dna template Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher template dna
    Promoter methylation in cf <t>DNA</t> from serum. (A) Heatmap of promoter methylation detected in cf DNA extracted from serum samples for single genes and combinations of genes. White: no methylation detected; gray: methylation detected; red box: best minimal combination of markers (highest AUC ). (B) Copies per mL of hypermethylated ST 6 GALNAC 3 , ZNF 660 , CCDC 181 , and HAPLN 3 in serum samples from 10 patients with BPH and 27 patients with PC analyzed by droplet digital <t>PCR</t> . P ‐values for trend of methylation in BPH
    Template Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 15134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/template dna/product/Thermo Fisher
    Average 99 stars, based on 15134 article reviews
    Price from $9.99 to $1999.99
    template dna - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Millipore template dna
    Seasonal fluctuations in <t>DNA</t> quantities or ascospore counts obtained by sampling airborne propagules collected over two autumns ( a , b ; 2002 and c , d ; 2006) periods on Melinex tapes of a Burkard 7-day volumetric air sampler located in Rothamsted Research, Harpenden, UK. Quantitative <t>PCR</t> assays detected avirulence alleles AvrLm1 ( a , c ; black line ), AvrLm6 ( a , c ; grey line ) or with primers based on β -tubulin ( b , d ; black line ) or e rg11 ( b , d ; grey line ) fragments in the propagules of Leptosphaeria maculans . Ascospore release patterns ( b , d ; dotted line ) were determined by light microscopic counts of Leptosphaeria -like ascospores per m 3 of air
    Template Dna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1527 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/template dna/product/Millipore
    Average 99 stars, based on 1527 article reviews
    Price from $9.99 to $1999.99
    template dna - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    ATUM template dna
    <t>PCR</t> amplification of the nuc gene of S. aureus . Lane 1: 100 bp <t>DNA</t> ladder. Lane 5: Amplified PCR product
    Template Dna, supplied by ATUM, used in various techniques. Bioz Stars score: 94/100, based on 2248 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/template dna/product/ATUM
    Average 94 stars, based on 2248 article reviews
    Price from $9.99 to $1999.99
    template dna - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    93
    Bio-Rad dna template
    Adjuvant vaccination after tumor resection leads to clean RAs and reactivation of the immune system to target cancer cells (A) B16F0 tumor-bearing mice underwent R1 tumor resection, were randomized into different treatment groups, and were vaccinated with either C+I, CpG, or PBS for four weeks. (B) <t>DNA</t> from skin biopsies (*) in resection areas (RAs) showed a significant reduction in the percentage of tumor cells after four vaccination rounds with the C+I vaccine, as assessed by <t>ddPCR.</t> (C) Vaccination post-tumor resection led to a reduction of Th17 cells (CD4 + CD62L + TCR-b + (IL-2/IL-17A); CD4 + CD62L + CD44 + TCR-b + (IL-17A)) and an increased presence of TNF-α expressing myeloid cells (CD11b + CD44 + GR1 hi (TNF-a)) and IL-4 expressing CD19 + CD62L + CD44 + B-cells ( n= 8 PBS, n =10 CpG, n =10 C+I, mean±s.e.m., ANOVA with Tukey’s multiple comparison test, *p
    Dna Template, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1343 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna template/product/Bio-Rad
    Average 93 stars, based on 1343 article reviews
    Price from $9.99 to $1999.99
    dna template - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    93
    Meridian Life Science dna template
    N. <t>munroi</t> CA genes and transcripts. CA1 and CA2 genomic <t>DNA</t> (gDNA) sequences are depicted using white boxes to represent introns and numbered gray boxes to represent exons (E1–E4). The mRNA sequences are depicted using colored boxes aligned to
    Dna Template, supplied by Meridian Life Science, used in various techniques. Bioz Stars score: 93/100, based on 934 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna template/product/Meridian Life Science
    Average 93 stars, based on 934 article reviews
    Price from $9.99 to $1999.99
    dna template - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    91
    Pacific Biosciences dna template prep kit 2 0
    N. <t>munroi</t> CA genes and transcripts. CA1 and CA2 genomic <t>DNA</t> (gDNA) sequences are depicted using white boxes to represent introns and numbered gray boxes to represent exons (E1–E4). The mRNA sequences are depicted using colored boxes aligned to
    Dna Template Prep Kit 2 0, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 91/100, based on 838 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna template prep kit 2 0/product/Pacific Biosciences
    Average 91 stars, based on 838 article reviews
    Price from $9.99 to $1999.99
    dna template prep kit 2 0 - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    99
    Thermo Fisher dna template
    Agarose gel stained with ethidium bromide, <t>PCR</t> products of COX-2 gene by using the COX21195A→G (rs689466) primer. Line 1–6 is 273 bp fragments, Line M is 100 bp <t>DNA</t> ladder
    Dna Template, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 9867 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna template/product/Thermo Fisher
    Average 99 stars, based on 9867 article reviews
    Price from $9.99 to $1999.99
    dna template - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    Stratagene dna template
    Southern hybridization analysis demonstrating that <t>cLV25</t> originated from the chromosome of B. fragilis LV25. LV25 chromosomal and plasmid DNAs were digested with Eco RI and hybridized with a 3.6-kb internal cLV25 Eco RI fragment from p25Δ.2. Lanes: 1, biotinylated lambda <t>DNA</t> Hin dIII markers; 2, pGAT400ΔBglII; 3, p25Δ.2; 4, LV25 chromosomal DNA; 5, LV25 plasmid DNA. The solid lines indicate the positions of molecular size markers in kilobases. The arrowhead indicates the 3.6-kb cLV25 Eco RI fragment.
    Dna Template, supplied by Stratagene, used in various techniques. Bioz Stars score: 92/100, based on 646 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna template/product/Stratagene
    Average 92 stars, based on 646 article reviews
    Price from $9.99 to $1999.99
    dna template - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    93
    tiangen biotech co dna template
    Optimization of ARMS condition. Notes: ARMS amplifications specific for the mutation (c.C799T) were optimized by indicated different primer pairs. The genomic samples of mutant hemizygous proband <t>M001</t> (I:1) and his normal son (II:3) were used as <t>DNA</t> templates. The black and blue arrows show the position of the point mutation and nonspecific primer-dimer, respectively. I:1=M001; II:3=M002. Abbreviations: ARMS, amplification refractory mutation system; WT, wild-type primer; MT, mutant primer; C, common primer.
    Dna Template, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 93/100, based on 367 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna template/product/tiangen biotech co
    Average 93 stars, based on 367 article reviews
    Price from $9.99 to $1999.99
    dna template - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    94
    Eppendorf AG dna template
    Optimization of ARMS condition. Notes: ARMS amplifications specific for the mutation (c.C799T) were optimized by indicated different primer pairs. The genomic samples of mutant hemizygous proband <t>M001</t> (I:1) and his normal son (II:3) were used as <t>DNA</t> templates. The black and blue arrows show the position of the point mutation and nonspecific primer-dimer, respectively. I:1=M001; II:3=M002. Abbreviations: ARMS, amplification refractory mutation system; WT, wild-type primer; MT, mutant primer; C, common primer.
    Dna Template, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 94/100, based on 459 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna template/product/Eppendorf AG
    Average 94 stars, based on 459 article reviews
    Price from $9.99 to $1999.99
    dna template - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    93
    Illumina Inc dna template
    <t>DNA</t> template and <t>RNA</t> transcript of HiTS-RAP. (A) Schematics of the DNA template used for HiTS-RAP and the resulting halted RNA transcript. DNA template encoding the RNA of interest (green) is flanked by the Illumina flowcell adaptor 1 (gray) and T7 RNA polymerase promoter (orange) upstream, and by the Illumina sequencing primer annealing site (purple), Tus-binding Ter site (red), and Illumina flowcell adaptor 2 downstream. Illumina flowcell adaptors 1 and 2 are required for cluster generation on Illumina GA flowcell. T7 RNA polymerase promoter is required for transcription of the RNA of interest. The Illumina sequencing primer is used for sequencing the DNA template of the RNA of interest and serves as a docking site for the T7 RNA polymerase when it is halted. Tus protein binds to Ter site and halts the transcribing RNA polymerase. Direction of transcription and sequencing are indicated by orange and purple arrows, respectively. Tus-bound Ter site that is non-permissive (halting) and permissive (read-through) to RNA polymerase are indicated by solid and open red triangles, respectively. The halted RNA transcript includes a triplet G derived from the T7 promoter, followed by the RNA of interest and some of the Illumina sequencing primer. The 3’-end of RNA transcript, indicated by a dashed line, is inaccessible. (B) Construction of DNA templates for HiTS-RAP. DNA template is constructed by PCR in two steps using 2 sets of nested oligos. Forward oligos introduce T7 promoter (step 1) and Illumina flowcell adaptor (step 2), whereas reverse oligos introduce Illumina sequencing primer (step 1), and Ter site and Illumina flowcell adaptor 2 (step 2). (C) Sequence of the HiTS-RAP DNA template for GFP aptamer. GFP aptamer encoding sequence is in green, and the rest of the sequences are colored as in (A). The transcription start site is indicated by +1 and a broken arrow. (D) Sequence of the halted RNA transcript from GFP aptamer template. Sequences are colored as in (C). Uppercase indicates the region of the halted RNA transcript that is accessible, and the lowercase indicates a region that is likely to be buried in T7 RNA polymerase and thus inaccessible by other proteins.
    Dna Template, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 311 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna template/product/Illumina Inc
    Average 93 stars, based on 311 article reviews
    Price from $9.99 to $1999.99
    dna template - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher rna century marker templates
    CRISPR/Cas9-mediated deletion of CISH in iC9/CAR19/IL-15 NK cells. a , Schematic representation of CRISPR/Cas9-mediated CISH KO using two guide RNAs (gRNA) targeting exon 4 of the CISH gene. b,c, CB-NK cells were expanded with K562 based feeder cells and IL-2, then either left non-transduced (NT) or transduced with a retroviral vector expressing iC9/CAR19/IL-15 construct on day 4 of expansion. On day 7 of expansion, NT and iC9/CAR19/IL-15-expressing CB-NK cells were nucleofected with Cas9 alone (Cas9 mock), Cas9 preloaded with gRNA targeting CISH exon 4 ( CISH KO) or non-nucleofected (WT). The CISH KO efficiency was determined by PCR ( b ) and western blot analysis ( c ). d , Sanger sequencing results showing multiple peaks reflecting non-homologous end joining (NHEJ) events in NT or iC9/CAR19/IL-15 (CAR) NK cells that underwent CISH KO compared to single peaks in CTRL (Cas9 mock). Arrows indicate the base pair position where the gene editing started. e , Bar graphs showing the relative mRNA expression levels of CISH determined on days 0, 7, 14 and 21 of expansion in NT (blue) and iC9/CAR19/IL-15 transduced (grey) NK cells by reverse transcription polymerase chain reaction (RT-PCR) (n=3). Note that on days 0 and 7 only data for NT-NK cells are included since the CAR transduction step is performed on day 4 of expansion.18 S ribosomal <t>RNA</t> (18S) was used as the internal reference gene. Bars represent mean values with standard deviation, *p ≤ 0.05.
    Rna Century Marker Templates, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna century marker templates/product/Thermo Fisher
    Average 99 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    rna century marker templates - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    TaKaRa template dna
    CRISPR/Cas9-mediated deletion of CISH in iC9/CAR19/IL-15 NK cells. a , Schematic representation of CRISPR/Cas9-mediated CISH KO using two guide RNAs (gRNA) targeting exon 4 of the CISH gene. b,c, CB-NK cells were expanded with K562 based feeder cells and IL-2, then either left non-transduced (NT) or transduced with a retroviral vector expressing iC9/CAR19/IL-15 construct on day 4 of expansion. On day 7 of expansion, NT and iC9/CAR19/IL-15-expressing CB-NK cells were nucleofected with Cas9 alone (Cas9 mock), Cas9 preloaded with gRNA targeting CISH exon 4 ( CISH KO) or non-nucleofected (WT). The CISH KO efficiency was determined by PCR ( b ) and western blot analysis ( c ). d , Sanger sequencing results showing multiple peaks reflecting non-homologous end joining (NHEJ) events in NT or iC9/CAR19/IL-15 (CAR) NK cells that underwent CISH KO compared to single peaks in CTRL (Cas9 mock). Arrows indicate the base pair position where the gene editing started. e , Bar graphs showing the relative mRNA expression levels of CISH determined on days 0, 7, 14 and 21 of expansion in NT (blue) and iC9/CAR19/IL-15 transduced (grey) NK cells by reverse transcription polymerase chain reaction (RT-PCR) (n=3). Note that on days 0 and 7 only data for NT-NK cells are included since the CAR transduction step is performed on day 4 of expansion.18 S ribosomal <t>RNA</t> (18S) was used as the internal reference gene. Bars represent mean values with standard deviation, *p ≤ 0.05.
    Template Dna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 5386 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/template dna/product/TaKaRa
    Average 99 stars, based on 5386 article reviews
    Price from $9.99 to $1999.99
    template dna - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    5 PRIME dna template
    CRISPR/Cas9-mediated deletion of CISH in iC9/CAR19/IL-15 NK cells. a , Schematic representation of CRISPR/Cas9-mediated CISH KO using two guide RNAs (gRNA) targeting exon 4 of the CISH gene. b,c, CB-NK cells were expanded with K562 based feeder cells and IL-2, then either left non-transduced (NT) or transduced with a retroviral vector expressing iC9/CAR19/IL-15 construct on day 4 of expansion. On day 7 of expansion, NT and iC9/CAR19/IL-15-expressing CB-NK cells were nucleofected with Cas9 alone (Cas9 mock), Cas9 preloaded with gRNA targeting CISH exon 4 ( CISH KO) or non-nucleofected (WT). The CISH KO efficiency was determined by PCR ( b ) and western blot analysis ( c ). d , Sanger sequencing results showing multiple peaks reflecting non-homologous end joining (NHEJ) events in NT or iC9/CAR19/IL-15 (CAR) NK cells that underwent CISH KO compared to single peaks in CTRL (Cas9 mock). Arrows indicate the base pair position where the gene editing started. e , Bar graphs showing the relative mRNA expression levels of CISH determined on days 0, 7, 14 and 21 of expansion in NT (blue) and iC9/CAR19/IL-15 transduced (grey) NK cells by reverse transcription polymerase chain reaction (RT-PCR) (n=3). Note that on days 0 and 7 only data for NT-NK cells are included since the CAR transduction step is performed on day 4 of expansion.18 S ribosomal <t>RNA</t> (18S) was used as the internal reference gene. Bars represent mean values with standard deviation, *p ≤ 0.05.
    Dna Template, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 92/100, based on 174 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna template/product/5 PRIME
    Average 92 stars, based on 174 article reviews
    Price from $9.99 to $1999.99
    dna template - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    90
    GE Healthcare templiphi dna sequencing template amplification kit
    CRISPR/Cas9-mediated deletion of CISH in iC9/CAR19/IL-15 NK cells. a , Schematic representation of CRISPR/Cas9-mediated CISH KO using two guide RNAs (gRNA) targeting exon 4 of the CISH gene. b,c, CB-NK cells were expanded with K562 based feeder cells and IL-2, then either left non-transduced (NT) or transduced with a retroviral vector expressing iC9/CAR19/IL-15 construct on day 4 of expansion. On day 7 of expansion, NT and iC9/CAR19/IL-15-expressing CB-NK cells were nucleofected with Cas9 alone (Cas9 mock), Cas9 preloaded with gRNA targeting CISH exon 4 ( CISH KO) or non-nucleofected (WT). The CISH KO efficiency was determined by PCR ( b ) and western blot analysis ( c ). d , Sanger sequencing results showing multiple peaks reflecting non-homologous end joining (NHEJ) events in NT or iC9/CAR19/IL-15 (CAR) NK cells that underwent CISH KO compared to single peaks in CTRL (Cas9 mock). Arrows indicate the base pair position where the gene editing started. e , Bar graphs showing the relative mRNA expression levels of CISH determined on days 0, 7, 14 and 21 of expansion in NT (blue) and iC9/CAR19/IL-15 transduced (grey) NK cells by reverse transcription polymerase chain reaction (RT-PCR) (n=3). Note that on days 0 and 7 only data for NT-NK cells are included since the CAR transduction step is performed on day 4 of expansion.18 S ribosomal <t>RNA</t> (18S) was used as the internal reference gene. Bars represent mean values with standard deviation, *p ≤ 0.05.
    Templiphi Dna Sequencing Template Amplification Kit, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 90/100, based on 213 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/templiphi dna sequencing template amplification kit/product/GE Healthcare
    Average 90 stars, based on 213 article reviews
    Price from $9.99 to $1999.99
    templiphi dna sequencing template amplification kit - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    93
    Bioneer Corporation dna template
    <t>PCR</t> assay for detection of bla VEB gene with product size: 600 bp. Lanes 3–17: Amplified products, Lanes 2 and 19: Positive control, Lanes 1 and 20: <t>DNA</t> ladder 100 bp, Lane 18: Negative control
    Dna Template, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 93/100, based on 266 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna template/product/Bioneer Corporation
    Average 93 stars, based on 266 article reviews
    Price from $9.99 to $1999.99
    dna template - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    92
    Boehringer Mannheim dna template
    Restriction analysis with Rsa I of <t>DNA</t> amplified with primer pair ITS 5 and ITS 4 from P. infestans US-6 NY (lane 2), P. infestans 93-1 (lane 3), P. mirabilis 0S0016 (lane 4), P. fragariae A-8 (lane 5), P. megasperma NY 318 (lane 6), P. megasperma NY 412 (lane 7), P. sojae R1 (lane 8), P. cinnamomi 2302 (lane 9), P. cryptogea <t>PCR-1</t> (lane 10), and P. erythroseptica 4 (lane 11). Lanes 1 and 12 contain 100-bp ladders.
    Dna Template, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 92/100, based on 127 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna template/product/Boehringer Mannheim
    Average 92 stars, based on 127 article reviews
    Price from $9.99 to $1999.99
    dna template - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    TransGen biotech co dna template
    The effects of ChA on Akkermansia . ( A ) Comparison of the relative abundance of Akkermansia in fecal samples of DSS colitis mice analyzed by 16S rRNA gene sequencing; ( B ) A comparison of the relative abundance of Akkermansia in fecal samples of normal mice that were treated with ChA. Akkermansia was quantified with qPCR by amplifying fecal <t>DNA</t> with primers specific for Akkermansia and universal bacterial primers; ( C ) The polymerase chain reaction products were analyzed by electrophoresis in a 2% agarose gel. * p
    Dna Template, supplied by TransGen biotech co, used in various techniques. Bioz Stars score: 92/100, based on 166 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna template/product/TransGen biotech co
    Average 92 stars, based on 166 article reviews
    Price from $9.99 to $1999.99
    dna template - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    Image Search Results


    Promoter methylation in cf DNA from serum. (A) Heatmap of promoter methylation detected in cf DNA extracted from serum samples for single genes and combinations of genes. White: no methylation detected; gray: methylation detected; red box: best minimal combination of markers (highest AUC ). (B) Copies per mL of hypermethylated ST 6 GALNAC 3 , ZNF 660 , CCDC 181 , and HAPLN 3 in serum samples from 10 patients with BPH and 27 patients with PC analyzed by droplet digital PCR . P ‐values for trend of methylation in BPH

    Journal: Molecular Oncology

    Article Title: Biomarker potential of ST6GALNAC3 and ZNF660 promoter hypermethylation in prostate cancer tissue and liquid biopsies

    doi: 10.1002/1878-0261.12183

    Figure Lengend Snippet: Promoter methylation in cf DNA from serum. (A) Heatmap of promoter methylation detected in cf DNA extracted from serum samples for single genes and combinations of genes. White: no methylation detected; gray: methylation detected; red box: best minimal combination of markers (highest AUC ). (B) Copies per mL of hypermethylated ST 6 GALNAC 3 , ZNF 660 , CCDC 181 , and HAPLN 3 in serum samples from 10 patients with BPH and 27 patients with PC analyzed by droplet digital PCR . P ‐values for trend of methylation in BPH

    Article Snippet: For all reactions, 3 pmol of each primer, 1 pmol probe, 5 ng bisulfite‐converted template DNA, and TaqMan® Universal PCR Master Mix No UNG (Applied Biosystems, Foster City, CA, USA) were used.

    Techniques: Methylation, Digital PCR

    RT progression assay determining G-quartet formation in the Sp1 binding region. Cation-dependent pausing of reverse transcription at the guanine-rich elements in the U3 region was analyzed with RNA and DNA templates. A fragment of the RNA/DNA sequence of the Sp1 binding region is shown (top) with G-rich elements (shaded). Strong pauses of the RT near G-rich elements were observed in the presence of 50 mM of KCl, but not LiCl, indicating that these elements are involved in the formation of structure, which is stabilized by potassium ions but destabilized by lithium ions. This is indicative of a G-quadruplex. The cation-independent RT pauses are likely caused by hairpin structures. DNA primer, P; DNA marker, M; KCl, K + ; LiCl, Li + .

    Journal: Biochemistry

    Article Title: U3 Region in the HIV-1 Genome Adopts a G-Quadruplex Structure in Its RNA and DNA Sequence

    doi: 10.1021/bi4016692

    Figure Lengend Snippet: RT progression assay determining G-quartet formation in the Sp1 binding region. Cation-dependent pausing of reverse transcription at the guanine-rich elements in the U3 region was analyzed with RNA and DNA templates. A fragment of the RNA/DNA sequence of the Sp1 binding region is shown (top) with G-rich elements (shaded). Strong pauses of the RT near G-rich elements were observed in the presence of 50 mM of KCl, but not LiCl, indicating that these elements are involved in the formation of structure, which is stabilized by potassium ions but destabilized by lithium ions. This is indicative of a G-quadruplex. The cation-independent RT pauses are likely caused by hairpin structures. DNA primer, P; DNA marker, M; KCl, K + ; LiCl, Li + .

    Article Snippet: Preparation of RNA Templates RNA molecules were transcribed in vitro (Ambion T7-MEGAshortscript kit; Applied Biosystems) from DNA templates amplified by PCR using Vent DNA polymerase (New England BioLabs, Inc.) and two overlapping oligomers with the sequence of the desired region.

    Techniques: Binding Assay, Sequencing, Marker

    Formation of the structure stabilized by potassium ions in the HIV-1 U3 region facilitates RT template switching during reverse transcription. (A) Reconstituted system to analyze the influence of G-rich elements on strand transfer during HIV-1 minus strand DNA synthesis in vitro . Donor and acceptor RNA templates represent two copies of the viral RNA genome; in which reverse transcription is initiated from a 32 P-labeled DNA primer annealed to the donor RNA. The acceptor RNA does not share a homology (circle) with two nucleotides at the 5′ end of the donor RNA. TP, transfer product; DE, donor extension product; and P, DNA primer. (B) A time course of strand transfer reactions performed in the presence of potassium and lithium ions. Samples were collected at 1, 5, 15, and 30 min after the reaction was initiated. Formation of a potassium-dependent structure, anticipated to be a G-quadruplex, in the RNA template paused the RT during minus strand DNA synthesis and influenced the yield of the final products. The transfer efficiency decreased about 37% in reactions with lithium ions, presumably because the templates could not form a G-quadruplex.

    Journal: Biochemistry

    Article Title: U3 Region in the HIV-1 Genome Adopts a G-Quadruplex Structure in Its RNA and DNA Sequence

    doi: 10.1021/bi4016692

    Figure Lengend Snippet: Formation of the structure stabilized by potassium ions in the HIV-1 U3 region facilitates RT template switching during reverse transcription. (A) Reconstituted system to analyze the influence of G-rich elements on strand transfer during HIV-1 minus strand DNA synthesis in vitro . Donor and acceptor RNA templates represent two copies of the viral RNA genome; in which reverse transcription is initiated from a 32 P-labeled DNA primer annealed to the donor RNA. The acceptor RNA does not share a homology (circle) with two nucleotides at the 5′ end of the donor RNA. TP, transfer product; DE, donor extension product; and P, DNA primer. (B) A time course of strand transfer reactions performed in the presence of potassium and lithium ions. Samples were collected at 1, 5, 15, and 30 min after the reaction was initiated. Formation of a potassium-dependent structure, anticipated to be a G-quadruplex, in the RNA template paused the RT during minus strand DNA synthesis and influenced the yield of the final products. The transfer efficiency decreased about 37% in reactions with lithium ions, presumably because the templates could not form a G-quadruplex.

    Article Snippet: Preparation of RNA Templates RNA molecules were transcribed in vitro (Ambion T7-MEGAshortscript kit; Applied Biosystems) from DNA templates amplified by PCR using Vent DNA polymerase (New England BioLabs, Inc.) and two overlapping oligomers with the sequence of the desired region.

    Techniques: DNA Synthesis, In Vitro, Labeling

    CD spectral analysis of the RNA and single stranded DNA with Sp1 binding sites in HIV-1. CD spectra indicate the formation of the parallel G-quadruplex for the RNA template and an antiparallel or hybrid G-quadruplex for single stranded DNA. For reference, a profile of the G-rich sequence (50% of Gs; GGGGGGAUUGUG UGGUACAGUGCAGAGA), which is unable to adopt G-quadruplex structure, is shown in gray.

    Journal: Biochemistry

    Article Title: U3 Region in the HIV-1 Genome Adopts a G-Quadruplex Structure in Its RNA and DNA Sequence

    doi: 10.1021/bi4016692

    Figure Lengend Snippet: CD spectral analysis of the RNA and single stranded DNA with Sp1 binding sites in HIV-1. CD spectra indicate the formation of the parallel G-quadruplex for the RNA template and an antiparallel or hybrid G-quadruplex for single stranded DNA. For reference, a profile of the G-rich sequence (50% of Gs; GGGGGGAUUGUG UGGUACAGUGCAGAGA), which is unable to adopt G-quadruplex structure, is shown in gray.

    Article Snippet: Preparation of RNA Templates RNA molecules were transcribed in vitro (Ambion T7-MEGAshortscript kit; Applied Biosystems) from DNA templates amplified by PCR using Vent DNA polymerase (New England BioLabs, Inc.) and two overlapping oligomers with the sequence of the desired region.

    Techniques: Binding Assay, Sequencing

    Seasonal fluctuations in DNA quantities or ascospore counts obtained by sampling airborne propagules collected over two autumns ( a , b ; 2002 and c , d ; 2006) periods on Melinex tapes of a Burkard 7-day volumetric air sampler located in Rothamsted Research, Harpenden, UK. Quantitative PCR assays detected avirulence alleles AvrLm1 ( a , c ; black line ), AvrLm6 ( a , c ; grey line ) or with primers based on β -tubulin ( b , d ; black line ) or e rg11 ( b , d ; grey line ) fragments in the propagules of Leptosphaeria maculans . Ascospore release patterns ( b , d ; dotted line ) were determined by light microscopic counts of Leptosphaeria -like ascospores per m 3 of air

    Journal: Journal of Applied Genetics

    Article Title: Molecular screening for avirulence alleles AvrLm1 and AvrLm6 in airborne inoculum of Leptosphaeria maculans and winter oilseed rape (Brassica napus) plants from Poland and the UK

    doi: 10.1007/s13353-014-0235-8

    Figure Lengend Snippet: Seasonal fluctuations in DNA quantities or ascospore counts obtained by sampling airborne propagules collected over two autumns ( a , b ; 2002 and c , d ; 2006) periods on Melinex tapes of a Burkard 7-day volumetric air sampler located in Rothamsted Research, Harpenden, UK. Quantitative PCR assays detected avirulence alleles AvrLm1 ( a , c ; black line ), AvrLm6 ( a , c ; grey line ) or with primers based on β -tubulin ( b , d ; black line ) or e rg11 ( b , d ; grey line ) fragments in the propagules of Leptosphaeria maculans . Ascospore release patterns ( b , d ; dotted line ) were determined by light microscopic counts of Leptosphaeria -like ascospores per m 3 of air

    Article Snippet: Quantitative PCR to assess proportions of DNA of each Leptosphaeria maculans in the spore samples For quantitative PCR, a standard 20-μL reaction contained 5 μL template DNA, 200 nM forward primer, 180 nM reverse primer (Mahuku et al. ; Liu et al. ), 10 μL SYBR Green JumpStart Taq ReadyMix (Sigma, UK), 0.08 μL ROX internal reference dye (Sigma, UK) and 3.78 μL nuclease-free, sterile water.

    Techniques: Sampling, Real-time Polymerase Chain Reaction

    Seasonal fluctuations in DNA quantities or ascospore counts obtained by sampling airborne propagules collected over two autumns ( a , b ; 2006 and c , d ; 2008) periods on Melinex tapes of a Burkard 7-day volumetric air sampler located in Poznan, Poland. Quantitative PCR assays detected avirulence alleles AvrLm1 ( a , c ; black line ), AvrLm6 ( a , c ; grey line ) or with primers based on β -tubulin ( b , d ; black line ) or e rg11 ( b , d ; grey line ) fragments in the propagules of Leptosphaeria maculans . Ascospore release patterns ( b , d ; dotted line ) were determined by light microscopic counts of Leptosphaeria -like ascospores per m 3 of air

    Journal: Journal of Applied Genetics

    Article Title: Molecular screening for avirulence alleles AvrLm1 and AvrLm6 in airborne inoculum of Leptosphaeria maculans and winter oilseed rape (Brassica napus) plants from Poland and the UK

    doi: 10.1007/s13353-014-0235-8

    Figure Lengend Snippet: Seasonal fluctuations in DNA quantities or ascospore counts obtained by sampling airborne propagules collected over two autumns ( a , b ; 2006 and c , d ; 2008) periods on Melinex tapes of a Burkard 7-day volumetric air sampler located in Poznan, Poland. Quantitative PCR assays detected avirulence alleles AvrLm1 ( a , c ; black line ), AvrLm6 ( a , c ; grey line ) or with primers based on β -tubulin ( b , d ; black line ) or e rg11 ( b , d ; grey line ) fragments in the propagules of Leptosphaeria maculans . Ascospore release patterns ( b , d ; dotted line ) were determined by light microscopic counts of Leptosphaeria -like ascospores per m 3 of air

    Article Snippet: Quantitative PCR to assess proportions of DNA of each Leptosphaeria maculans in the spore samples For quantitative PCR, a standard 20-μL reaction contained 5 μL template DNA, 200 nM forward primer, 180 nM reverse primer (Mahuku et al. ; Liu et al. ), 10 μL SYBR Green JumpStart Taq ReadyMix (Sigma, UK), 0.08 μL ROX internal reference dye (Sigma, UK) and 3.78 μL nuclease-free, sterile water.

    Techniques: Sampling, Real-time Polymerase Chain Reaction

    Dps compacts the nucleoid in stationary-phase E. coli . ( A ) Schematic of the structure of DNA in a wild-type cell during stationary phase. Dps condenses the cellular DNA. ( B ) In Δ dps cells, Dps-mediated DNA compaction cannot occur. ( C, D ) Fluorescence images of the nucleoid from wild-type and Δ dps cells stained with Hoechst 33258 (cyan) were superimposed onto phase-contrast images of the same cells (black on red) grown for (C) 24 hours or (D) 96 hours. ( E ) Ratios of nucleoid length to cell length, extracted from fluorescence images ( n = 133 - 208 .

    Journal: Cell

    Article Title: Global DNA compaction in stationary-phase bacteria does not affect transcription

    doi: 10.1016/j.cell.2018.06.049

    Figure Lengend Snippet: Dps compacts the nucleoid in stationary-phase E. coli . ( A ) Schematic of the structure of DNA in a wild-type cell during stationary phase. Dps condenses the cellular DNA. ( B ) In Δ dps cells, Dps-mediated DNA compaction cannot occur. ( C, D ) Fluorescence images of the nucleoid from wild-type and Δ dps cells stained with Hoechst 33258 (cyan) were superimposed onto phase-contrast images of the same cells (black on red) grown for (C) 24 hours or (D) 96 hours. ( E ) Ratios of nucleoid length to cell length, extracted from fluorescence images ( n = 133 - 208 .

    Article Snippet: Dps and/or restriction enzymes were removed from the DNA template by adding a final concentration of 120 μg/mL Heparin (Sigma-Aldrich) to the samples and mixing.

    Techniques: Fluorescence, Staining

    Multiplexed single-molecule transcription-elongation assay and dwell time analysis of RNAP dynamics. ( A ) Schematics of the single-molecule in vitro transcriptional assay in the assisting force (AF) configuration, showing a single RNAP bound to a surface-attached DNA template in the presence of Dps. A magnetic bead was attached to the RNAP and exerted a constant force of 5 pN on the ternary complex. ( B ) The opposing force (OF) experimental configuration ( C ) Individual RNAP trajectories over time measured at 25 Hz via the change of the diffraction pattern of the attached magnetic bead (inset). The dashed rectangle depicts the trace region magnified in ( D ). Dwell times ( τ n .

    Journal: Cell

    Article Title: Global DNA compaction in stationary-phase bacteria does not affect transcription

    doi: 10.1016/j.cell.2018.06.049

    Figure Lengend Snippet: Multiplexed single-molecule transcription-elongation assay and dwell time analysis of RNAP dynamics. ( A ) Schematics of the single-molecule in vitro transcriptional assay in the assisting force (AF) configuration, showing a single RNAP bound to a surface-attached DNA template in the presence of Dps. A magnetic bead was attached to the RNAP and exerted a constant force of 5 pN on the ternary complex. ( B ) The opposing force (OF) experimental configuration ( C ) Individual RNAP trajectories over time measured at 25 Hz via the change of the diffraction pattern of the attached magnetic bead (inset). The dashed rectangle depicts the trace region magnified in ( D ). Dwell times ( τ n .

    Article Snippet: Dps and/or restriction enzymes were removed from the DNA template by adding a final concentration of 120 μg/mL Heparin (Sigma-Aldrich) to the samples and mixing.

    Techniques: Transcription‐elongation Assay, In Vitro, Transcription Factor Assay

    Dependence of transcription elongation dynamics on force and location of DNA:Dps complex. ( A ) Dwell time distributions for assisting force (AF) trajectories in the presence (red) and the absence (black) of 1 μM Dps at 20°C. ( B ) Dwell time distributions resulting from the opposing force (OF) experiments in the presence (blue) and the absence (black) of 1 μM Dps at 20°C. ( C ) Comparison of extracted RNAP elongation rates k for AF and OF experimental distributions shown in (A, B), determined by Galton distribution fits with an upper boundary of 1 s. ( D , E ) Calculated transcription pause probabilities (per 10 nt) for short (SP, D ) and long pauses (LP, E .

    Journal: Cell

    Article Title: Global DNA compaction in stationary-phase bacteria does not affect transcription

    doi: 10.1016/j.cell.2018.06.049

    Figure Lengend Snippet: Dependence of transcription elongation dynamics on force and location of DNA:Dps complex. ( A ) Dwell time distributions for assisting force (AF) trajectories in the presence (red) and the absence (black) of 1 μM Dps at 20°C. ( B ) Dwell time distributions resulting from the opposing force (OF) experiments in the presence (blue) and the absence (black) of 1 μM Dps at 20°C. ( C ) Comparison of extracted RNAP elongation rates k for AF and OF experimental distributions shown in (A, B), determined by Galton distribution fits with an upper boundary of 1 s. ( D , E ) Calculated transcription pause probabilities (per 10 nt) for short (SP, D ) and long pauses (LP, E .

    Article Snippet: Dps and/or restriction enzymes were removed from the DNA template by adding a final concentration of 120 μg/mL Heparin (Sigma-Aldrich) to the samples and mixing.

    Techniques:

    Dps allows RNAP to bind to promoters but excludes KpnI restriction enzyme from its target site. ( A ) Gel-shift analysis of Dps binding to linear promoter DNA fragments. The calculated K D . ( B ) Transcription initiation from the recA promoter. ( C ) Dps-mediated protection from DNA digestion. The vertical dashed lines in (B) and (C) indicate the K D of Dps for the different DNA templates shown in (A). The data in panels A-C are shown as mean ± SD from three biological replicates. ( D ) Wild-type, K8A, or K10A Dps proteins at 4 μM were bound to rec .

    Journal: Cell

    Article Title: Global DNA compaction in stationary-phase bacteria does not affect transcription

    doi: 10.1016/j.cell.2018.06.049

    Figure Lengend Snippet: Dps allows RNAP to bind to promoters but excludes KpnI restriction enzyme from its target site. ( A ) Gel-shift analysis of Dps binding to linear promoter DNA fragments. The calculated K D . ( B ) Transcription initiation from the recA promoter. ( C ) Dps-mediated protection from DNA digestion. The vertical dashed lines in (B) and (C) indicate the K D of Dps for the different DNA templates shown in (A). The data in panels A-C are shown as mean ± SD from three biological replicates. ( D ) Wild-type, K8A, or K10A Dps proteins at 4 μM were bound to rec .

    Article Snippet: Dps and/or restriction enzymes were removed from the DNA template by adding a final concentration of 120 μg/mL Heparin (Sigma-Aldrich) to the samples and mixing.

    Techniques: Electrophoretic Mobility Shift Assay, Binding Assay

    Cancer cells that have high clonogenic and cloning efficiency can undergo SD and ASD divisions (A) serial single cell cloning assay (SSCA) was set up as described in Methods. At each round, 180-wells were scored for monoclonal SD and ASD colony formation. (B) the morphology of single cell derived from LLC-SE in 96-well plate(top), bar=60um. And, the the morphology of stable symmetric division cell lines (LLC-SD) and asymmetric division cell lines (LLC-ASD) after 5 times SSCA of LLC-SE (bottom), bar=120um. (C) analysis of symmetric and asymmetric segregation of BrdU-labeled DNA during mitosis in LLC-SD and LLC-ASD. BrdU retention on day 7 after BrdU withdrawal in LLC-SD and LLC-ASD (top), bar=120um. Symmetric BrdU segregation between two daughter cells and asymmetric BrdU segregation between two daughter cells (bottom), bar=30um. (D) Quantification of SD and ASD cells in 100 dividing anaphase LLC-SD and LLC-ASD cells, respectively. (E) analysis of symmetric and asymmetric segregation of Numb in LLC-SD and LLC-ASD, bar=15um.

    Journal: Oncotarget

    Article Title: Comparison of tumor biology of two distinct cell sub-populations in lung cancer stem cells

    doi: 10.18632/oncotarget.18451

    Figure Lengend Snippet: Cancer cells that have high clonogenic and cloning efficiency can undergo SD and ASD divisions (A) serial single cell cloning assay (SSCA) was set up as described in Methods. At each round, 180-wells were scored for monoclonal SD and ASD colony formation. (B) the morphology of single cell derived from LLC-SE in 96-well plate(top), bar=60um. And, the the morphology of stable symmetric division cell lines (LLC-SD) and asymmetric division cell lines (LLC-ASD) after 5 times SSCA of LLC-SE (bottom), bar=120um. (C) analysis of symmetric and asymmetric segregation of BrdU-labeled DNA during mitosis in LLC-SD and LLC-ASD. BrdU retention on day 7 after BrdU withdrawal in LLC-SD and LLC-ASD (top), bar=120um. Symmetric BrdU segregation between two daughter cells and asymmetric BrdU segregation between two daughter cells (bottom), bar=30um. (D) Quantification of SD and ASD cells in 100 dividing anaphase LLC-SD and LLC-ASD cells, respectively. (E) analysis of symmetric and asymmetric segregation of Numb in LLC-SD and LLC-ASD, bar=15um.

    Article Snippet: BrdU-labeling, analysis of symmetric and asymmetrical chromosome segregation Labeling of DNA templates was achieved by the addition of 10μM BrdU (Sigma) to the culture medium for 7 days followed by BrdU withdrawal.

    Techniques: Clone Assay, Derivative Assay, Labeling

    SD and ASD cell lines could be obtained from human cancer cells MDA-MB-435 (A) the morphology of MDA-MB-435, MDA-MB-435-SE, MDA-MB-435-SD and MDA-MB-435-ASD, bar=120um. (B) the analysis of mRNA expression of embryonic stem cell markers (Oct4, Sox2, Nanog, Klf4 and c-Myc) in MDA-MB-435, MDA-MB-435-SE, MDA-MB-435-SD and MDA-MB-435-ASD, the tata-Box binding protein gene (Tbp) was reference gene. (C) Analysis of symmetric and asymmetric segregation of BrdU-labeled DNA during mitosis in MDA-MB-435-SD and MDA-MB-435-ASD. BrdU retention on day 6 after BrdU withdrawal in MDA-MB-435-SD (i) and MDA-MB-435-ASD (ii). (iii), #1 and #2: symmetric BrdU segregation between two daughter cells. #3: an adjacent BrdU-positive cell. (iv), asymmetric BrdU segregation between two daughter cells. (v) Quantification of SD and ASD cells in 100 dividing anaphase MDA-MB-435-SD and MDA-MB-435-ASD cells, respectively. Scale bars: 10 uM in (i-ii), 5 uM in (iii-iv). (D) asymmetric partitioning of Numb, in a pair of newly formed daughter cells in a dividing anaphase MDA-MB-435-ASD cell. (E) MDA-MB-435-SD exhibited significantly enhanced clonogeneicity and sphere-forming capability compared with corresponding MDA-MB-435, MDA-MB-435-SE and MDA-MB-435-ASD. a, b and c: different letters represent a significant difference, p

    Journal: Oncotarget

    Article Title: Comparison of tumor biology of two distinct cell sub-populations in lung cancer stem cells

    doi: 10.18632/oncotarget.18451

    Figure Lengend Snippet: SD and ASD cell lines could be obtained from human cancer cells MDA-MB-435 (A) the morphology of MDA-MB-435, MDA-MB-435-SE, MDA-MB-435-SD and MDA-MB-435-ASD, bar=120um. (B) the analysis of mRNA expression of embryonic stem cell markers (Oct4, Sox2, Nanog, Klf4 and c-Myc) in MDA-MB-435, MDA-MB-435-SE, MDA-MB-435-SD and MDA-MB-435-ASD, the tata-Box binding protein gene (Tbp) was reference gene. (C) Analysis of symmetric and asymmetric segregation of BrdU-labeled DNA during mitosis in MDA-MB-435-SD and MDA-MB-435-ASD. BrdU retention on day 6 after BrdU withdrawal in MDA-MB-435-SD (i) and MDA-MB-435-ASD (ii). (iii), #1 and #2: symmetric BrdU segregation between two daughter cells. #3: an adjacent BrdU-positive cell. (iv), asymmetric BrdU segregation between two daughter cells. (v) Quantification of SD and ASD cells in 100 dividing anaphase MDA-MB-435-SD and MDA-MB-435-ASD cells, respectively. Scale bars: 10 uM in (i-ii), 5 uM in (iii-iv). (D) asymmetric partitioning of Numb, in a pair of newly formed daughter cells in a dividing anaphase MDA-MB-435-ASD cell. (E) MDA-MB-435-SD exhibited significantly enhanced clonogeneicity and sphere-forming capability compared with corresponding MDA-MB-435, MDA-MB-435-SE and MDA-MB-435-ASD. a, b and c: different letters represent a significant difference, p

    Article Snippet: BrdU-labeling, analysis of symmetric and asymmetrical chromosome segregation Labeling of DNA templates was achieved by the addition of 10μM BrdU (Sigma) to the culture medium for 7 days followed by BrdU withdrawal.

    Techniques: Multiple Displacement Amplification, Expressing, Binding Assay, Labeling

    PCR amplification of the nuc gene of S. aureus . Lane 1: 100 bp DNA ladder. Lane 5: Amplified PCR product

    Journal: Iranian Journal of Veterinary Research

    Article Title: Isolation, characterization and therapeutic potential assessment of bacteriophages virulent to Staphylococcus aureus associated with goat mastitis

    doi:

    Figure Lengend Snippet: PCR amplification of the nuc gene of S. aureus . Lane 1: 100 bp DNA ladder. Lane 5: Amplified PCR product

    Article Snippet: The PCR mixture consisting of 50 ng template DNA, 20 pmol of each primer and 17 µl PCR master-mix (Qiagen, USA) was diluted up to a 25 µl volume with nuclease free water.

    Techniques: Polymerase Chain Reaction, Amplification

    Adjuvant vaccination after tumor resection leads to clean RAs and reactivation of the immune system to target cancer cells (A) B16F0 tumor-bearing mice underwent R1 tumor resection, were randomized into different treatment groups, and were vaccinated with either C+I, CpG, or PBS for four weeks. (B) DNA from skin biopsies (*) in resection areas (RAs) showed a significant reduction in the percentage of tumor cells after four vaccination rounds with the C+I vaccine, as assessed by ddPCR. (C) Vaccination post-tumor resection led to a reduction of Th17 cells (CD4 + CD62L + TCR-b + (IL-2/IL-17A); CD4 + CD62L + CD44 + TCR-b + (IL-17A)) and an increased presence of TNF-α expressing myeloid cells (CD11b + CD44 + GR1 hi (TNF-a)) and IL-4 expressing CD19 + CD62L + CD44 + B-cells ( n= 8 PBS, n =10 CpG, n =10 C+I, mean±s.e.m., ANOVA with Tukey’s multiple comparison test, *p

    Journal: Cell stem cell

    Article Title: Autologous iPSC-based Vaccines Elicit Anti-Tumor Responses in Vivo

    doi: 10.1016/j.stem.2018.01.016

    Figure Lengend Snippet: Adjuvant vaccination after tumor resection leads to clean RAs and reactivation of the immune system to target cancer cells (A) B16F0 tumor-bearing mice underwent R1 tumor resection, were randomized into different treatment groups, and were vaccinated with either C+I, CpG, or PBS for four weeks. (B) DNA from skin biopsies (*) in resection areas (RAs) showed a significant reduction in the percentage of tumor cells after four vaccination rounds with the C+I vaccine, as assessed by ddPCR. (C) Vaccination post-tumor resection led to a reduction of Th17 cells (CD4 + CD62L + TCR-b + (IL-2/IL-17A); CD4 + CD62L + CD44 + TCR-b + (IL-17A)) and an increased presence of TNF-α expressing myeloid cells (CD11b + CD44 + GR1 hi (TNF-a)) and IL-4 expressing CD19 + CD62L + CD44 + B-cells ( n= 8 PBS, n =10 CpG, n =10 C+I, mean±s.e.m., ANOVA with Tukey’s multiple comparison test, *p

    Article Snippet: Each ddPCR reaction solution was reconstituted to a final volume of 20 μL using 40 to 50 ng of DNA template and ddPCR™ Supermix for Probes, without dUTP (BioRad).

    Techniques: Mouse Assay, Expressing

    (a) ddPCR analysis of the growth of ML cultured in NK250 supplemented with human blood plasma Red, no DNase treatment; blue, DNase treated. (b) ddPCR analysis of DNase treated samples. The results of the DNase treated samples are shown on a different scale, showing an approximately two‐fold increase in ML DNA copy numbers during 150 days of culture. (c) The growth pattern of ML expressed as fold changes in cell counts compared with the start of the experiment.

    Journal: Microbiology and Immunology

    Article Title: Non‐exponential growth of Mycobacterium leprae Thai‐53 strain cultured in vitro

    doi: 10.1111/1348-0421.12454

    Figure Lengend Snippet: (a) ddPCR analysis of the growth of ML cultured in NK250 supplemented with human blood plasma Red, no DNase treatment; blue, DNase treated. (b) ddPCR analysis of DNase treated samples. The results of the DNase treated samples are shown on a different scale, showing an approximately two‐fold increase in ML DNA copy numbers during 150 days of culture. (c) The growth pattern of ML expressed as fold changes in cell counts compared with the start of the experiment.

    Article Snippet: Briefly, DNA templates were mixed with 2× QX200 ddPCR EvaGreen Supermix (Bio‐Rad) and 2 pmol of an ML‐specific primer pair (S13: 5′‐CTCCACCTCCACCGGCGAT‐3′ and S62: 5′‐GACTAGCCTGCCAAGTCG‐3′) , .

    Techniques: Cell Culture

    Effects of DNase treatment on ML‐specific DNA copy numbers in a specimen isolated on the first day of culture Treatment of the cultured specimens with DNase before DNA extraction greatly reduces the numbers of ML DNA copies detected by ddPCR analysis.

    Journal: Microbiology and Immunology

    Article Title: Non‐exponential growth of Mycobacterium leprae Thai‐53 strain cultured in vitro

    doi: 10.1111/1348-0421.12454

    Figure Lengend Snippet: Effects of DNase treatment on ML‐specific DNA copy numbers in a specimen isolated on the first day of culture Treatment of the cultured specimens with DNase before DNA extraction greatly reduces the numbers of ML DNA copies detected by ddPCR analysis.

    Article Snippet: Briefly, DNA templates were mixed with 2× QX200 ddPCR EvaGreen Supermix (Bio‐Rad) and 2 pmol of an ML‐specific primer pair (S13: 5′‐CTCCACCTCCACCGGCGAT‐3′ and S62: 5′‐GACTAGCCTGCCAAGTCG‐3′) , .

    Techniques: Isolation, Cell Culture, DNA Extraction

    N. munroi CA genes and transcripts. CA1 and CA2 genomic DNA (gDNA) sequences are depicted using white boxes to represent introns and numbered gray boxes to represent exons (E1–E4). The mRNA sequences are depicted using colored boxes aligned to

    Journal: Plant Physiology

    Article Title: Loss of the Chloroplast Transit Peptide from an Ancestral C3 Carbonic Anhydrase Is Associated with C4 Evolution in the Grass Genus Neurachne 1 1 [OPEN]

    doi: 10.1104/pp.16.01893

    Figure Lengend Snippet: N. munroi CA genes and transcripts. CA1 and CA2 genomic DNA (gDNA) sequences are depicted using white boxes to represent introns and numbered gray boxes to represent exons (E1–E4). The mRNA sequences are depicted using colored boxes aligned to

    Article Snippet: Upstream regions of the CA1 and CA2 genes in N. alopecuroidea , N. minor , and N. munroi were amplified as a single fragment from 1 μL of genomic DNA template of an individual plant from each species using 0.4 μ m gene-specific primers ( ) and the MyFi Polymerase system (Bioline) in a final volume of 25 μL.

    Techniques:

    Agarose gel stained with ethidium bromide, PCR products of COX-2 gene by using the COX21195A→G (rs689466) primer. Line 1–6 is 273 bp fragments, Line M is 100 bp DNA ladder

    Journal: Iranian Journal of Public Health

    Article Title: Association of COX-2 Promoter Polymorphisms -765G/C and -1195A/G with Migraine

    doi:

    Figure Lengend Snippet: Agarose gel stained with ethidium bromide, PCR products of COX-2 gene by using the COX21195A→G (rs689466) primer. Line 1–6 is 273 bp fragments, Line M is 100 bp DNA ladder

    Article Snippet: Therefore, the final volume of 25 μl PCR reactions in 0.2 ml tubes containing 500 ng/μl of DNA template, 2 mM of MgCl2 concentration, 2 mM dNTPs, 10 pmol/μl of each primer, 5 μl of 10X PCR buffer and 1 U of Taq DNA polymerase (Fermentas, Germany) was performed.

    Techniques: Agarose Gel Electrophoresis, Staining, Polymerase Chain Reaction

    Agarose gel stained with ethidium bromide, PCR products of COX-2 gene by using the COX-2-765G > C (rs20417) primer. Line 1–6 is 309 bp fragments, Line M is 100 bp DNA ladder

    Journal: Iranian Journal of Public Health

    Article Title: Association of COX-2 Promoter Polymorphisms -765G/C and -1195A/G with Migraine

    doi:

    Figure Lengend Snippet: Agarose gel stained with ethidium bromide, PCR products of COX-2 gene by using the COX-2-765G > C (rs20417) primer. Line 1–6 is 309 bp fragments, Line M is 100 bp DNA ladder

    Article Snippet: Therefore, the final volume of 25 μl PCR reactions in 0.2 ml tubes containing 500 ng/μl of DNA template, 2 mM of MgCl2 concentration, 2 mM dNTPs, 10 pmol/μl of each primer, 5 μl of 10X PCR buffer and 1 U of Taq DNA polymerase (Fermentas, Germany) was performed.

    Techniques: Agarose Gel Electrophoresis, Staining, Polymerase Chain Reaction

    Southern hybridization analysis demonstrating that cLV25 originated from the chromosome of B. fragilis LV25. LV25 chromosomal and plasmid DNAs were digested with Eco RI and hybridized with a 3.6-kb internal cLV25 Eco RI fragment from p25Δ.2. Lanes: 1, biotinylated lambda DNA Hin dIII markers; 2, pGAT400ΔBglII; 3, p25Δ.2; 4, LV25 chromosomal DNA; 5, LV25 plasmid DNA. The solid lines indicate the positions of molecular size markers in kilobases. The arrowhead indicates the 3.6-kb cLV25 Eco RI fragment.

    Journal: Journal of Bacteriology

    Article Title: Isolation and Characterization of cLV25, a Bacteroides fragilis Chromosomal Transfer Factor Resembling Multiple Bacteroides sp. Mobilizable Transposons

    doi: 10.1128/JB.184.7.1895-1904.2002

    Figure Lengend Snippet: Southern hybridization analysis demonstrating that cLV25 originated from the chromosome of B. fragilis LV25. LV25 chromosomal and plasmid DNAs were digested with Eco RI and hybridized with a 3.6-kb internal cLV25 Eco RI fragment from p25Δ.2. Lanes: 1, biotinylated lambda DNA Hin dIII markers; 2, pGAT400ΔBglII; 3, p25Δ.2; 4, LV25 chromosomal DNA; 5, LV25 plasmid DNA. The solid lines indicate the positions of molecular size markers in kilobases. The arrowhead indicates the 3.6-kb cLV25 Eco RI fragment.

    Article Snippet: The following three cLV25 fragments were amplified using p25Δ.2 as the DNA template, native Pfu DNA polymerase (Stratagene, La Jolla, Calif.), and the GeneAmp XL PCR kit core reagents.

    Techniques: Hybridization, Plasmid Preparation, Lambda DNA Preparation

    New DNA in pGAT400ΔBglII acquired from B. fragilis LV25. (A) Restriction map of pGAT400ΔBglII. bla , ampicillin resistance; ermF , clindamycin resistance; tetX , aerobic tetracycline resistance; A, Ava I; C, Cla I; E, Eco RI; H, Hin dIII; RV, Eco RV. The solid triangles indicate the locations of cLV25 in pGAT400ΔBglII. (B) Agarose gel of Hin dIII restriction enzyme digestions of pGAT400ΔBglII and transconjugant plasmid DNA from a B. fragilis LV25-to- E. coli HB101 mating. Lanes: 1, pGAT400ΔBglII; 2, p25Δ.1; 3, p25Δ.2; 4, p25Δ.3; 5, p25Δ.4; 6, p25Δ.5; 7, p25Δ.6; 8, high-molecular-weight DNA markers; 9, 1-kb DNA ladder. Molecular size markers in kilobases are indicated on the right. The solid lines on the left indicate pGAT400ΔBglII Hin dIII fragments in kilobases. The arrowhead indicates the presence of 15 kb of new DNA in pGAT400ΔBglII. (C) Sequence analysis of the cLV25 termini. Shown is an alignment of the 20-bp imperfect inverted repeat (underlined) and the sequence of the additional 8 bp detected at the left end of cLV25 after insertion in pGAT400ΔBglII. (D) DNA sequence analysis of the left and right junctions of transconjugant plasmid DNA p25Δ.2. The pGAT400ΔBglII sequence is in uppercase letters, and the cLV25 sequence is in lowercase letters. The 8-bp target site repeat is underlined.

    Journal: Journal of Bacteriology

    Article Title: Isolation and Characterization of cLV25, a Bacteroides fragilis Chromosomal Transfer Factor Resembling Multiple Bacteroides sp. Mobilizable Transposons

    doi: 10.1128/JB.184.7.1895-1904.2002

    Figure Lengend Snippet: New DNA in pGAT400ΔBglII acquired from B. fragilis LV25. (A) Restriction map of pGAT400ΔBglII. bla , ampicillin resistance; ermF , clindamycin resistance; tetX , aerobic tetracycline resistance; A, Ava I; C, Cla I; E, Eco RI; H, Hin dIII; RV, Eco RV. The solid triangles indicate the locations of cLV25 in pGAT400ΔBglII. (B) Agarose gel of Hin dIII restriction enzyme digestions of pGAT400ΔBglII and transconjugant plasmid DNA from a B. fragilis LV25-to- E. coli HB101 mating. Lanes: 1, pGAT400ΔBglII; 2, p25Δ.1; 3, p25Δ.2; 4, p25Δ.3; 5, p25Δ.4; 6, p25Δ.5; 7, p25Δ.6; 8, high-molecular-weight DNA markers; 9, 1-kb DNA ladder. Molecular size markers in kilobases are indicated on the right. The solid lines on the left indicate pGAT400ΔBglII Hin dIII fragments in kilobases. The arrowhead indicates the presence of 15 kb of new DNA in pGAT400ΔBglII. (C) Sequence analysis of the cLV25 termini. Shown is an alignment of the 20-bp imperfect inverted repeat (underlined) and the sequence of the additional 8 bp detected at the left end of cLV25 after insertion in pGAT400ΔBglII. (D) DNA sequence analysis of the left and right junctions of transconjugant plasmid DNA p25Δ.2. The pGAT400ΔBglII sequence is in uppercase letters, and the cLV25 sequence is in lowercase letters. The 8-bp target site repeat is underlined.

    Article Snippet: The following three cLV25 fragments were amplified using p25Δ.2 as the DNA template, native Pfu DNA polymerase (Stratagene, La Jolla, Calif.), and the GeneAmp XL PCR kit core reagents.

    Techniques: Antiviral Assay, Agarose Gel Electrophoresis, Plasmid Preparation, Molecular Weight, Sequencing

    Optimization of ARMS condition. Notes: ARMS amplifications specific for the mutation (c.C799T) were optimized by indicated different primer pairs. The genomic samples of mutant hemizygous proband M001 (I:1) and his normal son (II:3) were used as DNA templates. The black and blue arrows show the position of the point mutation and nonspecific primer-dimer, respectively. I:1=M001; II:3=M002. Abbreviations: ARMS, amplification refractory mutation system; WT, wild-type primer; MT, mutant primer; C, common primer.

    Journal: The Application of Clinical Genetics

    Article Title: Evaluation of amplification refractory mutation system (ARMS) technique for quick and accurate prenatal gene diagnosis of CHM variant in choroideremia

    doi: 10.2147/TACG.S144383

    Figure Lengend Snippet: Optimization of ARMS condition. Notes: ARMS amplifications specific for the mutation (c.C799T) were optimized by indicated different primer pairs. The genomic samples of mutant hemizygous proband M001 (I:1) and his normal son (II:3) were used as DNA templates. The black and blue arrows show the position of the point mutation and nonspecific primer-dimer, respectively. I:1=M001; II:3=M002. Abbreviations: ARMS, amplification refractory mutation system; WT, wild-type primer; MT, mutant primer; C, common primer.

    Article Snippet: ARMS-PCR amplification PCR was performed in a 10 µL reaction volume for DNA samples M001, M002, M003, M004, M050, and M051 that comprised 1 µL DNA template (15 ng), 1 µL 3.3 µM primers, 5 µL 2X PCR Taq Master Mix (TianGen Biotech Co. Ltd., Beijing, People’s Republic of China), and 3 µL double-distilled water.

    Techniques: Mutagenesis, Amplification

    ARMS amplification by primers CHM-WT2 (WT2) and CHM-Common, and primers CHM-MT and CHM-Common. Notes: ( A ) ARMS amplification for different DNA samples. The black arrow shows the specific PCR products. ( B ) Verification of M003 by Sanger sequencing. The black arrow shows the position of the point mutation. I:1=M001; II:3=M002; II:2=M003; III:1=M004; II:1=M050; M051=Normal male control. Abbreviations: ARMS, amplification refractory mutation system; CHM, choroideremia; WT, wild-type primer; MT, mutant primer; C, common primer.

    Journal: The Application of Clinical Genetics

    Article Title: Evaluation of amplification refractory mutation system (ARMS) technique for quick and accurate prenatal gene diagnosis of CHM variant in choroideremia

    doi: 10.2147/TACG.S144383

    Figure Lengend Snippet: ARMS amplification by primers CHM-WT2 (WT2) and CHM-Common, and primers CHM-MT and CHM-Common. Notes: ( A ) ARMS amplification for different DNA samples. The black arrow shows the specific PCR products. ( B ) Verification of M003 by Sanger sequencing. The black arrow shows the position of the point mutation. I:1=M001; II:3=M002; II:2=M003; III:1=M004; II:1=M050; M051=Normal male control. Abbreviations: ARMS, amplification refractory mutation system; CHM, choroideremia; WT, wild-type primer; MT, mutant primer; C, common primer.

    Article Snippet: ARMS-PCR amplification PCR was performed in a 10 µL reaction volume for DNA samples M001, M002, M003, M004, M050, and M051 that comprised 1 µL DNA template (15 ng), 1 µL 3.3 µM primers, 5 µL 2X PCR Taq Master Mix (TianGen Biotech Co. Ltd., Beijing, People’s Republic of China), and 3 µL double-distilled water.

    Techniques: Amplification, Polymerase Chain Reaction, Sequencing, Mutagenesis

    DNA template and RNA transcript of HiTS-RAP. (A) Schematics of the DNA template used for HiTS-RAP and the resulting halted RNA transcript. DNA template encoding the RNA of interest (green) is flanked by the Illumina flowcell adaptor 1 (gray) and T7 RNA polymerase promoter (orange) upstream, and by the Illumina sequencing primer annealing site (purple), Tus-binding Ter site (red), and Illumina flowcell adaptor 2 downstream. Illumina flowcell adaptors 1 and 2 are required for cluster generation on Illumina GA flowcell. T7 RNA polymerase promoter is required for transcription of the RNA of interest. The Illumina sequencing primer is used for sequencing the DNA template of the RNA of interest and serves as a docking site for the T7 RNA polymerase when it is halted. Tus protein binds to Ter site and halts the transcribing RNA polymerase. Direction of transcription and sequencing are indicated by orange and purple arrows, respectively. Tus-bound Ter site that is non-permissive (halting) and permissive (read-through) to RNA polymerase are indicated by solid and open red triangles, respectively. The halted RNA transcript includes a triplet G derived from the T7 promoter, followed by the RNA of interest and some of the Illumina sequencing primer. The 3’-end of RNA transcript, indicated by a dashed line, is inaccessible. (B) Construction of DNA templates for HiTS-RAP. DNA template is constructed by PCR in two steps using 2 sets of nested oligos. Forward oligos introduce T7 promoter (step 1) and Illumina flowcell adaptor (step 2), whereas reverse oligos introduce Illumina sequencing primer (step 1), and Ter site and Illumina flowcell adaptor 2 (step 2). (C) Sequence of the HiTS-RAP DNA template for GFP aptamer. GFP aptamer encoding sequence is in green, and the rest of the sequences are colored as in (A). The transcription start site is indicated by +1 and a broken arrow. (D) Sequence of the halted RNA transcript from GFP aptamer template. Sequences are colored as in (C). Uppercase indicates the region of the halted RNA transcript that is accessible, and the lowercase indicates a region that is likely to be buried in T7 RNA polymerase and thus inaccessible by other proteins.

    Journal: Nature protocols

    Article Title: Quantitative Assessment of RNA-Protein Interactions with High Throughput Sequencing - RNA Affinity Profiling (HiTS-RAP)

    doi: 10.1038/nprot.2015.074

    Figure Lengend Snippet: DNA template and RNA transcript of HiTS-RAP. (A) Schematics of the DNA template used for HiTS-RAP and the resulting halted RNA transcript. DNA template encoding the RNA of interest (green) is flanked by the Illumina flowcell adaptor 1 (gray) and T7 RNA polymerase promoter (orange) upstream, and by the Illumina sequencing primer annealing site (purple), Tus-binding Ter site (red), and Illumina flowcell adaptor 2 downstream. Illumina flowcell adaptors 1 and 2 are required for cluster generation on Illumina GA flowcell. T7 RNA polymerase promoter is required for transcription of the RNA of interest. The Illumina sequencing primer is used for sequencing the DNA template of the RNA of interest and serves as a docking site for the T7 RNA polymerase when it is halted. Tus protein binds to Ter site and halts the transcribing RNA polymerase. Direction of transcription and sequencing are indicated by orange and purple arrows, respectively. Tus-bound Ter site that is non-permissive (halting) and permissive (read-through) to RNA polymerase are indicated by solid and open red triangles, respectively. The halted RNA transcript includes a triplet G derived from the T7 promoter, followed by the RNA of interest and some of the Illumina sequencing primer. The 3’-end of RNA transcript, indicated by a dashed line, is inaccessible. (B) Construction of DNA templates for HiTS-RAP. DNA template is constructed by PCR in two steps using 2 sets of nested oligos. Forward oligos introduce T7 promoter (step 1) and Illumina flowcell adaptor (step 2), whereas reverse oligos introduce Illumina sequencing primer (step 1), and Ter site and Illumina flowcell adaptor 2 (step 2). (C) Sequence of the HiTS-RAP DNA template for GFP aptamer. GFP aptamer encoding sequence is in green, and the rest of the sequences are colored as in (A). The transcription start site is indicated by +1 and a broken arrow. (D) Sequence of the halted RNA transcript from GFP aptamer template. Sequences are colored as in (C). Uppercase indicates the region of the halted RNA transcript that is accessible, and the lowercase indicates a region that is likely to be buried in T7 RNA polymerase and thus inaccessible by other proteins.

    Article Snippet: Quantitative analysis of RNA on a massively parallel array (RNA-MaP) is conceptually identical to HiTS-RAP, where sequencing, transcription of RNA encoding templates, and binding of fluorescently labeled protein to RNA transcripts retained on the DNA template are done on an Illumina GAIIx instrument .

    Techniques: Sequencing, Binding Assay, Derivative Assay, Construct, Polymerase Chain Reaction, Introduce

    CRISPR/Cas9-mediated deletion of CISH in iC9/CAR19/IL-15 NK cells. a , Schematic representation of CRISPR/Cas9-mediated CISH KO using two guide RNAs (gRNA) targeting exon 4 of the CISH gene. b,c, CB-NK cells were expanded with K562 based feeder cells and IL-2, then either left non-transduced (NT) or transduced with a retroviral vector expressing iC9/CAR19/IL-15 construct on day 4 of expansion. On day 7 of expansion, NT and iC9/CAR19/IL-15-expressing CB-NK cells were nucleofected with Cas9 alone (Cas9 mock), Cas9 preloaded with gRNA targeting CISH exon 4 ( CISH KO) or non-nucleofected (WT). The CISH KO efficiency was determined by PCR ( b ) and western blot analysis ( c ). d , Sanger sequencing results showing multiple peaks reflecting non-homologous end joining (NHEJ) events in NT or iC9/CAR19/IL-15 (CAR) NK cells that underwent CISH KO compared to single peaks in CTRL (Cas9 mock). Arrows indicate the base pair position where the gene editing started. e , Bar graphs showing the relative mRNA expression levels of CISH determined on days 0, 7, 14 and 21 of expansion in NT (blue) and iC9/CAR19/IL-15 transduced (grey) NK cells by reverse transcription polymerase chain reaction (RT-PCR) (n=3). Note that on days 0 and 7 only data for NT-NK cells are included since the CAR transduction step is performed on day 4 of expansion.18 S ribosomal RNA (18S) was used as the internal reference gene. Bars represent mean values with standard deviation, *p ≤ 0.05.

    Journal: bioRxiv

    Article Title: CIS checkpoint deletion enhances the fitness of cord blood derived natural killer cells transduced with a chimeric antigen receptor

    doi: 10.1101/2020.03.29.014472

    Figure Lengend Snippet: CRISPR/Cas9-mediated deletion of CISH in iC9/CAR19/IL-15 NK cells. a , Schematic representation of CRISPR/Cas9-mediated CISH KO using two guide RNAs (gRNA) targeting exon 4 of the CISH gene. b,c, CB-NK cells were expanded with K562 based feeder cells and IL-2, then either left non-transduced (NT) or transduced with a retroviral vector expressing iC9/CAR19/IL-15 construct on day 4 of expansion. On day 7 of expansion, NT and iC9/CAR19/IL-15-expressing CB-NK cells were nucleofected with Cas9 alone (Cas9 mock), Cas9 preloaded with gRNA targeting CISH exon 4 ( CISH KO) or non-nucleofected (WT). The CISH KO efficiency was determined by PCR ( b ) and western blot analysis ( c ). d , Sanger sequencing results showing multiple peaks reflecting non-homologous end joining (NHEJ) events in NT or iC9/CAR19/IL-15 (CAR) NK cells that underwent CISH KO compared to single peaks in CTRL (Cas9 mock). Arrows indicate the base pair position where the gene editing started. e , Bar graphs showing the relative mRNA expression levels of CISH determined on days 0, 7, 14 and 21 of expansion in NT (blue) and iC9/CAR19/IL-15 transduced (grey) NK cells by reverse transcription polymerase chain reaction (RT-PCR) (n=3). Note that on days 0 and 7 only data for NT-NK cells are included since the CAR transduction step is performed on day 4 of expansion.18 S ribosomal RNA (18S) was used as the internal reference gene. Bars represent mean values with standard deviation, *p ≤ 0.05.

    Article Snippet: DNA templates for gRNAs were made using the protocol described by Li et al. We used two gRNAs targeting exon 4 of the human CISH gene: crRNA1:AGGCCACATAGTGCTGCACA, crRNA2: TGTACAGCAGTGGCTGGTGG.

    Techniques: CRISPR, Chromogenic In Situ Hybridization, Transduction, Plasmid Preparation, Expressing, Construct, Polymerase Chain Reaction, Western Blot, Sequencing, Non-Homologous End Joining, Reverse Transcription Polymerase Chain Reaction, Standard Deviation

    PCR assay for detection of bla VEB gene with product size: 600 bp. Lanes 3–17: Amplified products, Lanes 2 and 19: Positive control, Lanes 1 and 20: DNA ladder 100 bp, Lane 18: Negative control

    Journal: GMS Hygiene and Infection Control

    Article Title: Prevalence of extended-spectrum beta-lactamase genes in Acinetobacter baumannii strains isolated from nosocomial infections in Tehran, Iran

    doi: 10.3205/dgkh000318

    Figure Lengend Snippet: PCR assay for detection of bla VEB gene with product size: 600 bp. Lanes 3–17: Amplified products, Lanes 2 and 19: Positive control, Lanes 1 and 20: DNA ladder 100 bp, Lane 18: Negative control

    Article Snippet: The PCR mixture contained the DNA template, Forward/Reverse primers, and master mix (Bioneer Co., Korea, Cat. number K-2016).

    Techniques: Polymerase Chain Reaction, Amplification, Positive Control, Negative Control

    PCR assay for detection of bla TEM gene with product size: 700 bp. Lanes 2–36: Amplified products, Lane 37: Positive control, Lanes 1 and 40: DNA ladder 100 bp, Lane 38–40: Negative control

    Journal: GMS Hygiene and Infection Control

    Article Title: Prevalence of extended-spectrum beta-lactamase genes in Acinetobacter baumannii strains isolated from nosocomial infections in Tehran, Iran

    doi: 10.3205/dgkh000318

    Figure Lengend Snippet: PCR assay for detection of bla TEM gene with product size: 700 bp. Lanes 2–36: Amplified products, Lane 37: Positive control, Lanes 1 and 40: DNA ladder 100 bp, Lane 38–40: Negative control

    Article Snippet: The PCR mixture contained the DNA template, Forward/Reverse primers, and master mix (Bioneer Co., Korea, Cat. number K-2016).

    Techniques: Polymerase Chain Reaction, Transmission Electron Microscopy, Amplification, Positive Control, Negative Control

    PCR assay for detection of bla SHV gene with product size: 700 bp. Lanes 3–18: Amplified products, Lane 2: Positive control, Lanes 1 and 20: DNA ladder 100 bp, Lane 19: Negative control

    Journal: GMS Hygiene and Infection Control

    Article Title: Prevalence of extended-spectrum beta-lactamase genes in Acinetobacter baumannii strains isolated from nosocomial infections in Tehran, Iran

    doi: 10.3205/dgkh000318

    Figure Lengend Snippet: PCR assay for detection of bla SHV gene with product size: 700 bp. Lanes 3–18: Amplified products, Lane 2: Positive control, Lanes 1 and 20: DNA ladder 100 bp, Lane 19: Negative control

    Article Snippet: The PCR mixture contained the DNA template, Forward/Reverse primers, and master mix (Bioneer Co., Korea, Cat. number K-2016).

    Techniques: Polymerase Chain Reaction, Amplification, Positive Control, Negative Control

    Restriction analysis with Rsa I of DNA amplified with primer pair ITS 5 and ITS 4 from P. infestans US-6 NY (lane 2), P. infestans 93-1 (lane 3), P. mirabilis 0S0016 (lane 4), P. fragariae A-8 (lane 5), P. megasperma NY 318 (lane 6), P. megasperma NY 412 (lane 7), P. sojae R1 (lane 8), P. cinnamomi 2302 (lane 9), P. cryptogea PCR-1 (lane 10), and P. erythroseptica 4 (lane 11). Lanes 1 and 12 contain 100-bp ladders.

    Journal: Applied and Environmental Microbiology

    Article Title: PCR Amplification of Ribosomal DNA for Species Identification in the Plant Pathogen Genus Phytophthora

    doi:

    Figure Lengend Snippet: Restriction analysis with Rsa I of DNA amplified with primer pair ITS 5 and ITS 4 from P. infestans US-6 NY (lane 2), P. infestans 93-1 (lane 3), P. mirabilis 0S0016 (lane 4), P. fragariae A-8 (lane 5), P. megasperma NY 318 (lane 6), P. megasperma NY 412 (lane 7), P. sojae R1 (lane 8), P. cinnamomi 2302 (lane 9), P. cryptogea PCR-1 (lane 10), and P. erythroseptica 4 (lane 11). Lanes 1 and 12 contain 100-bp ladders.

    Article Snippet: Each reaction tube contained approximately 1 μl of a 1-ng/μl DNA template, 5 μl of 10× PCR buffer (Boehringer Mannheim, Indianapolis, Ind.), 36.6 μl of sterile distilled water, 2 μl (each) of 1.25 mM deoxynucleoside triphosphates (Pharmacia Biotech, Piscataway, N.J.), 2 μl of 10 mM MgCl2 (Sigma, St. Louis, Mo.), 2 μl each of 10 μM forward and reverse primers , and 0.4 μl of Taq (5 U/μl; Boehringer Mannheim).

    Techniques: Amplification, Polymerase Chain Reaction

    Restriction analysis with Hae III of DNA amplified with ITS 5 and ITS 4 from P. palmivora P8 (lane 2), P. erythroseptica 4 (lane 3), P. cryptogea PCR-1 (lane 4), P. citrophthora M86 (lane 5), P. cinnamomi 2302 (lane 6), P. fragariae A-8 (lane 7), P. megasperma NY 412 (lane 8), P. sojae R1 (lane 9), and P. megasperma NY 318 (lane 10). Lanes 1 and 11 contain 100-bp ladders.

    Journal: Applied and Environmental Microbiology

    Article Title: PCR Amplification of Ribosomal DNA for Species Identification in the Plant Pathogen Genus Phytophthora

    doi:

    Figure Lengend Snippet: Restriction analysis with Hae III of DNA amplified with ITS 5 and ITS 4 from P. palmivora P8 (lane 2), P. erythroseptica 4 (lane 3), P. cryptogea PCR-1 (lane 4), P. citrophthora M86 (lane 5), P. cinnamomi 2302 (lane 6), P. fragariae A-8 (lane 7), P. megasperma NY 412 (lane 8), P. sojae R1 (lane 9), and P. megasperma NY 318 (lane 10). Lanes 1 and 11 contain 100-bp ladders.

    Article Snippet: Each reaction tube contained approximately 1 μl of a 1-ng/μl DNA template, 5 μl of 10× PCR buffer (Boehringer Mannheim, Indianapolis, Ind.), 36.6 μl of sterile distilled water, 2 μl (each) of 1.25 mM deoxynucleoside triphosphates (Pharmacia Biotech, Piscataway, N.J.), 2 μl of 10 mM MgCl2 (Sigma, St. Louis, Mo.), 2 μl each of 10 μM forward and reverse primers , and 0.4 μl of Taq (5 U/μl; Boehringer Mannheim).

    Techniques: Amplification, Polymerase Chain Reaction

    The effects of ChA on Akkermansia . ( A ) Comparison of the relative abundance of Akkermansia in fecal samples of DSS colitis mice analyzed by 16S rRNA gene sequencing; ( B ) A comparison of the relative abundance of Akkermansia in fecal samples of normal mice that were treated with ChA. Akkermansia was quantified with qPCR by amplifying fecal DNA with primers specific for Akkermansia and universal bacterial primers; ( C ) The polymerase chain reaction products were analyzed by electrophoresis in a 2% agarose gel. * p

    Journal: Nutrients

    Article Title: Chlorogenic Acid Ameliorates Experimental Colitis by Promoting Growth of Akkermansia in Mice

    doi: 10.3390/nu9070677

    Figure Lengend Snippet: The effects of ChA on Akkermansia . ( A ) Comparison of the relative abundance of Akkermansia in fecal samples of DSS colitis mice analyzed by 16S rRNA gene sequencing; ( B ) A comparison of the relative abundance of Akkermansia in fecal samples of normal mice that were treated with ChA. Akkermansia was quantified with qPCR by amplifying fecal DNA with primers specific for Akkermansia and universal bacterial primers; ( C ) The polymerase chain reaction products were analyzed by electrophoresis in a 2% agarose gel. * p

    Article Snippet: All polymerase chain reaction (PCR) recations contained 10 ng DNA template, TransStart FastPfu Polymerase (Transgen Biotech, Beijing, China) and forward primer and reverse primer at a final concentration of 200 nM.

    Techniques: Mouse Assay, Sequencing, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Electrophoresis, Agarose Gel Electrophoresis