dntp mix Roche Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher sybr green pcr master mix
    Activation of BiP ( A ), Atf3 ( B ), Ero1-lβ ( C ), Chop ( D ) in Tr-J . Expression levels in sciatic nerves were measured by quantitative <t>RT–PCR</t> using <t>SYBR®</t> Green in triplicates and normalized to β-Actin. All UPR markers except
    Sybr Green Pcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 101787 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr green pcr master mix/product/Thermo Fisher
    Average 99 stars, based on 101787 article reviews
    Price from $9.99 to $1999.99
    sybr green pcr master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad iq sybr green supermix
    Activation of BiP ( A ), Atf3 ( B ), Ero1-lβ ( C ), Chop ( D ) in Tr-J . Expression levels in sciatic nerves were measured by quantitative <t>RT–PCR</t> using <t>SYBR®</t> Green in triplicates and normalized to β-Actin. All UPR markers except
    Iq Sybr Green Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 75704 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iq sybr green supermix/product/Bio-Rad
    Average 99 stars, based on 75704 article reviews
    Price from $9.99 to $1999.99
    iq sybr green supermix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    TaKaRa primescript rt master mix
    Activation of BiP ( A ), Atf3 ( B ), Ero1-lβ ( C ), Chop ( D ) in Tr-J . Expression levels in sciatic nerves were measured by quantitative <t>RT–PCR</t> using <t>SYBR®</t> Green in triplicates and normalized to β-Actin. All UPR markers except
    Primescript Rt Master Mix, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 12317 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primescript rt master mix/product/TaKaRa
    Average 99 stars, based on 12317 article reviews
    Price from $9.99 to $1999.99
    primescript rt master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    TaKaRa primescript rt reagent kit
    Activation of BiP ( A ), Atf3 ( B ), Ero1-lβ ( C ), Chop ( D ) in Tr-J . Expression levels in sciatic nerves were measured by quantitative <t>RT–PCR</t> using <t>SYBR®</t> Green in triplicates and normalized to β-Actin. All UPR markers except
    Primescript Rt Reagent Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 72258 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primescript rt reagent kit/product/TaKaRa
    Average 99 stars, based on 72258 article reviews
    Price from $9.99 to $1999.99
    primescript rt reagent kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher mgcl2
    Activation of BiP ( A ), Atf3 ( B ), Ero1-lβ ( C ), Chop ( D ) in Tr-J . Expression levels in sciatic nerves were measured by quantitative <t>RT–PCR</t> using <t>SYBR®</t> Green in triplicates and normalized to β-Actin. All UPR markers except
    Mgcl2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 104037 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mgcl2/product/Thermo Fisher
    Average 99 stars, based on 104037 article reviews
    Price from $9.99 to $1999.99
    mgcl2 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher taqman gene expression master mix
    Gene expression analysis of IL-6 (a) and <t>TNF-α</t> (b) in the hippocampi of TMEV-infected mice treated with control liposomes or clodronate-containing liposomes. Mice were treated with control or clodronate-containing liposomes as described in the Methods and hippocampi were harvested at days 2 and 3 post infection (6 mice per group). Real time PCR for the detection of IL-6 (a) and TNF-α (b) was performed using <t>TaqMan</t> PCR as described in the Methods. Fold changes were calculated using the ΔΔCT method, in which fold change data are represented as 2−ΔΔCT. Error bars depict the SEM ΔCT values
    Taqman Gene Expression Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 21089 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman gene expression master mix/product/Thermo Fisher
    Average 99 stars, based on 21089 article reviews
    Price from $9.99 to $1999.99
    taqman gene expression master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher fast sybr green master mix
    Gene expression analysis of IL-6 (a) and <t>TNF-α</t> (b) in the hippocampi of TMEV-infected mice treated with control liposomes or clodronate-containing liposomes. Mice were treated with control or clodronate-containing liposomes as described in the Methods and hippocampi were harvested at days 2 and 3 post infection (6 mice per group). Real time PCR for the detection of IL-6 (a) and TNF-α (b) was performed using <t>TaqMan</t> PCR as described in the Methods. Fold changes were calculated using the ΔΔCT method, in which fold change data are represented as 2−ΔΔCT. Error bars depict the SEM ΔCT values
    Fast Sybr Green Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 28777 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fast sybr green master mix/product/Thermo Fisher
    Average 99 stars, based on 28777 article reviews
    Price from $9.99 to $1999.99
    fast sybr green master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen omniscript rt kit
    Analysis of EIAV plasmid ( A ) Blast search revealed for sequences above 2.5 kb the presence of a CAT (Chloramphenicolacetyltransferase). For the longest sequence UN_TR272_len_4326 a second bacterial resistance (AmpR-) conferring a resistance to ß-Lactam antibiotics such as Ampicillin. ( B ) Plasmid map of the predicted <t>Omniscript</t> RT Kit expression plasmid which was identified as the source of the EIAV pol . Qiagen confirmed that such a plasmid is used for their Omniscript product. The EIAV pol sequence is in-frame with a histidin-tag, flanked by a BamHI and a HindIII restriction site and followed by a lambda t0 terminator. Further downstream a inactive CmR resistance followed by a rrnB T1 Terminator. Further upstream a AmpR promoter together with a ß-lactamase can be found. In front of the Insert is a Ribosomal Binding Site (RBS) with a T5 promoter to ensure strong transcription. The system is induced by a lac operator. The backbone of the plasmid seems to be pDS56/RBSII and therefore the origin of replication may be pBR332. The whole plasmid with the name p6EIAV-RT was created by Dr. Stuart J LeGrice in 1991.
    Omniscript Rt Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 12872 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/omniscript rt kit/product/Qiagen
    Average 99 stars, based on 12872 article reviews
    Price from $9.99 to $1999.99
    omniscript rt kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript iii first strand synthesis supermix
    Analysis of EIAV plasmid ( A ) Blast search revealed for sequences above 2.5 kb the presence of a CAT (Chloramphenicolacetyltransferase). For the longest sequence UN_TR272_len_4326 a second bacterial resistance (AmpR-) conferring a resistance to ß-Lactam antibiotics such as Ampicillin. ( B ) Plasmid map of the predicted <t>Omniscript</t> RT Kit expression plasmid which was identified as the source of the EIAV pol . Qiagen confirmed that such a plasmid is used for their Omniscript product. The EIAV pol sequence is in-frame with a histidin-tag, flanked by a BamHI and a HindIII restriction site and followed by a lambda t0 terminator. Further downstream a inactive CmR resistance followed by a rrnB T1 Terminator. Further upstream a AmpR promoter together with a ß-lactamase can be found. In front of the Insert is a Ribosomal Binding Site (RBS) with a T5 promoter to ensure strong transcription. The system is induced by a lac operator. The backbone of the plasmid seems to be pDS56/RBSII and therefore the origin of replication may be pBR332. The whole plasmid with the name p6EIAV-RT was created by Dr. Stuart J LeGrice in 1991.
    Superscript Iii First Strand Synthesis Supermix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 11389 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii first strand synthesis supermix/product/Thermo Fisher
    Average 99 stars, based on 11389 article reviews
    Price from $9.99 to $1999.99
    superscript iii first strand synthesis supermix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    95
    Thermo Fisher dntp mix
    Analysis of EIAV plasmid ( A ) Blast search revealed for sequences above 2.5 kb the presence of a CAT (Chloramphenicolacetyltransferase). For the longest sequence UN_TR272_len_4326 a second bacterial resistance (AmpR-) conferring a resistance to ß-Lactam antibiotics such as Ampicillin. ( B ) Plasmid map of the predicted <t>Omniscript</t> RT Kit expression plasmid which was identified as the source of the EIAV pol . Qiagen confirmed that such a plasmid is used for their Omniscript product. The EIAV pol sequence is in-frame with a histidin-tag, flanked by a BamHI and a HindIII restriction site and followed by a lambda t0 terminator. Further downstream a inactive CmR resistance followed by a rrnB T1 Terminator. Further upstream a AmpR promoter together with a ß-lactamase can be found. In front of the Insert is a Ribosomal Binding Site (RBS) with a T5 promoter to ensure strong transcription. The system is induced by a lac operator. The backbone of the plasmid seems to be pDS56/RBSII and therefore the origin of replication may be pBR332. The whole plasmid with the name p6EIAV-RT was created by Dr. Stuart J LeGrice in 1991.
    Dntp Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 14684 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp mix/product/Thermo Fisher
    Average 95 stars, based on 14684 article reviews
    Price from $9.99 to $1999.99
    dntp mix - by Bioz Stars, 2020-09
    95/100 stars
      Buy from Supplier

    99
    Thermo Fisher platinum taq dna polymerase
    Analysis of EIAV plasmid ( A ) Blast search revealed for sequences above 2.5 kb the presence of a CAT (Chloramphenicolacetyltransferase). For the longest sequence UN_TR272_len_4326 a second bacterial resistance (AmpR-) conferring a resistance to ß-Lactam antibiotics such as Ampicillin. ( B ) Plasmid map of the predicted <t>Omniscript</t> RT Kit expression plasmid which was identified as the source of the EIAV pol . Qiagen confirmed that such a plasmid is used for their Omniscript product. The EIAV pol sequence is in-frame with a histidin-tag, flanked by a BamHI and a HindIII restriction site and followed by a lambda t0 terminator. Further downstream a inactive CmR resistance followed by a rrnB T1 Terminator. Further upstream a AmpR promoter together with a ß-lactamase can be found. In front of the Insert is a Ribosomal Binding Site (RBS) with a T5 promoter to ensure strong transcription. The system is induced by a lac operator. The backbone of the plasmid seems to be pDS56/RBSII and therefore the origin of replication may be pBR332. The whole plasmid with the name p6EIAV-RT was created by Dr. Stuart J LeGrice in 1991.
    Platinum Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 25090 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/platinum taq dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 25090 article reviews
    Price from $9.99 to $1999.99
    platinum taq dna polymerase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher dtt
    Analysis of EIAV plasmid ( A ) Blast search revealed for sequences above 2.5 kb the presence of a CAT (Chloramphenicolacetyltransferase). For the longest sequence UN_TR272_len_4326 a second bacterial resistance (AmpR-) conferring a resistance to ß-Lactam antibiotics such as Ampicillin. ( B ) Plasmid map of the predicted <t>Omniscript</t> RT Kit expression plasmid which was identified as the source of the EIAV pol . Qiagen confirmed that such a plasmid is used for their Omniscript product. The EIAV pol sequence is in-frame with a histidin-tag, flanked by a BamHI and a HindIII restriction site and followed by a lambda t0 terminator. Further downstream a inactive CmR resistance followed by a rrnB T1 Terminator. Further upstream a AmpR promoter together with a ß-lactamase can be found. In front of the Insert is a Ribosomal Binding Site (RBS) with a T5 promoter to ensure strong transcription. The system is induced by a lac operator. The backbone of the plasmid seems to be pDS56/RBSII and therefore the origin of replication may be pBR332. The whole plasmid with the name p6EIAV-RT was created by Dr. Stuart J LeGrice in 1991.
    Dtt, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 31034 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dtt/product/Thermo Fisher
    Average 99 stars, based on 31034 article reviews
    Price from $9.99 to $1999.99
    dtt - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher maxima sybr green qpcr master mix
    Relative mRNA expression of barrier function and nutrient sensing genes in different segments of intestinal mucosa in chickens injected in ovo with GOS. The panel includes genes encoding mucin, (A) MUC6 ; tight junctions components, (B) CLDN1 and (C) TJAP1 ; free fatty acid receptors, (D) FFAR2 and (E) FFAR4 ; and glucose transporters, (F) GLUT1 , (G) GLUT2 and (H) GLUT5 . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum and CEC–caecum. In ovo treatment groups: control (white bars)–injected in ovo with physiological saline; GOS (black bars)–injected in ovo with galactooligosaccharides. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) were collected from chickens on day 42 post-hatching. <t>RT-qPCR</t> data were generated with custom-designed primers used for amplification with <t>SYBR</t> green dye; Glucose-6-phosphate dehydrogenase ( G6PDH ) and beta-actin ( ACTB ) were used as reference genes; relative gene expression calculated as 2 –ΔΔCt; Two-way ANOVA with a post hoc HSD Tukey test was used to compare the groups. Asterisk indicates pair-wise significant differences ( P
    Maxima Sybr Green Qpcr Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 6413 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maxima sybr green qpcr master mix/product/Thermo Fisher
    Average 99 stars, based on 6413 article reviews
    Price from $9.99 to $1999.99
    maxima sybr green qpcr master mix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Qiagen onestep rt pcr kit
    Relative mRNA expression of barrier function and nutrient sensing genes in different segments of intestinal mucosa in chickens injected in ovo with GOS. The panel includes genes encoding mucin, (A) MUC6 ; tight junctions components, (B) CLDN1 and (C) TJAP1 ; free fatty acid receptors, (D) FFAR2 and (E) FFAR4 ; and glucose transporters, (F) GLUT1 , (G) GLUT2 and (H) GLUT5 . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum and CEC–caecum. In ovo treatment groups: control (white bars)–injected in ovo with physiological saline; GOS (black bars)–injected in ovo with galactooligosaccharides. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) were collected from chickens on day 42 post-hatching. <t>RT-qPCR</t> data were generated with custom-designed primers used for amplification with <t>SYBR</t> green dye; Glucose-6-phosphate dehydrogenase ( G6PDH ) and beta-actin ( ACTB ) were used as reference genes; relative gene expression calculated as 2 –ΔΔCt; Two-way ANOVA with a post hoc HSD Tukey test was used to compare the groups. Asterisk indicates pair-wise significant differences ( P
    Onestep Rt Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 12383 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/onestep rt pcr kit/product/Qiagen
    Average 99 stars, based on 12383 article reviews
    Price from $9.99 to $1999.99
    onestep rt pcr kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    93
    Promega rnasin
    Relative mRNA expression of barrier function and nutrient sensing genes in different segments of intestinal mucosa in chickens injected in ovo with GOS. The panel includes genes encoding mucin, (A) MUC6 ; tight junctions components, (B) CLDN1 and (C) TJAP1 ; free fatty acid receptors, (D) FFAR2 and (E) FFAR4 ; and glucose transporters, (F) GLUT1 , (G) GLUT2 and (H) GLUT5 . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum and CEC–caecum. In ovo treatment groups: control (white bars)–injected in ovo with physiological saline; GOS (black bars)–injected in ovo with galactooligosaccharides. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) were collected from chickens on day 42 post-hatching. <t>RT-qPCR</t> data were generated with custom-designed primers used for amplification with <t>SYBR</t> green dye; Glucose-6-phosphate dehydrogenase ( G6PDH ) and beta-actin ( ACTB ) were used as reference genes; relative gene expression calculated as 2 –ΔΔCt; Two-way ANOVA with a post hoc HSD Tukey test was used to compare the groups. Asterisk indicates pair-wise significant differences ( P
    Rnasin, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 22066 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnasin/product/Promega
    Average 93 stars, based on 22066 article reviews
    Price from $9.99 to $1999.99
    rnasin - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher taqman universal master mix ii
    <t>RT-qPCR</t> on selected miRNAs in bulk and CSCs cells and exosomes Expression was assessed by <t>TaqMan</t> miRNA assays. Cp values from each assay are compared between samples ( n = 3).
    Taqman Universal Master Mix Ii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 7800 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman universal master mix ii/product/Thermo Fisher
    Average 99 stars, based on 7800 article reviews
    Price from $9.99 to $1999.99
    taqman universal master mix ii - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher maxima first strand cdna synthesis kit
    Expression pattern of chemokines and cytokines in the brain. C57BL/6 mice were infected via the aerosol route with M. tuberculosis H37Rv and 30 days later with 1 × 10 5 pRBCs i.p. Perfused brains were collected on day 6 after Pb ANKA infection for RNA isolation followed by <t>cDNA</t> synthesis. <t>qRT-PCR</t> was used to analyze cyto- and chemokine expression relative to expression of the HPRT housekeeping gene. Symbols and bars represent individual mice and means, respectively. Data from two independent experiments are shown ( n = 8 to 10, mean ± SD, Kruskal-Wallis test with Dunn′s posttest). *, P
    Maxima First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 9764 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maxima first strand cdna synthesis kit/product/Thermo Fisher
    Average 99 stars, based on 9764 article reviews
    Price from $9.99 to $1999.99
    maxima first strand cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher amplitaq gold dna polymerase
    Expression pattern of chemokines and cytokines in the brain. C57BL/6 mice were infected via the aerosol route with M. tuberculosis H37Rv and 30 days later with 1 × 10 5 pRBCs i.p. Perfused brains were collected on day 6 after Pb ANKA infection for RNA isolation followed by <t>cDNA</t> synthesis. <t>qRT-PCR</t> was used to analyze cyto- and chemokine expression relative to expression of the HPRT housekeeping gene. Symbols and bars represent individual mice and means, respectively. Data from two independent experiments are shown ( n = 8 to 10, mean ± SD, Kruskal-Wallis test with Dunn′s posttest). *, P
    Amplitaq Gold Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 13081 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplitaq gold dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 13081 article reviews
    Price from $9.99 to $1999.99
    amplitaq gold dna polymerase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher rnase inhibitor
    Expression pattern of chemokines and cytokines in the brain. C57BL/6 mice were infected via the aerosol route with M. tuberculosis H37Rv and 30 days later with 1 × 10 5 pRBCs i.p. Perfused brains were collected on day 6 after Pb ANKA infection for RNA isolation followed by <t>cDNA</t> synthesis. <t>qRT-PCR</t> was used to analyze cyto- and chemokine expression relative to expression of the HPRT housekeeping gene. Symbols and bars represent individual mice and means, respectively. Data from two independent experiments are shown ( n = 8 to 10, mean ± SD, Kruskal-Wallis test with Dunn′s posttest). *, P
    Rnase Inhibitor, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 23259 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase inhibitor/product/Thermo Fisher
    Average 99 stars, based on 23259 article reviews
    Price from $9.99 to $1999.99
    rnase inhibitor - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript iii reverse transcriptase
    Localization of M3 expression in lung, spleen, and lymph node. Detection of M3 <t>RNA</t> in lung and spleen by in situ hybridization in MHV-68 infected wood mice. A, B: Lung, day 7 p.i.: (A) M3 transcripts detected within lymphocytes in perivascular infiltrates (white arrows) and lymphocytes attached to the endothelial wall (black arrow). A: artery; (B) No signal detected with sense-strand probe (negative control). C, D: Lung, day 12 p.i.: (C) Perivascular and peribronchial lymphocyte infiltrations containing numerous M3 -positive lymphocytes. A, artery; B, bronchioles; (D) Peribronchial, focal follicle-like lymphocyte accumulation with numerous M3 -positive lymphocytes. B, bronchiolus. (E) Bronchial lymph node, day 7 p.i.; lymphocytes showing M3 transcripts are present in lymphatic follicles (within germinal center cells). F, follicle. (F) Spleen, day 14 p.i.; follicle with numerous M3 RNA-positive lymphocytes in the germinal center. Results are representative of numerous tissue sections analyzed from <t>three</t> infected wood mice.
    Superscript Iii Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 90401 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 90401 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    97
    Thermo Fisher dntps
    Localization of M3 expression in lung, spleen, and lymph node. Detection of M3 <t>RNA</t> in lung and spleen by in situ hybridization in MHV-68 infected wood mice. A, B: Lung, day 7 p.i.: (A) M3 transcripts detected within lymphocytes in perivascular infiltrates (white arrows) and lymphocytes attached to the endothelial wall (black arrow). A: artery; (B) No signal detected with sense-strand probe (negative control). C, D: Lung, day 12 p.i.: (C) Perivascular and peribronchial lymphocyte infiltrations containing numerous M3 -positive lymphocytes. A, artery; B, bronchioles; (D) Peribronchial, focal follicle-like lymphocyte accumulation with numerous M3 -positive lymphocytes. B, bronchiolus. (E) Bronchial lymph node, day 7 p.i.; lymphocytes showing M3 transcripts are present in lymphatic follicles (within germinal center cells). F, follicle. (F) Spleen, day 14 p.i.; follicle with numerous M3 RNA-positive lymphocytes in the germinal center. Results are representative of numerous tissue sections analyzed from <t>three</t> infected wood mice.
    Dntps, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 52680 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntps/product/Thermo Fisher
    Average 97 stars, based on 52680 article reviews
    Price from $9.99 to $1999.99
    dntps - by Bioz Stars, 2020-09
    97/100 stars
      Buy from Supplier

    99
    Bio-Rad ssoadvanced universal sybr green supermix
    Localization of M3 expression in lung, spleen, and lymph node. Detection of M3 <t>RNA</t> in lung and spleen by in situ hybridization in MHV-68 infected wood mice. A, B: Lung, day 7 p.i.: (A) M3 transcripts detected within lymphocytes in perivascular infiltrates (white arrows) and lymphocytes attached to the endothelial wall (black arrow). A: artery; (B) No signal detected with sense-strand probe (negative control). C, D: Lung, day 12 p.i.: (C) Perivascular and peribronchial lymphocyte infiltrations containing numerous M3 -positive lymphocytes. A, artery; B, bronchioles; (D) Peribronchial, focal follicle-like lymphocyte accumulation with numerous M3 -positive lymphocytes. B, bronchiolus. (E) Bronchial lymph node, day 7 p.i.; lymphocytes showing M3 transcripts are present in lymphatic follicles (within germinal center cells). F, follicle. (F) Spleen, day 14 p.i.; follicle with numerous M3 RNA-positive lymphocytes in the germinal center. Results are representative of numerous tissue sections analyzed from <t>three</t> infected wood mice.
    Ssoadvanced Universal Sybr Green Supermix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 8689 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ssoadvanced universal sybr green supermix/product/Bio-Rad
    Average 99 stars, based on 8689 article reviews
    Price from $9.99 to $1999.99
    ssoadvanced universal sybr green supermix - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Activation of BiP ( A ), Atf3 ( B ), Ero1-lβ ( C ), Chop ( D ) in Tr-J . Expression levels in sciatic nerves were measured by quantitative RT–PCR using SYBR® Green in triplicates and normalized to β-Actin. All UPR markers except

    Journal: Human Molecular Genetics

    Article Title: Curcumin facilitates a transitory cellular stress response in Trembler-J mice

    doi: 10.1093/hmg/ddt318

    Figure Lengend Snippet: Activation of BiP ( A ), Atf3 ( B ), Ero1-lβ ( C ), Chop ( D ) in Tr-J . Expression levels in sciatic nerves were measured by quantitative RT–PCR using SYBR® Green in triplicates and normalized to β-Actin. All UPR markers except

    Article Snippet: The cDNA was then PCR-amplified in triplicates and confirmed in two independent experiments by SYBR® Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) using 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) on different animal groups to avoid biases.

    Techniques: Activation Assay, Expressing, Quantitative RT-PCR, SYBR Green Assay

    Gene expression analysis of IL-6 (a) and TNF-α (b) in the hippocampi of TMEV-infected mice treated with control liposomes or clodronate-containing liposomes. Mice were treated with control or clodronate-containing liposomes as described in the Methods and hippocampi were harvested at days 2 and 3 post infection (6 mice per group). Real time PCR for the detection of IL-6 (a) and TNF-α (b) was performed using TaqMan PCR as described in the Methods. Fold changes were calculated using the ΔΔCT method, in which fold change data are represented as 2−ΔΔCT. Error bars depict the SEM ΔCT values

    Journal: Journal of neurovirology

    Article Title: The Immune Response to Picornavirus Infection and the Effect of Immune Manipulation on Acute Seizures

    doi: 10.1007/s13365-018-0636-2

    Figure Lengend Snippet: Gene expression analysis of IL-6 (a) and TNF-α (b) in the hippocampi of TMEV-infected mice treated with control liposomes or clodronate-containing liposomes. Mice were treated with control or clodronate-containing liposomes as described in the Methods and hippocampi were harvested at days 2 and 3 post infection (6 mice per group). Real time PCR for the detection of IL-6 (a) and TNF-α (b) was performed using TaqMan PCR as described in the Methods. Fold changes were calculated using the ΔΔCT method, in which fold change data are represented as 2−ΔΔCT. Error bars depict the SEM ΔCT values

    Article Snippet: Real time PCR for the detection of IL-6 and TNF-α was performed using TaqMan Gene Expression Assays (Life Technologies) and TaqMan Gene Expression Master Mix (Life Technologies) in a 20 μl reaction volume containing 1 μl of cDNA template.

    Techniques: Expressing, Infection, Mouse Assay, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    Analysis of EIAV plasmid ( A ) Blast search revealed for sequences above 2.5 kb the presence of a CAT (Chloramphenicolacetyltransferase). For the longest sequence UN_TR272_len_4326 a second bacterial resistance (AmpR-) conferring a resistance to ß-Lactam antibiotics such as Ampicillin. ( B ) Plasmid map of the predicted Omniscript RT Kit expression plasmid which was identified as the source of the EIAV pol . Qiagen confirmed that such a plasmid is used for their Omniscript product. The EIAV pol sequence is in-frame with a histidin-tag, flanked by a BamHI and a HindIII restriction site and followed by a lambda t0 terminator. Further downstream a inactive CmR resistance followed by a rrnB T1 Terminator. Further upstream a AmpR promoter together with a ß-lactamase can be found. In front of the Insert is a Ribosomal Binding Site (RBS) with a T5 promoter to ensure strong transcription. The system is induced by a lac operator. The backbone of the plasmid seems to be pDS56/RBSII and therefore the origin of replication may be pBR332. The whole plasmid with the name p6EIAV-RT was created by Dr. Stuart J LeGrice in 1991.

    Journal: Scientific Reports

    Article Title: Plasmid DNA contaminant in molecular reagents

    doi: 10.1038/s41598-019-38733-1

    Figure Lengend Snippet: Analysis of EIAV plasmid ( A ) Blast search revealed for sequences above 2.5 kb the presence of a CAT (Chloramphenicolacetyltransferase). For the longest sequence UN_TR272_len_4326 a second bacterial resistance (AmpR-) conferring a resistance to ß-Lactam antibiotics such as Ampicillin. ( B ) Plasmid map of the predicted Omniscript RT Kit expression plasmid which was identified as the source of the EIAV pol . Qiagen confirmed that such a plasmid is used for their Omniscript product. The EIAV pol sequence is in-frame with a histidin-tag, flanked by a BamHI and a HindIII restriction site and followed by a lambda t0 terminator. Further downstream a inactive CmR resistance followed by a rrnB T1 Terminator. Further upstream a AmpR promoter together with a ß-lactamase can be found. In front of the Insert is a Ribosomal Binding Site (RBS) with a T5 promoter to ensure strong transcription. The system is induced by a lac operator. The backbone of the plasmid seems to be pDS56/RBSII and therefore the origin of replication may be pBR332. The whole plasmid with the name p6EIAV-RT was created by Dr. Stuart J LeGrice in 1991.

    Article Snippet: Total DNA and RNA had then been purified with the Roche High Pure Viral Nucleic Acid Kit (Roche, Mannheim, Germany) and reverse transcribed with either iScript cDNA Synthesis Kit (Bio-Rad, Hercules, USA) or Omniscript RT Kit (Qiagen, Hildesheim, Germany) according to the manufactures instructions.

    Techniques: Plasmid Preparation, Sequencing, Expressing, Binding Assay

    Sample testing of environmental equipment for EIAV. Enriched DNA and RNA tested without ( A ) and with Reverse-Transcription with the Omniscript RT Kit ( B ). When reverse transcribing the samples with Omniscript RT Kit (Qiagen, Hildesheim, Germany), all samples turned positive including the non-template control of the reverse transcription. The negative control of the amplification (Lane B7) was negative and the positive control with the EIAV plasmid was positive (B8). ( A ) Testing of laboratory environment and two patient samples for EIAV. 1: Ultrafiltrated DNA of Pharyngeal lavage Healthy Volunteer C, 2: Ultrafiltrated DNA of Urine Healthy Volunteer J, 3: Ultrafiltrated DNA of Pharyngeal lavage Volunteer J, 4: Adenovirus DNA, 5: Influenza strain A/Puerto Rico/8/1934 H1N1 DNA, 6: EIAV39 cDNA, 7: EIAV Packaging Plasmid containing gag and pol region (positive control), 8: Mili-Q Water, 9: Distilled Ultrafiltrated Mili-Q Water, 10: Gibco Dulbecco’s Modified Eagle Medium, 11: Gibco Trypsin-EDTA, 12. Gibco Pencillin-Streptomycin Testing the Distilled Ultrafiltrated Mili-Q Water counted also as negative control. ( B ) Testing of samples after Reverse Transcription with Omniscript RT-Kit: 1: Ultrafiltrated DNA of Pharyngeal lavage Healthy Volunteer C, 2: Ultrafiltrated DNA of Urine Healthy Volunteer J, 3: Ultrafiltrated DNA of Pharyngeal lavage Volunteer J, 4: Adenovirus DNA, 5: Influenza strain A/Puerto Rico/8/1934 H1N1 DNA, 6: Non-Template control of Omniscript RT-Kit (1 µl of enclosed Nuclease-free Water as Template), 7: Non-template control of PCR, 8: EIAV Packaging Plasmid containing gag and pol region (positive control). A Marker on the left side was excluded as the lane was overloaded. Additionally, another experiment below the upper experiment ( A ) was excluded. Raw Data is available in the Supplementary File.

    Journal: Scientific Reports

    Article Title: Plasmid DNA contaminant in molecular reagents

    doi: 10.1038/s41598-019-38733-1

    Figure Lengend Snippet: Sample testing of environmental equipment for EIAV. Enriched DNA and RNA tested without ( A ) and with Reverse-Transcription with the Omniscript RT Kit ( B ). When reverse transcribing the samples with Omniscript RT Kit (Qiagen, Hildesheim, Germany), all samples turned positive including the non-template control of the reverse transcription. The negative control of the amplification (Lane B7) was negative and the positive control with the EIAV plasmid was positive (B8). ( A ) Testing of laboratory environment and two patient samples for EIAV. 1: Ultrafiltrated DNA of Pharyngeal lavage Healthy Volunteer C, 2: Ultrafiltrated DNA of Urine Healthy Volunteer J, 3: Ultrafiltrated DNA of Pharyngeal lavage Volunteer J, 4: Adenovirus DNA, 5: Influenza strain A/Puerto Rico/8/1934 H1N1 DNA, 6: EIAV39 cDNA, 7: EIAV Packaging Plasmid containing gag and pol region (positive control), 8: Mili-Q Water, 9: Distilled Ultrafiltrated Mili-Q Water, 10: Gibco Dulbecco’s Modified Eagle Medium, 11: Gibco Trypsin-EDTA, 12. Gibco Pencillin-Streptomycin Testing the Distilled Ultrafiltrated Mili-Q Water counted also as negative control. ( B ) Testing of samples after Reverse Transcription with Omniscript RT-Kit: 1: Ultrafiltrated DNA of Pharyngeal lavage Healthy Volunteer C, 2: Ultrafiltrated DNA of Urine Healthy Volunteer J, 3: Ultrafiltrated DNA of Pharyngeal lavage Volunteer J, 4: Adenovirus DNA, 5: Influenza strain A/Puerto Rico/8/1934 H1N1 DNA, 6: Non-Template control of Omniscript RT-Kit (1 µl of enclosed Nuclease-free Water as Template), 7: Non-template control of PCR, 8: EIAV Packaging Plasmid containing gag and pol region (positive control). A Marker on the left side was excluded as the lane was overloaded. Additionally, another experiment below the upper experiment ( A ) was excluded. Raw Data is available in the Supplementary File.

    Article Snippet: Total DNA and RNA had then been purified with the Roche High Pure Viral Nucleic Acid Kit (Roche, Mannheim, Germany) and reverse transcribed with either iScript cDNA Synthesis Kit (Bio-Rad, Hercules, USA) or Omniscript RT Kit (Qiagen, Hildesheim, Germany) according to the manufactures instructions.

    Techniques: Negative Control, Amplification, Positive Control, Plasmid Preparation, Modification, Polymerase Chain Reaction, Marker

    Relative mRNA expression of barrier function and nutrient sensing genes in different segments of intestinal mucosa in chickens injected in ovo with GOS. The panel includes genes encoding mucin, (A) MUC6 ; tight junctions components, (B) CLDN1 and (C) TJAP1 ; free fatty acid receptors, (D) FFAR2 and (E) FFAR4 ; and glucose transporters, (F) GLUT1 , (G) GLUT2 and (H) GLUT5 . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum and CEC–caecum. In ovo treatment groups: control (white bars)–injected in ovo with physiological saline; GOS (black bars)–injected in ovo with galactooligosaccharides. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) were collected from chickens on day 42 post-hatching. RT-qPCR data were generated with custom-designed primers used for amplification with SYBR green dye; Glucose-6-phosphate dehydrogenase ( G6PDH ) and beta-actin ( ACTB ) were used as reference genes; relative gene expression calculated as 2 –ΔΔCt; Two-way ANOVA with a post hoc HSD Tukey test was used to compare the groups. Asterisk indicates pair-wise significant differences ( P

    Journal: PLoS ONE

    Article Title: Modulation of microbial communities and mucosal gene expression in chicken intestines after galactooligosaccharides delivery In Ovo

    doi: 10.1371/journal.pone.0212318

    Figure Lengend Snippet: Relative mRNA expression of barrier function and nutrient sensing genes in different segments of intestinal mucosa in chickens injected in ovo with GOS. The panel includes genes encoding mucin, (A) MUC6 ; tight junctions components, (B) CLDN1 and (C) TJAP1 ; free fatty acid receptors, (D) FFAR2 and (E) FFAR4 ; and glucose transporters, (F) GLUT1 , (G) GLUT2 and (H) GLUT5 . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum and CEC–caecum. In ovo treatment groups: control (white bars)–injected in ovo with physiological saline; GOS (black bars)–injected in ovo with galactooligosaccharides. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) were collected from chickens on day 42 post-hatching. RT-qPCR data were generated with custom-designed primers used for amplification with SYBR green dye; Glucose-6-phosphate dehydrogenase ( G6PDH ) and beta-actin ( ACTB ) were used as reference genes; relative gene expression calculated as 2 –ΔΔCt; Two-way ANOVA with a post hoc HSD Tukey test was used to compare the groups. Asterisk indicates pair-wise significant differences ( P

    Article Snippet: A total reaction volume of 10 μl in a 384-well plate format contained 5 μl Maxima SYBR Green qPCR Master Mix (Thermo Scientific/Fermentas, Vilnius, Lithuania), 0.2 μM of each primer, specific to 16s rDNA of Bifidobacterium spp. (F: GCGTGCTTAACACATGCAAGTC , R: CACCCGTTTCCAGGAGCTATT ) [ ], Lactobacillus spp. (F: AGCAGTAGGGAATCTTCCA , R: CACCGCTACACATGGAG ) [ , ] or universal bacteria (F: ACTCCTACGGGAGGCAGCAGT , R: GTATTACCGCGGCTGCTGGCAC ) [ ] and 2 ng of bacterial DNA template.

    Techniques: Expressing, Injection, In Ovo, Capillary Electrochromatography, Incubation, Quantitative RT-PCR, Generated, Amplification, SYBR Green Assay

    A heat map of hierarchically clustered gene expression in different segments of intestinal mucosa in chicken treated with GOS in ovo . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum, and CEC–caecum. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) collected from chickens on day 42 post-hatching. RT-qPCR data were generated with custom-designed primers used for amplification with SYBR green dye; Glucose-6-phosphate dehydrogenase (G6PDH) and beta-actin (ACTB) were used as reference genes; relative gene expression (fold change) calculated as 2 –ΔΔCt . A Multiexperiment Viewer version 4.9 (MeV) was used for constructing a Hierarchical Cluster Tree based on fold change. Colours (red-black-green) show relative gene expression changes in GOS vs. C (red: down-regulated, green: up-regulated genes).

    Journal: PLoS ONE

    Article Title: Modulation of microbial communities and mucosal gene expression in chicken intestines after galactooligosaccharides delivery In Ovo

    doi: 10.1371/journal.pone.0212318

    Figure Lengend Snippet: A heat map of hierarchically clustered gene expression in different segments of intestinal mucosa in chicken treated with GOS in ovo . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum, and CEC–caecum. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) collected from chickens on day 42 post-hatching. RT-qPCR data were generated with custom-designed primers used for amplification with SYBR green dye; Glucose-6-phosphate dehydrogenase (G6PDH) and beta-actin (ACTB) were used as reference genes; relative gene expression (fold change) calculated as 2 –ΔΔCt . A Multiexperiment Viewer version 4.9 (MeV) was used for constructing a Hierarchical Cluster Tree based on fold change. Colours (red-black-green) show relative gene expression changes in GOS vs. C (red: down-regulated, green: up-regulated genes).

    Article Snippet: A total reaction volume of 10 μl in a 384-well plate format contained 5 μl Maxima SYBR Green qPCR Master Mix (Thermo Scientific/Fermentas, Vilnius, Lithuania), 0.2 μM of each primer, specific to 16s rDNA of Bifidobacterium spp. (F: GCGTGCTTAACACATGCAAGTC , R: CACCCGTTTCCAGGAGCTATT ) [ ], Lactobacillus spp. (F: AGCAGTAGGGAATCTTCCA , R: CACCGCTACACATGGAG ) [ , ] or universal bacteria (F: ACTCCTACGGGAGGCAGCAGT , R: GTATTACCGCGGCTGCTGGCAC ) [ ] and 2 ng of bacterial DNA template.

    Techniques: Expressing, In Ovo, Capillary Electrochromatography, Injection, Incubation, Quantitative RT-PCR, Generated, Amplification, SYBR Green Assay

    Relative mRNA expression of intestinal immune-related genes in different segments of intestinal mucosa in chickens injected in ovo with GOS. The panel includes genes encoding cytokines, (A) IL-1β , (B) IL10 and (C) IL12p40 ; and host defence peptides, (D) AvBD1 and (E) CATHL . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum, and CEC–caecum. In ovo treatment groups: control (white bars), injected in ovo with physiological saline; GOS (black bars)–injected in ovo with galactooligosaccharides. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) were collected from chickens on day 42 post-hatching. RT-qPCR data were generated with custom-designed primers used for amplification with SYBR green dye; Glucose-6-phosphate dehydrogenase ( G6PDH ) and beta-actin ( ACTB ) were used as reference genes; relative gene expression calculated as 2 –ΔΔCt; Two-way ANOVA with post hoc HSD Tukey test was used to compare the groups. Asterisk indicates pair-wise significant differences ( P

    Journal: PLoS ONE

    Article Title: Modulation of microbial communities and mucosal gene expression in chicken intestines after galactooligosaccharides delivery In Ovo

    doi: 10.1371/journal.pone.0212318

    Figure Lengend Snippet: Relative mRNA expression of intestinal immune-related genes in different segments of intestinal mucosa in chickens injected in ovo with GOS. The panel includes genes encoding cytokines, (A) IL-1β , (B) IL10 and (C) IL12p40 ; and host defence peptides, (D) AvBD1 and (E) CATHL . Intestinal segments: DUO–duodenum, JEJ–jejunum, ILE–ileum, and CEC–caecum. In ovo treatment groups: control (white bars), injected in ovo with physiological saline; GOS (black bars)–injected in ovo with galactooligosaccharides. In ovo injection was carried out on day 12 of egg incubation. Intestinal samples (n = 10) were collected from chickens on day 42 post-hatching. RT-qPCR data were generated with custom-designed primers used for amplification with SYBR green dye; Glucose-6-phosphate dehydrogenase ( G6PDH ) and beta-actin ( ACTB ) were used as reference genes; relative gene expression calculated as 2 –ΔΔCt; Two-way ANOVA with post hoc HSD Tukey test was used to compare the groups. Asterisk indicates pair-wise significant differences ( P

    Article Snippet: A total reaction volume of 10 μl in a 384-well plate format contained 5 μl Maxima SYBR Green qPCR Master Mix (Thermo Scientific/Fermentas, Vilnius, Lithuania), 0.2 μM of each primer, specific to 16s rDNA of Bifidobacterium spp. (F: GCGTGCTTAACACATGCAAGTC , R: CACCCGTTTCCAGGAGCTATT ) [ ], Lactobacillus spp. (F: AGCAGTAGGGAATCTTCCA , R: CACCGCTACACATGGAG ) [ , ] or universal bacteria (F: ACTCCTACGGGAGGCAGCAGT , R: GTATTACCGCGGCTGCTGGCAC ) [ ] and 2 ng of bacterial DNA template.

    Techniques: Expressing, Injection, In Ovo, Capillary Electrochromatography, Incubation, Quantitative RT-PCR, Generated, Amplification, SYBR Green Assay

    RT-qPCR on selected miRNAs in bulk and CSCs cells and exosomes Expression was assessed by TaqMan miRNA assays. Cp values from each assay are compared between samples ( n = 3).

    Journal: Oncotarget

    Article Title: Exosomes from bulk and stem cells from human prostate cancer have a differential microRNA content that contributes cooperatively over local and pre-metastatic niche

    doi: 10.18632/oncotarget.6540

    Figure Lengend Snippet: RT-qPCR on selected miRNAs in bulk and CSCs cells and exosomes Expression was assessed by TaqMan miRNA assays. Cp values from each assay are compared between samples ( n = 3).

    Article Snippet: Later, cDNA was used to perform qPCR using the TaqMan® Universal Master Mix II no UNG (Lifetechnologies) with primers included in the TaqMan miRNA assay according to manufacturer's protocols in a Light Cycler 480 thermocycler (Roche).

    Techniques: Quantitative RT-PCR, Expressing

    Expression pattern of chemokines and cytokines in the brain. C57BL/6 mice were infected via the aerosol route with M. tuberculosis H37Rv and 30 days later with 1 × 10 5 pRBCs i.p. Perfused brains were collected on day 6 after Pb ANKA infection for RNA isolation followed by cDNA synthesis. qRT-PCR was used to analyze cyto- and chemokine expression relative to expression of the HPRT housekeeping gene. Symbols and bars represent individual mice and means, respectively. Data from two independent experiments are shown ( n = 8 to 10, mean ± SD, Kruskal-Wallis test with Dunn′s posttest). *, P

    Journal: Infection and Immunity

    Article Title: Mycobacterium tuberculosis Coinfection Has No Impact on Plasmodium berghei ANKA-Induced Experimental Cerebral Malaria in C57BL/6 Mice

    doi: 10.1128/IAI.01290-15

    Figure Lengend Snippet: Expression pattern of chemokines and cytokines in the brain. C57BL/6 mice were infected via the aerosol route with M. tuberculosis H37Rv and 30 days later with 1 × 10 5 pRBCs i.p. Perfused brains were collected on day 6 after Pb ANKA infection for RNA isolation followed by cDNA synthesis. qRT-PCR was used to analyze cyto- and chemokine expression relative to expression of the HPRT housekeeping gene. Symbols and bars represent individual mice and means, respectively. Data from two independent experiments are shown ( n = 8 to 10, mean ± SD, Kruskal-Wallis test with Dunn′s posttest). *, P

    Article Snippet: For quantitative real-time PCR, 400 ng of total RNA was reverse transcribed (RT) using a Maxima First Strand cDNA synthesis kit for RT-quantitative PCR (RT-qPCR) (Life Technologies) according to the manufacturer's instruction at 25°C for 10 min, 55°C for 30 min, and 85°C for 3 min. RT-qPCRs were performed using LightCycler 480 SYBR green I Master (Roche).

    Techniques: Expressing, Mouse Assay, Infection, Isolation, Quantitative RT-PCR

    Localization of M3 expression in lung, spleen, and lymph node. Detection of M3 RNA in lung and spleen by in situ hybridization in MHV-68 infected wood mice. A, B: Lung, day 7 p.i.: (A) M3 transcripts detected within lymphocytes in perivascular infiltrates (white arrows) and lymphocytes attached to the endothelial wall (black arrow). A: artery; (B) No signal detected with sense-strand probe (negative control). C, D: Lung, day 12 p.i.: (C) Perivascular and peribronchial lymphocyte infiltrations containing numerous M3 -positive lymphocytes. A, artery; B, bronchioles; (D) Peribronchial, focal follicle-like lymphocyte accumulation with numerous M3 -positive lymphocytes. B, bronchiolus. (E) Bronchial lymph node, day 7 p.i.; lymphocytes showing M3 transcripts are present in lymphatic follicles (within germinal center cells). F, follicle. (F) Spleen, day 14 p.i.; follicle with numerous M3 RNA-positive lymphocytes in the germinal center. Results are representative of numerous tissue sections analyzed from three infected wood mice.

    Journal: PLoS Pathogens

    Article Title: Chemokine Binding Protein M3 of Murine Gammaherpesvirus 68 Modulates the Host Response to Infection in a Natural Host

    doi: 10.1371/journal.ppat.1001321

    Figure Lengend Snippet: Localization of M3 expression in lung, spleen, and lymph node. Detection of M3 RNA in lung and spleen by in situ hybridization in MHV-68 infected wood mice. A, B: Lung, day 7 p.i.: (A) M3 transcripts detected within lymphocytes in perivascular infiltrates (white arrows) and lymphocytes attached to the endothelial wall (black arrow). A: artery; (B) No signal detected with sense-strand probe (negative control). C, D: Lung, day 12 p.i.: (C) Perivascular and peribronchial lymphocyte infiltrations containing numerous M3 -positive lymphocytes. A, artery; B, bronchioles; (D) Peribronchial, focal follicle-like lymphocyte accumulation with numerous M3 -positive lymphocytes. B, bronchiolus. (E) Bronchial lymph node, day 7 p.i.; lymphocytes showing M3 transcripts are present in lymphatic follicles (within germinal center cells). F, follicle. (F) Spleen, day 14 p.i.; follicle with numerous M3 RNA-positive lymphocytes in the germinal center. Results are representative of numerous tissue sections analyzed from three infected wood mice.

    Article Snippet: Reverse transcription was performed at 50 °C for 30 min with 2 µg RNA in a 20-µl reaction containing 200 U Superscript III reverse transcriptase (Invitrogen), 500 ng oligo(dT)15 primer (Roche), 0.5 mM dNTP mix (Promega), 5 mM DTT, 40 U RNase inhibitor (RNaseOUT; Invitrogen), and First-Strand buffer (50 mM Tris-HCl [pH 8.3], 75 mM KCl, 3 mM MgCl2 ; Invitrogen).

    Techniques: Expressing, In Situ Hybridization, Infection, Mouse Assay, Negative Control

    Comparative analysis of M3 RNA expression in lungs of infected wood mice. Quantification by qRT-PCR of RNA expressed from the MHV-68 genome within lungs; ORF50 RNA levels were assessed as a general reference for lytic-cycle gene expression. The copy numbers of individual viral-gene RNAs (as cDNAs) were normalized to those for cellular RPL8 . Error bars represent the standard error of the mean from three wood mice per time point. (A) analysis of expression from the M1-M4 locus of infected wood mice lungs. (B) analysis of M3 expression from the lungs of BALB/c and wood mice. Note that, although M3 expression is similar for both species at 7 days p.i., after 14 days p.i., M3 expression in BALB/c mouse lungs is drastically reduced compared to wood mice.

    Journal: PLoS Pathogens

    Article Title: Chemokine Binding Protein M3 of Murine Gammaherpesvirus 68 Modulates the Host Response to Infection in a Natural Host

    doi: 10.1371/journal.ppat.1001321

    Figure Lengend Snippet: Comparative analysis of M3 RNA expression in lungs of infected wood mice. Quantification by qRT-PCR of RNA expressed from the MHV-68 genome within lungs; ORF50 RNA levels were assessed as a general reference for lytic-cycle gene expression. The copy numbers of individual viral-gene RNAs (as cDNAs) were normalized to those for cellular RPL8 . Error bars represent the standard error of the mean from three wood mice per time point. (A) analysis of expression from the M1-M4 locus of infected wood mice lungs. (B) analysis of M3 expression from the lungs of BALB/c and wood mice. Note that, although M3 expression is similar for both species at 7 days p.i., after 14 days p.i., M3 expression in BALB/c mouse lungs is drastically reduced compared to wood mice.

    Article Snippet: Reverse transcription was performed at 50 °C for 30 min with 2 µg RNA in a 20-µl reaction containing 200 U Superscript III reverse transcriptase (Invitrogen), 500 ng oligo(dT)15 primer (Roche), 0.5 mM dNTP mix (Promega), 5 mM DTT, 40 U RNase inhibitor (RNaseOUT; Invitrogen), and First-Strand buffer (50 mM Tris-HCl [pH 8.3], 75 mM KCl, 3 mM MgCl2 ; Invitrogen).

    Techniques: RNA Expression, Infection, Mouse Assay, Quantitative RT-PCR, Expressing