut site-enriched population is enriched and is retained for the subsequent subtraction step. A DNaseI cut site-depleted population is prepared by further fragmenting DNaseI-treated genomic DNA with a four-cutter that leaves a 3′ overhang (e.g., Nla III). Further digestion of this sample with Exonuclease III followed by mung bean nuclease will preserve the Nla III– Nla III fragments (which are resistant to processive degradation), whereas fragments with DNaseI cut ends will be efficiently eliminated. The residual remaining population of DNaseI cut site-depleted DNA is then heavily biotinylated. An excess of this population is mixed with the DNaseI cut site-enriched population, and the sample is denatured and is slowly reannealed. Nonbiotinylated fragments generated by repeated DNaseI cleavage events at or around the same genomic coordinate (i.e., a hypersensitive site) will be more likely to self-anneal than find a partner in the DNaseI cut site-depleted population. Sites that have only been cut once (i.e., due to non-HS-specific cutting or to genomic shear) will form heteroduplexes. Extraction of the mixture with paramagnetic beads isolates the nonbiotinylated homoduplexes that are now further enriched in DNaseI hypersensitive sites. This population is PCR-amplified and cloned to make the genomic ACS libraries.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Genome-wide identification of DNaseI hypersensitive sites using active chromatin sequence libraries

    doi: 10.1073/pnas.0400678101

    Figure Lengend Snippet: Cloning of active chromatin sequences. We developed a strategy to create genomic DNA libraries containing sequences flanking DNaseI cut sites introduced into nuclear chromatin under limiting (hypersensitive) conditions. After DNA purification, free DNA ends are enzymatically repaired and ligated to a biotinylated linker adaptor. The DNA sample is then fragmented further with a four-cutter enzyme ( Nla III). At this stage, the genome has been partitioned into two predominant fragment populations: Nla III– Nla III fragments (derived from the non-DNaseI cut background) and Nla III-adaptor fragments (carrying for DNaseI cut sites). Adapted DNA is efficiently isolated on paramagnetic streptavidin-coated beads, whereas Nla III– Nla III background fragments are cleansed. A second linker adaptor is then appended to the Nla III end of captured DNA, and the product is released from the beads. This DNaseI cut site-enriched population is enriched and is retained for the subsequent subtraction step. A DNaseI cut site-depleted population is prepared by further fragmenting DNaseI-treated genomic DNA with a four-cutter that leaves a 3′ overhang (e.g., Nla III). Further digestion of this sample with Exonuclease III followed by mung bean nuclease will preserve the Nla III– Nla III fragments (which are resistant to processive degradation), whereas fragments with DNaseI cut ends will be efficiently eliminated. The residual remaining population of DNaseI cut site-depleted DNA is then heavily biotinylated. An excess of this population is mixed with the DNaseI cut site-enriched population, and the sample is denatured and is slowly reannealed. Nonbiotinylated fragments generated by repeated DNaseI cleavage events at or around the same genomic coordinate (i.e., a hypersensitive site) will be more likely to self-anneal than find a partner in the DNaseI cut site-depleted population. Sites that have only been cut once (i.e., due to non-HS-specific cutting or to genomic shear) will form heteroduplexes. Extraction of the mixture with paramagnetic beads isolates the nonbiotinylated homoduplexes that are now further enriched in DNaseI hypersensitive sites. This population is PCR-amplified and cloned to make the genomic ACS libraries.

    Article Snippet: Genomic DNA was then fractionated by digestion with Nla III, and the biotinylated DNA was purified on paramagnetic streptavidin-coated beads (Dynal, Great Neck, NY).

    Techniques: Clone Assay, DNA Purification, Derivative Assay, Isolation, Generated, Polymerase Chain Reaction, Amplification

    Experimental setup and procedure. ( A ) Schematic diagram of G4 DNA and magnetic tweezers. The 26 mer ssDNA of four-repeat human telomeric sequence d(TTGGG(TTAGGG) 3 TTT) is sandwiched bewteen a lower 1449 bp and an upper 601 bp dsDNA handles. The DNA construct is tethered between a 2.8 μm-diameter paramagnetic bead via biotin-streptavidin linkage and an amine functionalized coverslip surface through covalent cross-linker sulfo-SMCC. Inset shows two possible hybrid-type G4 structures that may form on the sequence ( 16 , 17 ). ( B ) Imino proton NMR spectrum of telomeric G4 sequence d(TTGGG(TTAGGG) 3 TTT) (top) and the 1:1:1 mixture of three sequences, d( CGAGTCTGTGCACAAG GTGC), d( CTACTGACCTGGCTGC ) and d( CTTGTGCACAGACTCG TTGGG(TTAGGG) 3 TTT GCAGCCAGGTCAGTAGCGAC ) (bottom). The mixture is expected to form a G-quadruplex in the centre flanked by two 16-bp Watson–Crick duplexes at the 5′- and 3′-ends respectively (underlined sequences). ( C ) Typical force responses of G4 DNA in two repeating stretching cycles (original and smoothed extension data are shown in black and red, respectively). In each cycle, a constant force was maintained at 6.5 pN for 60 s then increased to 50 pN at a constant loading rate of 2 pN/s. In the first cycle, at the constant force of 6.5 pN, two extension states with an extension difference of ∼6 nm were observed, indicated by an unfolding transition (up-arrow) followed by a refolding transition (down-arrow) in the zoom-in inset in the orange rectangle. During the subsequent force-increase scan at 2 pN/s, a typical G4 unfolding indicated by a sudden extension jump with a step size of ∼8 nm occurred at ∼25 pN (marked in cyan rectangle). In the second cycle after force was jumped back to 6.5 pN, a refolding transition and a following unfolding transition were observed. In the subsequent force-increase scan at 2 pN/s, G4 unfolding was not observed.

    Journal: Nucleic Acids Research

    Article Title: Dynamics and stability of polymorphic human telomeric G-quadruplex under tension

    doi: 10.1093/nar/gku581

    Figure Lengend Snippet: Experimental setup and procedure. ( A ) Schematic diagram of G4 DNA and magnetic tweezers. The 26 mer ssDNA of four-repeat human telomeric sequence d(TTGGG(TTAGGG) 3 TTT) is sandwiched bewteen a lower 1449 bp and an upper 601 bp dsDNA handles. The DNA construct is tethered between a 2.8 μm-diameter paramagnetic bead via biotin-streptavidin linkage and an amine functionalized coverslip surface through covalent cross-linker sulfo-SMCC. Inset shows two possible hybrid-type G4 structures that may form on the sequence ( 16 , 17 ). ( B ) Imino proton NMR spectrum of telomeric G4 sequence d(TTGGG(TTAGGG) 3 TTT) (top) and the 1:1:1 mixture of three sequences, d( CGAGTCTGTGCACAAG GTGC), d( CTACTGACCTGGCTGC ) and d( CTTGTGCACAGACTCG TTGGG(TTAGGG) 3 TTT GCAGCCAGGTCAGTAGCGAC ) (bottom). The mixture is expected to form a G-quadruplex in the centre flanked by two 16-bp Watson–Crick duplexes at the 5′- and 3′-ends respectively (underlined sequences). ( C ) Typical force responses of G4 DNA in two repeating stretching cycles (original and smoothed extension data are shown in black and red, respectively). In each cycle, a constant force was maintained at 6.5 pN for 60 s then increased to 50 pN at a constant loading rate of 2 pN/s. In the first cycle, at the constant force of 6.5 pN, two extension states with an extension difference of ∼6 nm were observed, indicated by an unfolding transition (up-arrow) followed by a refolding transition (down-arrow) in the zoom-in inset in the orange rectangle. During the subsequent force-increase scan at 2 pN/s, a typical G4 unfolding indicated by a sudden extension jump with a step size of ∼8 nm occurred at ∼25 pN (marked in cyan rectangle). In the second cycle after force was jumped back to 6.5 pN, a refolding transition and a following unfolding transition were observed. In the subsequent force-increase scan at 2 pN/s, G4 unfolding was not observed.

    Article Snippet: After DNA constructs were bound to the surface, 2.8 μm-diameter streptavidin-coated paramagnetic beads (Dynal M-280, Life technologies) were introduced to attach to the biotin end of DNA.

    Techniques: Sequencing, Construct, Proton NMR

    Schematic representation of the HSAM assay based on self-assembly of DNA-streptavidin nanoparticles. (a) Bis-biotinylated DNA detection probes (2B-DNA) and poly-streptavidin (Poly-STV) form a nanoparticle. (b) The biotinylated capture probe was immobilized onto streptavidin-coated Dynal magnetic beads because of the high-affinity interaction of biotin with streptavidin. (c) IS 6110 was selected as a target site for detection. It is specifically recognized by the capture probe and detection probe. (d) The remaining free biotin binding sites of the surface-bound STV on the beads were blocked with d-Biotin, represented by shaded spheres. (e) The 2B-DNA hybridized to target, and immobilized the nanoparticles to the beads. (f)The reporter molecule (biotinylated-FITC) binds to the nanoparticle. (g)The results of the HSAM assay were obtained using fluorescent microscopy.

    Journal: Brazilian Journal of Microbiology

    Article Title: Rapid identification of Mycobacterium tuberculosis complex by a novel hybridization signal amplification method based on self-assembly of DNA-streptavidin nanoparticles

    doi: 10.1590/S1517-838220110003000016

    Figure Lengend Snippet: Schematic representation of the HSAM assay based on self-assembly of DNA-streptavidin nanoparticles. (a) Bis-biotinylated DNA detection probes (2B-DNA) and poly-streptavidin (Poly-STV) form a nanoparticle. (b) The biotinylated capture probe was immobilized onto streptavidin-coated Dynal magnetic beads because of the high-affinity interaction of biotin with streptavidin. (c) IS 6110 was selected as a target site for detection. It is specifically recognized by the capture probe and detection probe. (d) The remaining free biotin binding sites of the surface-bound STV on the beads were blocked with d-Biotin, represented by shaded spheres. (e) The 2B-DNA hybridized to target, and immobilized the nanoparticles to the beads. (f)The reporter molecule (biotinylated-FITC) binds to the nanoparticle. (g)The results of the HSAM assay were obtained using fluorescent microscopy.

    Article Snippet: The biotinylated capture probe was immobilized on streptavidin-coated Dynal magnetic beads, taking advantage of the high affinity between biotin and streptavidin (STV) ( , ).

    Techniques: Magnetic Beads, Binding Assay, Microscopy

    Binding specificities of anti-VEGF-C scFv. (A) ELISA screening of random clones obtained after 2 or 3 rounds of panning against ΔNΔC-VEGF-C. (B) ELISA analysis of representative anti-VEGF-C scFv clones for the 4 different amino acid sequences obtained. Maxisorp or streptavidin-precoated (SA) plates were coated with his-tagged human ΔNΔC-VEGF-C derived from P. pastoris or biotinylated his-tagged human ΔNΔC-VEGF-C from mammalian cells or P. pastoris , respectively. Control surfaces were left untreated. Antibody fragments and control antibodies were subsequently added and the ELISA was developed as described in Materials and Methods. (C) Cross-reactivity tested by ELISA. Human ΔNΔC-VEGF-C orΔNΔC-VEGF-D (both from mammalian cells) were coated on a maxisorp plate. Anti-VEGF-C scFv clone VC2 or a negative control (PBS only) was added and the ELISA was developed as described in Materials and Methods. (D) BIAcore profiles from the 4 different anti-VEGF-C scFv clones. Different concentrations of protein-A purified scFv were injected on a streptavidin-precoated sensorchip coated with ca. 2000 RU biotinylated mammalian cell-derived ΔNΔC-VEGF-C.

    Journal: PLoS ONE

    Article Title: Phage-Derived Fully Human Monoclonal Antibody Fragments to Human Vascular Endothelial Growth Factor-C Block Its Interaction with VEGF Receptor-2 and 3

    doi: 10.1371/journal.pone.0011941

    Figure Lengend Snippet: Binding specificities of anti-VEGF-C scFv. (A) ELISA screening of random clones obtained after 2 or 3 rounds of panning against ΔNΔC-VEGF-C. (B) ELISA analysis of representative anti-VEGF-C scFv clones for the 4 different amino acid sequences obtained. Maxisorp or streptavidin-precoated (SA) plates were coated with his-tagged human ΔNΔC-VEGF-C derived from P. pastoris or biotinylated his-tagged human ΔNΔC-VEGF-C from mammalian cells or P. pastoris , respectively. Control surfaces were left untreated. Antibody fragments and control antibodies were subsequently added and the ELISA was developed as described in Materials and Methods. (C) Cross-reactivity tested by ELISA. Human ΔNΔC-VEGF-C orΔNΔC-VEGF-D (both from mammalian cells) were coated on a maxisorp plate. Anti-VEGF-C scFv clone VC2 or a negative control (PBS only) was added and the ELISA was developed as described in Materials and Methods. (D) BIAcore profiles from the 4 different anti-VEGF-C scFv clones. Different concentrations of protein-A purified scFv were injected on a streptavidin-precoated sensorchip coated with ca. 2000 RU biotinylated mammalian cell-derived ΔNΔC-VEGF-C.

    Article Snippet: Prior to selection, 50 µl streptavidin coated magnetic beads (M-280 Dynabeads, Dynal Biotech, Oslo, Norway) per selection were blocked with 1 ml 3% BSA in PBS for 1 hour at room temperature and resuspended in 50 µl 2% BSA/PBS.

    Techniques: Binding Assay, Enzyme-linked Immunosorbent Assay, Clone Assay, Derivative Assay, Negative Control, Purification, Injection

    Affinity matured anti-VEGF-C scFvs possess a higher affinity. (A, B) ELISA analysis of bacterial supernatant from randomly picked affinity matured clones after 1 to 3 rounds of selection on biotinylated (A) P. pastoris -derived or (B) mammalian cell-derived ΔNΔC-VEGF-C. (C) BIAcore profiles of monomeric affinity matured anti-VEGF-C scFvs. Monomeric fractions of protein-A purified scFv were prepared by FPLC and injected as 2-fold dilution series on a streptavidin-sensorchip coated with 2000 RU biotinylated ΔNΔC-VEGF-C derived from mammalian cells.

    Journal: PLoS ONE

    Article Title: Phage-Derived Fully Human Monoclonal Antibody Fragments to Human Vascular Endothelial Growth Factor-C Block Its Interaction with VEGF Receptor-2 and 3

    doi: 10.1371/journal.pone.0011941

    Figure Lengend Snippet: Affinity matured anti-VEGF-C scFvs possess a higher affinity. (A, B) ELISA analysis of bacterial supernatant from randomly picked affinity matured clones after 1 to 3 rounds of selection on biotinylated (A) P. pastoris -derived or (B) mammalian cell-derived ΔNΔC-VEGF-C. (C) BIAcore profiles of monomeric affinity matured anti-VEGF-C scFvs. Monomeric fractions of protein-A purified scFv were prepared by FPLC and injected as 2-fold dilution series on a streptavidin-sensorchip coated with 2000 RU biotinylated ΔNΔC-VEGF-C derived from mammalian cells.

    Article Snippet: Prior to selection, 50 µl streptavidin coated magnetic beads (M-280 Dynabeads, Dynal Biotech, Oslo, Norway) per selection were blocked with 1 ml 3% BSA in PBS for 1 hour at room temperature and resuspended in 50 µl 2% BSA/PBS.

    Techniques: Enzyme-linked Immunosorbent Assay, Clone Assay, Selection, Derivative Assay, Purification, Fast Protein Liquid Chromatography, Injection

    Schematic representation of GEP-DEAN. ( a ) Outline of the assay procedures. ( b ) Structure of molecular translation table (MTT) that connects the target cDNA with a target specific sequence TSS i to the corresponding two-digit DNA-coded number DCN j composed of the common start digit (SD), the first digit D1 j 1 , the second digit D2 j 2 and the common end digit (ED). ( c ) Encoding step. The encoding reaction for the target cDNA strands with TSS i starts with ligation of 5′-MTT i , j and 3′-MTT i , j strands that hybridize adjacently with TSS i . After ligation of the MTT strands, the reaction mixture is subjected to incubation at high temperature and a subsequent quick cooling to dissociate the target cDNA strands and to make 3′-biotinylated cCS (cCS-b) hybridize. The ligation products with cCS-b bound are captured by streptavidin-coupled magnetic beads (SA-beads) and then excess free MTT strands and the dissociated target cDNA strands are washed out. After elution of the ligation products, a primer pair of 5′-b-CS and cED strands is added to the reaction mixture and the ligation products are amplified by PCR to further remove the free 3′-MTT strands. The amplified ligation products are then captured by SA-beads and converted to single strands by alkali wash. ( d ) Amplification step. The DCN region of the single-stranded ligation products is amplified by PCR with a primer pair of 5′-biotinylated SD and cED. The amplified products are then captured by SA-beads and converted to single strands by alkali wash. ( e ) Decoding step. The two-digit DCNs are decoded with respect to the second digit (D2). The solution of the single-stranded amplified products of the sample and that of the reference are divided into N D2 tubes. To the j 2-th tube, a fluorescence-labeled (Cy5- and Cy3-labeled for sample and reference, respectively) cD2 j 2 strand and the mixture of all cD1 strands are added. When a DCN j strand corresponding to the target cDNA with TSS i is present, a cD2 j 2 and a cD1 j 1 strand are joined together by DCN-templated ligation to produce a decoding product cD2 j 2 –cD1 j 1 . The decoding products of the sample and reference are thus labeled with different fluorescence colors. ( f ) Quantification step. The decoding products of the sample and those of the reference in the j 2-th tube are competitively hybridized in the j 2-th capillary of a DNA capillary array (DCA), which is a kind of DNA microarray composed of an array of capillaries with DNA probes immobilized on their inner surface. All capillaries have a common set of DNA probes D1 j 1 ( j 1 = 0, 1, 2 , … , N D1 − 1). The absolute amount of the target cDNA with TSS i is obtained from the Cy5/Cy3 fluorescence intensity ratio measured for a spot of D1 j 1 probe in the j 2-th capillary.

    Journal: Nucleic Acids Research

    Article Title: Multiplex cDNA quantification method that facilitates the standardization of gene expression data

    doi: 10.1093/nar/gkr138

    Figure Lengend Snippet: Schematic representation of GEP-DEAN. ( a ) Outline of the assay procedures. ( b ) Structure of molecular translation table (MTT) that connects the target cDNA with a target specific sequence TSS i to the corresponding two-digit DNA-coded number DCN j composed of the common start digit (SD), the first digit D1 j 1 , the second digit D2 j 2 and the common end digit (ED). ( c ) Encoding step. The encoding reaction for the target cDNA strands with TSS i starts with ligation of 5′-MTT i , j and 3′-MTT i , j strands that hybridize adjacently with TSS i . After ligation of the MTT strands, the reaction mixture is subjected to incubation at high temperature and a subsequent quick cooling to dissociate the target cDNA strands and to make 3′-biotinylated cCS (cCS-b) hybridize. The ligation products with cCS-b bound are captured by streptavidin-coupled magnetic beads (SA-beads) and then excess free MTT strands and the dissociated target cDNA strands are washed out. After elution of the ligation products, a primer pair of 5′-b-CS and cED strands is added to the reaction mixture and the ligation products are amplified by PCR to further remove the free 3′-MTT strands. The amplified ligation products are then captured by SA-beads and converted to single strands by alkali wash. ( d ) Amplification step. The DCN region of the single-stranded ligation products is amplified by PCR with a primer pair of 5′-biotinylated SD and cED. The amplified products are then captured by SA-beads and converted to single strands by alkali wash. ( e ) Decoding step. The two-digit DCNs are decoded with respect to the second digit (D2). The solution of the single-stranded amplified products of the sample and that of the reference are divided into N D2 tubes. To the j 2-th tube, a fluorescence-labeled (Cy5- and Cy3-labeled for sample and reference, respectively) cD2 j 2 strand and the mixture of all cD1 strands are added. When a DCN j strand corresponding to the target cDNA with TSS i is present, a cD2 j 2 and a cD1 j 1 strand are joined together by DCN-templated ligation to produce a decoding product cD2 j 2 –cD1 j 1 . The decoding products of the sample and reference are thus labeled with different fluorescence colors. ( f ) Quantification step. The decoding products of the sample and those of the reference in the j 2-th tube are competitively hybridized in the j 2-th capillary of a DNA capillary array (DCA), which is a kind of DNA microarray composed of an array of capillaries with DNA probes immobilized on their inner surface. All capillaries have a common set of DNA probes D1 j 1 ( j 1 = 0, 1, 2 , … , N D1 − 1). The absolute amount of the target cDNA with TSS i is obtained from the Cy5/Cy3 fluorescence intensity ratio measured for a spot of D1 j 1 probe in the j 2-th capillary.

    Article Snippet: The reaction mixtures were captured by adding 0.3 mg of streptavidin-coupled magnetic beads (Dynabeads MyOne streptavidin C1, Invitrogen's Dynal) and incubating at room temperature for 15 min, followed by washing twice at room temperature with 1× binding and washing buffer (B & W: 1 M NaCl, TE, pH 8.0), according to the manufacturer's protocol.

    Techniques: MTT Assay, Sequencing, Ligation, Incubation, Magnetic Beads, Amplification, Polymerase Chain Reaction, Fluorescence, Labeling, Microarray

    L-selectin–deficient mice have an intact antigen presentation pathway. ( A ) Epidermal whole mounts from L-selectin–deficient mice show normal numbers and distribution of LC. Whole mounts of abdominal skin were prepared and stained with anti-I-A b ( 41 ). I-A + cells were counted in 30 fields/slide (field = 0.1 mm 2 ), and calculated as the average of cells/mm 2 over two slides. ( B ) LC are present in L-selectin–deficient mice and drain to PLN following skin painting with FITC. Mice were sensitized with FITC and 24 h later PLN and spleens were collected and centrifuged over metrizamide gradients ( 18 ). Cells at the interface were collected and stained with biotinylated anti– mouse I-A followed by streptavidin-PE and analyzed by twocolor FACS ® analysis to detect the presence of draining I-A + / FITC + LC. One of six representative experiments is shown. ( C ) LC from L-selectin–deficient mice can initiate allogeneic responses. LC collected from PLN of FITC-painted wild-type ( squares ) or L-selectin–deficient mice ( triangles ) were irradiated and incubated for 48 h with 2 × 10 5 T cells from either BALB/c (allogeneic; open squares and triangles ) or C57BL/6J (syngeneic; closed squares and triangles ) mice. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting. ( D ) LC can initiate antigen-specific responses. Irradiated PLN cells were used as APCs from wild-type or L-selectin–deficient mice, and were either pulsed with or without DNBS. These cells were incubated for 48 h with increasing concentrations of PLN T cells isolated from wild-type mice sensitized with DNFB 5 d before. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting.

    Journal: The Journal of Experimental Medicine

    Article Title: The Route of Antigen Entry Determines the Requirement for L-selectin during Immune Responses

    doi:

    Figure Lengend Snippet: L-selectin–deficient mice have an intact antigen presentation pathway. ( A ) Epidermal whole mounts from L-selectin–deficient mice show normal numbers and distribution of LC. Whole mounts of abdominal skin were prepared and stained with anti-I-A b ( 41 ). I-A + cells were counted in 30 fields/slide (field = 0.1 mm 2 ), and calculated as the average of cells/mm 2 over two slides. ( B ) LC are present in L-selectin–deficient mice and drain to PLN following skin painting with FITC. Mice were sensitized with FITC and 24 h later PLN and spleens were collected and centrifuged over metrizamide gradients ( 18 ). Cells at the interface were collected and stained with biotinylated anti– mouse I-A followed by streptavidin-PE and analyzed by twocolor FACS ® analysis to detect the presence of draining I-A + / FITC + LC. One of six representative experiments is shown. ( C ) LC from L-selectin–deficient mice can initiate allogeneic responses. LC collected from PLN of FITC-painted wild-type ( squares ) or L-selectin–deficient mice ( triangles ) were irradiated and incubated for 48 h with 2 × 10 5 T cells from either BALB/c (allogeneic; open squares and triangles ) or C57BL/6J (syngeneic; closed squares and triangles ) mice. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting. ( D ) LC can initiate antigen-specific responses. Irradiated PLN cells were used as APCs from wild-type or L-selectin–deficient mice, and were either pulsed with or without DNBS. These cells were incubated for 48 h with increasing concentrations of PLN T cells isolated from wild-type mice sensitized with DNFB 5 d before. Cultures were pulsed with [ 3 H]thymidine for 18 h before harvesting.

    Article Snippet: PLN cells from wild-type mice sensitized 5 d before with 25 μl of DNFB or from control untreated mice were harvested, depleted of macrophages and B cells using biotinylated anti-Mac-1 and anti-B220 followed by streptavidin-conjugated magnetic beads (DYNAL Inc., Lake Success, NY).

    Techniques: Mouse Assay, Staining, FACS, Irradiation, Incubation, Isolation

    Direct telomerase assay with POT1 preloaded primers. (A) Schematic of the experimental design to preload substrate primers with POT1 (see the text). (B) Direct telomerase activity assay. Biotinylated primer tel3.0 bound to streptavidin beads was incubated

    Journal: Molecular and Cellular Biology

    Article Title: Human Protection of Telomeres 1 (POT1) Is a Negative Regulator of Telomerase Activity In Vitro

    doi: 10.1128/MCB.25.2.808-818.2005

    Figure Lengend Snippet: Direct telomerase assay with POT1 preloaded primers. (A) Schematic of the experimental design to preload substrate primers with POT1 (see the text). (B) Direct telomerase activity assay. Biotinylated primer tel3.0 bound to streptavidin beads was incubated

    Article Snippet: Unincorporated nucleotides were removed by binding biotinylated primers to streptavidin paramagnetic beads (Dynal), preincubated with 3′-32 P-labeled B-10mer (5′-B-CAAGTCATCT-3′) as a loading control, washing twice with 2× BW (10 mM Tris-HCl [pH 7.5], 1 mM EDTA, 2 M NaCl) and once with TE (10 mM Tris HCl [pH 8.0], 1 mM EDTA).

    Techniques: Telomerase Assay, Telomerase Activity Assay, Incubation

    Phosphorylation at p53 Ser15 inhibits TFIID binding. (A) Diagram of biotinylated peptides which correspond to the activation domain (amino acids 1 through 39) of human p53. Biotinylated peptides were incubated with the 1 M phosphocellulose TFIID fraction from HeLa cell extracts. Bound complexes were captured with magnetic streptavidin beads and analyzed by Western blotting for the presence of TBP, using an anti-TFIID antibody (Santa Cruz). (B) Lane 1, one-fourth of input TFIID fraction; lane 2, no peptide; lane 3, unphosphorylated 1-39 peptide; lane 4, 1-39 peptide phosphorylated at Ser15; lane 5, 1-39 peptide phosphorylated at Ser20. Sizes are indicated in kilodaltons. (C) Peptides were either mock treated (lanes 2 to 5) or treated with DNA PK. The reaction was stopped by addition of 0.5 μM wortmannin. Lane 1, one-fourth of input TFIID fraction; lane 2, unphosphorylated 1-39 peptide; lane 3, 1-39 peptide phosphorylated at Ser15; lane 4, 1-39 peptide phosphorylated at Ser20; lane 5, 1-39 peptide phosphorylated at Ser37; lane 6, DNA PK-treated peptide 1-39; lane 7, DNA PK-treated peptide 1-39P15; lane 8, DNA PK-treated peptide 1-39P20; lane 9, DNA PK-treated peptide 1-39P37. Below lanes 2 to 9 are captured peptides stained with Coomassie blue to determine the amount of peptide recovered in the binding assays.

    Journal: Journal of Virology

    Article Title: Phosphorylation of p53: a Novel Pathway for p53 Inactivation in Human T-Cell Lymphotropic Virus Type 1-Transformed Cells

    doi:

    Figure Lengend Snippet: Phosphorylation at p53 Ser15 inhibits TFIID binding. (A) Diagram of biotinylated peptides which correspond to the activation domain (amino acids 1 through 39) of human p53. Biotinylated peptides were incubated with the 1 M phosphocellulose TFIID fraction from HeLa cell extracts. Bound complexes were captured with magnetic streptavidin beads and analyzed by Western blotting for the presence of TBP, using an anti-TFIID antibody (Santa Cruz). (B) Lane 1, one-fourth of input TFIID fraction; lane 2, no peptide; lane 3, unphosphorylated 1-39 peptide; lane 4, 1-39 peptide phosphorylated at Ser15; lane 5, 1-39 peptide phosphorylated at Ser20. Sizes are indicated in kilodaltons. (C) Peptides were either mock treated (lanes 2 to 5) or treated with DNA PK. The reaction was stopped by addition of 0.5 μM wortmannin. Lane 1, one-fourth of input TFIID fraction; lane 2, unphosphorylated 1-39 peptide; lane 3, 1-39 peptide phosphorylated at Ser15; lane 4, 1-39 peptide phosphorylated at Ser20; lane 5, 1-39 peptide phosphorylated at Ser37; lane 6, DNA PK-treated peptide 1-39; lane 7, DNA PK-treated peptide 1-39P15; lane 8, DNA PK-treated peptide 1-39P20; lane 9, DNA PK-treated peptide 1-39P37. Below lanes 2 to 9 are captured peptides stained with Coomassie blue to determine the amount of peptide recovered in the binding assays.

    Article Snippet: Bound complexes were captured with magnetic streptavidin beads (Dynal), washed four times with buffer A, separated by electrophoresis, and analyzed by Western blot analysis with antibody to TFIID (Santa Cruz Biotechnology).

    Techniques: Binding Assay, Activation Assay, Incubation, Western Blot, Staining