dna polymerase Takara Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher takara dna polymerase
    Takara Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/takara dna polymerase/product/Thermo Fisher
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    takara dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    TaKaRa takara dna polymerase
    Detection and determination of Has2 gene mutation A 454 bp region within exon2 of rat Has2 that contains the Cas9 mutation site was <t>PCR</t> amplified from genomic <t>DNA</t> of each cell clone as a template. The amplified product was gel-purified and then digested with Pas1. The final products were analyzed by agarose gel electrophoresis. DNA standards (std) are labeled. Panel A. Products amplified from RCS-o WT cells and clones 1 thru 7. Panel B. Pas1 digestion products of the amplified 454 bp products shown in panel A. Panel C. Products amplified from RCS-Cas9 WT cells and clones 3, 7, 39, 43, 53, 80 and 88. Panel D. Pas1 digestion products of the amplified 454 bp products shown in panel C. Panel E. Alignment of the targeted rat Has2 genomic sequences from RCS-Cas9 clone #7, allele 1 and allele 2 with the WT RCS-Cas9 cells. Deleted bases are indicated.
    Takara Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 477 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/takara dna polymerase/product/TaKaRa
    Average 99 stars, based on 477 article reviews
    Price from $9.99 to $1999.99
    takara dna polymerase - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    90
    TaKaRa taq dna polymerase
    (A) Genotype in each generation of mutant mice confirmed by PCR analysis on isolated genomic <t>DNA.</t> PCR was performed on the isolated genomic DNA using <t>taq</t> DNA polymerase and primer sets (#1 and #2 are for wild-type and GluR2 delta7 KI, #3 and #4 are for
    Taq Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 9959 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/TaKaRa
    Average 90 stars, based on 9959 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    TaKaRa z taq polymerase
    (A) Genotype in each generation of mutant mice confirmed by PCR analysis on isolated genomic <t>DNA.</t> PCR was performed on the isolated genomic DNA using <t>taq</t> DNA polymerase and primer sets (#1 and #2 are for wild-type and GluR2 delta7 KI, #3 and #4 are for
    Z Taq Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/z taq polymerase/product/TaKaRa
    Average 90 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    z taq polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    TaKaRa la taq polymerase
    PCR of subdivided genomic sequences. Three regions of human genomic DNA (GenBank accession nos AC006454 , AC093734 and X91835 , with 5103, 5193 and 12 114 bp, respectively) were subdivided into nine 567, 577 and 1346 bp PCR sites, respectively. PCR was performed for each subdivided site using primer sets (20 bp each) corresponding to the terminal sequence of each site using the <t>Taq</t> DNA polymerase ( ExTaq DNA polymerase plus ‘hot start’ antibody; <t>Takara-bio).</t> PCR was carried out in the absence and in the presence of Tth RecA protein and ATP. The products were electrophoresed and stained with ethidium bromide. ( a ) A diagrammatic representation of the subdivided region (5103 bp in GenBank accession no AC006454 ) (upper panel) and the electrophoretic patterns of the PCR products (lower panel). ( b ) A diagrammatic representation of the subdivided region (5193 bp in GenBank accession no AC093734 ) (upper panel) and the electrophoretic patterns of the PCR products (lower panel). ( c ) A diagrammatic representation of the subdivided region (12 114 bp in GenBank accession no X91835 ) (upper panel) and the electrophoretic patterns of the PCR products (lower panel). Throughout (a–c), nine subdivided sites for each region are indicated as a-1 to a-9, b-1 to b-9 and c-1 to c-9. Nucleotide (nt) numbers correspond to registries in GenBank. Locations of the specific PCR products are indicated by arrows.
    La Taq Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 4252 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/la taq polymerase/product/TaKaRa
    Average 90 stars, based on 4252 article reviews
    Price from $9.99 to $1999.99
    la taq polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    TaKaRa t4 dna polymerase
    The PCR product of a foreign gene was amplified by <t>T4</t> DNA polymerase and dGTP, and then was ligated with the Bsu36I-digested pRTRA. The ligation mixture was transformed to the donor strain DH10β, and then the recombinant donor plasmid was obtained. We introduced the two different Bsu36I sites (CCTTAGG and CCTGAGG) in the pRTRA vector and the 4 nt TTAC(5′–3′) in the forward primer and the other 4 nt TGAC(5′–3′) in the reverse primer. The complete digestion of pRTRA with Bsu36I results in a linearized donor vector with overhang ends of 5′-TTA-3′ and 5′-TCA-3′, respectively. We made use of the 3′→5′ exonuclease activity and 5′→3′ polymerase activity of T4 DNA polymerase. When T4 DNA polymerase encounters the first Guanine nucleotide at the 5′ end of the DNA in the dGTP bath, the reaction will keep the balance between the exonuclease activity and polymerase activity. Therefore, the overhang ends of the gene fragments of interest will be digested to be perfectly compatible with the vector.
    T4 Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 730 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna polymerase/product/TaKaRa
    Average 90 stars, based on 730 article reviews
    Price from $9.99 to $1999.99
    t4 dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    TaKaRa ex taq dna polymerase
    PCR-RFLP fragments of the 23S rRNA gene in 3% agarose gel electrophoresis digestion with <t>Taq</t> I. Lane M: 100 bp <t>DNA</t> ladder; lane 1: B. hyodysenteriae B204; lane 2: B. hyodysenteriae B234; lane 3: B. hyodysenteriae B169; lane 4: B. pilosicoli P43/6/78; lane 5 to 14: B. hyodysenteriae field isolates; lane 15: B. murdochii 56-150; lane 16: B. intermedia PWS/A; lane 17: B. innocens B256.
    Ex Taq Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 7360 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ex taq dna polymerase/product/TaKaRa
    Average 90 stars, based on 7360 article reviews
    Price from $9.99 to $1999.99
    ex taq dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    TaKaRa primestar hs dna polymerase
    Characterization of <t>DNA</t> analogs. ( A ) PCR assays analyzed by 5% native polyacrylamide gel electrophoresis. Total PCR volume 100 µl: 20 ng 418-bp DNA template (pJ1506), 0.4 mM each LJM-3222 (5'-G TA CGC AG T ) and LJM-3223 (5'-TGTGAGT AGCTCACTCAT AG ), 0.2 mM each dNTP with indicated analog triphosphate ( 1–9 ) completely replacing appropriate dNTP, and 5 U DNA polymerase (indicated with plus symbol) with associated buffer and cycle conditions. Taq DNA polymerase ( Taq ) conditions: Taq DNA polymerase buffer with 100 mg/ml BSA and 2 mM MgCl ; 98°C (3 min), 30 cycles of [94°C (30 s), 60°C (30 s), and 72°C (45 s)], 72°C (5 min). <t>PrimeSTAR</t> HS DNA polymerase (PS) conditions: PrimeSTAR GC buffer with 2 M betaine; 98°C (3 min), 30 cycles of [98°C (15 s), 60°C (5 s), and 72°C (45 s)], 72°C (5 min). Pwo SuperYield DNA Polymerase ( Pwo ) conditions: Pwo PCR buffer with GC-rich solution and 2 M betaine; 98°C (3 min), 30 cycles of [98°C (1 min), 60°C (2 min), and 72°C (8 min)], 72°C (5 min). Lane 1 is marker (M) DNA (100 bp DNA ladder, Invitrogen) with 400 - and 500-bp bands indicated. ( B ) Anion exchange chromatography of 98-bp DNA-like polymers (pJ1923). Following equilibration in 20 mM Tris–HCl, pH 8 (buffer A), samples were eluted over 25 min at a 1 ml/min flow rate in a linear gradient from 50 to 100% buffer B (buffer A plus 1 M NaCl). Eluent absorbance at 260 nm (milli-absorbance units) was monitored with elution time (min).
    Primestar Hs Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 244 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primestar hs dna polymerase/product/TaKaRa
    Average 90 stars, based on 244 article reviews
    Price from $9.99 to $1999.99
    primestar hs dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    TaKaRa seqamp dna polymerase
    Characterization of <t>DNA</t> analogs. ( A ) PCR assays analyzed by 5% native polyacrylamide gel electrophoresis. Total PCR volume 100 µl: 20 ng 418-bp DNA template (pJ1506), 0.4 mM each LJM-3222 (5'-G TA CGC AG T ) and LJM-3223 (5'-TGTGAGT AGCTCACTCAT AG ), 0.2 mM each dNTP with indicated analog triphosphate ( 1–9 ) completely replacing appropriate dNTP, and 5 U DNA polymerase (indicated with plus symbol) with associated buffer and cycle conditions. Taq DNA polymerase ( Taq ) conditions: Taq DNA polymerase buffer with 100 mg/ml BSA and 2 mM MgCl ; 98°C (3 min), 30 cycles of [94°C (30 s), 60°C (30 s), and 72°C (45 s)], 72°C (5 min). <t>PrimeSTAR</t> HS DNA polymerase (PS) conditions: PrimeSTAR GC buffer with 2 M betaine; 98°C (3 min), 30 cycles of [98°C (15 s), 60°C (5 s), and 72°C (45 s)], 72°C (5 min). Pwo SuperYield DNA Polymerase ( Pwo ) conditions: Pwo PCR buffer with GC-rich solution and 2 M betaine; 98°C (3 min), 30 cycles of [98°C (1 min), 60°C (2 min), and 72°C (8 min)], 72°C (5 min). Lane 1 is marker (M) DNA (100 bp DNA ladder, Invitrogen) with 400 - and 500-bp bands indicated. ( B ) Anion exchange chromatography of 98-bp DNA-like polymers (pJ1923). Following equilibration in 20 mM Tris–HCl, pH 8 (buffer A), samples were eluted over 25 min at a 1 ml/min flow rate in a linear gradient from 50 to 100% buffer B (buffer A plus 1 M NaCl). Eluent absorbance at 260 nm (milli-absorbance units) was monitored with elution time (min).
    Seqamp Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 130 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/seqamp dna polymerase/product/TaKaRa
    Average 90 stars, based on 130 article reviews
    Price from $9.99 to $1999.99
    seqamp dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    88
    TaKaRa e2tak dna polymerase
    Characterization of <t>DNA</t> analogs. ( A ) PCR assays analyzed by 5% native polyacrylamide gel electrophoresis. Total PCR volume 100 µl: 20 ng 418-bp DNA template (pJ1506), 0.4 mM each LJM-3222 (5'-G TA CGC AG T ) and LJM-3223 (5'-TGTGAGT AGCTCACTCAT AG ), 0.2 mM each dNTP with indicated analog triphosphate ( 1–9 ) completely replacing appropriate dNTP, and 5 U DNA polymerase (indicated with plus symbol) with associated buffer and cycle conditions. Taq DNA polymerase ( Taq ) conditions: Taq DNA polymerase buffer with 100 mg/ml BSA and 2 mM MgCl ; 98°C (3 min), 30 cycles of [94°C (30 s), 60°C (30 s), and 72°C (45 s)], 72°C (5 min). <t>PrimeSTAR</t> HS DNA polymerase (PS) conditions: PrimeSTAR GC buffer with 2 M betaine; 98°C (3 min), 30 cycles of [98°C (15 s), 60°C (5 s), and 72°C (45 s)], 72°C (5 min). Pwo SuperYield DNA Polymerase ( Pwo ) conditions: Pwo PCR buffer with GC-rich solution and 2 M betaine; 98°C (3 min), 30 cycles of [98°C (1 min), 60°C (2 min), and 72°C (8 min)], 72°C (5 min). Lane 1 is marker (M) DNA (100 bp DNA ladder, Invitrogen) with 400 - and 500-bp bands indicated. ( B ) Anion exchange chromatography of 98-bp DNA-like polymers (pJ1923). Following equilibration in 20 mM Tris–HCl, pH 8 (buffer A), samples were eluted over 25 min at a 1 ml/min flow rate in a linear gradient from 50 to 100% buffer B (buffer A plus 1 M NaCl). Eluent absorbance at 260 nm (milli-absorbance units) was monitored with elution time (min).
    E2tak Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 88/100, based on 72 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e2tak dna polymerase/product/TaKaRa
    Average 88 stars, based on 72 article reviews
    Price from $9.99 to $1999.99
    e2tak dna polymerase - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    94
    Beijing CWBio dna polymerase
    Characterization of <t>DNA</t> analogs. ( A ) PCR assays analyzed by 5% native polyacrylamide gel electrophoresis. Total PCR volume 100 µl: 20 ng 418-bp DNA template (pJ1506), 0.4 mM each LJM-3222 (5'-G TA CGC AG T ) and LJM-3223 (5'-TGTGAGT AGCTCACTCAT AG ), 0.2 mM each dNTP with indicated analog triphosphate ( 1–9 ) completely replacing appropriate dNTP, and 5 U DNA polymerase (indicated with plus symbol) with associated buffer and cycle conditions. Taq DNA polymerase ( Taq ) conditions: Taq DNA polymerase buffer with 100 mg/ml BSA and 2 mM MgCl ; 98°C (3 min), 30 cycles of [94°C (30 s), 60°C (30 s), and 72°C (45 s)], 72°C (5 min). <t>PrimeSTAR</t> HS DNA polymerase (PS) conditions: PrimeSTAR GC buffer with 2 M betaine; 98°C (3 min), 30 cycles of [98°C (15 s), 60°C (5 s), and 72°C (45 s)], 72°C (5 min). Pwo SuperYield DNA Polymerase ( Pwo ) conditions: Pwo PCR buffer with GC-rich solution and 2 M betaine; 98°C (3 min), 30 cycles of [98°C (1 min), 60°C (2 min), and 72°C (8 min)], 72°C (5 min). Lane 1 is marker (M) DNA (100 bp DNA ladder, Invitrogen) with 400 - and 500-bp bands indicated. ( B ) Anion exchange chromatography of 98-bp DNA-like polymers (pJ1923). Following equilibration in 20 mM Tris–HCl, pH 8 (buffer A), samples were eluted over 25 min at a 1 ml/min flow rate in a linear gradient from 50 to 100% buffer B (buffer A plus 1 M NaCl). Eluent absorbance at 260 nm (milli-absorbance units) was monitored with elution time (min).
    Dna Polymerase, supplied by Beijing CWBio, used in various techniques. Bioz Stars score: 94/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase/product/Beijing CWBio
    Average 94 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    dna polymerase - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    90
    TaKaRa extaq hot start version
    Characterization of <t>DNA</t> analogs. ( A ) PCR assays analyzed by 5% native polyacrylamide gel electrophoresis. Total PCR volume 100 µl: 20 ng 418-bp DNA template (pJ1506), 0.4 mM each LJM-3222 (5'-G TA CGC AG T ) and LJM-3223 (5'-TGTGAGT AGCTCACTCAT AG ), 0.2 mM each dNTP with indicated analog triphosphate ( 1–9 ) completely replacing appropriate dNTP, and 5 U DNA polymerase (indicated with plus symbol) with associated buffer and cycle conditions. Taq DNA polymerase ( Taq ) conditions: Taq DNA polymerase buffer with 100 mg/ml BSA and 2 mM MgCl ; 98°C (3 min), 30 cycles of [94°C (30 s), 60°C (30 s), and 72°C (45 s)], 72°C (5 min). <t>PrimeSTAR</t> HS DNA polymerase (PS) conditions: PrimeSTAR GC buffer with 2 M betaine; 98°C (3 min), 30 cycles of [98°C (15 s), 60°C (5 s), and 72°C (45 s)], 72°C (5 min). Pwo SuperYield DNA Polymerase ( Pwo ) conditions: Pwo PCR buffer with GC-rich solution and 2 M betaine; 98°C (3 min), 30 cycles of [98°C (1 min), 60°C (2 min), and 72°C (8 min)], 72°C (5 min). Lane 1 is marker (M) DNA (100 bp DNA ladder, Invitrogen) with 400 - and 500-bp bands indicated. ( B ) Anion exchange chromatography of 98-bp DNA-like polymers (pJ1923). Following equilibration in 20 mM Tris–HCl, pH 8 (buffer A), samples were eluted over 25 min at a 1 ml/min flow rate in a linear gradient from 50 to 100% buffer B (buffer A plus 1 M NaCl). Eluent absorbance at 260 nm (milli-absorbance units) was monitored with elution time (min).
    Extaq Hot Start Version, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 157 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/extaq hot start version/product/TaKaRa
    Average 90 stars, based on 157 article reviews
    Price from $9.99 to $1999.99
    extaq hot start version - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    TaKaRa hot start dna polymerase
    Characterization of <t>DNA</t> analogs. ( A ) PCR assays analyzed by 5% native polyacrylamide gel electrophoresis. Total PCR volume 100 µl: 20 ng 418-bp DNA template (pJ1506), 0.4 mM each LJM-3222 (5'-G TA CGC AG T ) and LJM-3223 (5'-TGTGAGT AGCTCACTCAT AG ), 0.2 mM each dNTP with indicated analog triphosphate ( 1–9 ) completely replacing appropriate dNTP, and 5 U DNA polymerase (indicated with plus symbol) with associated buffer and cycle conditions. Taq DNA polymerase ( Taq ) conditions: Taq DNA polymerase buffer with 100 mg/ml BSA and 2 mM MgCl ; 98°C (3 min), 30 cycles of [94°C (30 s), 60°C (30 s), and 72°C (45 s)], 72°C (5 min). <t>PrimeSTAR</t> HS DNA polymerase (PS) conditions: PrimeSTAR GC buffer with 2 M betaine; 98°C (3 min), 30 cycles of [98°C (15 s), 60°C (5 s), and 72°C (45 s)], 72°C (5 min). Pwo SuperYield DNA Polymerase ( Pwo ) conditions: Pwo PCR buffer with GC-rich solution and 2 M betaine; 98°C (3 min), 30 cycles of [98°C (1 min), 60°C (2 min), and 72°C (8 min)], 72°C (5 min). Lane 1 is marker (M) DNA (100 bp DNA ladder, Invitrogen) with 400 - and 500-bp bands indicated. ( B ) Anion exchange chromatography of 98-bp DNA-like polymers (pJ1923). Following equilibration in 20 mM Tris–HCl, pH 8 (buffer A), samples were eluted over 25 min at a 1 ml/min flow rate in a linear gradient from 50 to 100% buffer B (buffer A plus 1 M NaCl). Eluent absorbance at 260 nm (milli-absorbance units) was monitored with elution time (min).
    Hot Start Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 96 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hot start dna polymerase/product/TaKaRa
    Average 90 stars, based on 96 article reviews
    Price from $9.99 to $1999.99
    hot start dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    TaKaRa primestar gxl dna polymerase
    RT-PCR results for the expression of CIC-DUX4 in the tumor. A) The initial PCR with Premix Taq and the primer set CIC-4105F/DUX4-1538R (lane 1) as well as the nested PCR with the primers CIC-4283F/DUX4-1507R (lane 2) did not amplify any cDNA fragments. The primer set CIC-4238F/CIC-4958R (lane 3) amplified a CIC cDNA fragment suggesting the good quality of the synthesized cDNA. Lane 4, Blank, no RNA in cDNA synthesis. B) PCR amplifications using the <t>PrimeSTAR</t> <t>GXL</t> <t>DNA</t> polymerase and the primer combinations CIC-4377F/DUX4-1151R (lane 5) and CIC-4453F/DUX4-1053R (lane 6). Lane 7, Blank, no RNA in cDNA synthesis. M, 1 Kb DNA ladder (GeneRuler, Fermentas). C) Partial sequence chromatogram of the amplified cDNA fragment showing that CIC is fused to DUX4.
    Primestar Gxl Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 3344 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primestar gxl dna polymerase/product/TaKaRa
    Average 90 stars, based on 3344 article reviews
    Price from $9.99 to $1999.99
    primestar gxl dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    TaKaRa primestar max dna polymerase
    Subcellular localization of C-terminally GFP-tagged H2AX during the pre-zygotic stages. Wild-type strain (left) and the tagged strain (right) were mated. Approximately 1 kb of the ORFs (5′) and downstream UTRs (3′) of the H2AX (TTHERM_00790790) genomic loci were amplified from SB210 genomic <t>DNA</t> using <t>PrimeSTAR</t> Max DNA Polymerase (Takara) and the following primers: H2AX 5′ forward – AGTCGAGCTCTGAAGGTGATTCGTCATTGATTG, reverse – AGTCGGATTCAAGGTCTTGAGAAGCTTGACCTC; H2AX 3′ forward – AGTCCTCGAGTATAATGTGGCAAGTCTAAGTCTG, reverse – AGTCGGTACCACCTATGTAGCAACGAGTCATTTAT. The 5′ ORF sequence does not contain a stop codon. Amplified PCR products were purified and integrated into the backbone vector pEGFP-NEO4 as described in Materials and methods. The resulting vector (pH2AX-EGFP-NEO4) was linearized with SacI plus KpnI before biolistic transformation into Tetrahymena . Indirect immunofluorescence to visualize the tagged protein was carried out as described in Materials and methods. Scale bar denotes 10 μm. MAC-macronucleus; MIC-micronucleus. DOI: http://dx.doi.org/10.7554/eLife.26176.004
    Primestar Max Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 3109 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primestar max dna polymerase/product/TaKaRa
    Average 90 stars, based on 3109 article reviews
    Price from $9.99 to $1999.99
    primestar max dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    TaKaRa pyrobest dna polymerase
    The QuikChange TM method PCR with different high fidelity <t>DNA</t> polymerases. ( A ) Gel electrophoresis of the PCR products produced by different DNA polymerases; 3 μl of each product was analyzed. Lane 1, PCR product of PrimeStar; Lane 2, PCR product of TransTaq; Lane 3, PCR product of Phusion; Lane 4, PCR product of <t>Pyrobest;</t> Lane 5, PCR product of KOD FX polymerase; Lane 6, PCR product of PfuTurbo; Lane 7, PCR product of Q5 DNA polymerase. ( B ) Colonies were formed after transformation of the PCR products. Five microliters of the QuikChange TM PCR product was transformed into E. coli XL-1 Blue MRF’ cells; colonies were counted. Dark gray column, blue colonies; Light gray column, white colonies. The data are averages of three experiments with standard deviations (error bar). The lane numbers in ( A ) correspond to the column numbers in ( B ).
    Pyrobest Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1551 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pyrobest dna polymerase/product/TaKaRa
    Average 99 stars, based on 1551 article reviews
    Price from $9.99 to $1999.99
    pyrobest dna polymerase - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    TaKaRa mightyamp dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Mightyamp Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 302 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mightyamp dna polymerase/product/TaKaRa
    Average 99 stars, based on 302 article reviews
    Price from $9.99 to $1999.99
    mightyamp dna polymerase - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    79
    TaKaRa mightyamptm dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Mightyamptm Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 79/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mightyamptm dna polymerase/product/TaKaRa
    Average 79 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    mightyamptm dna polymerase - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    90
    TaKaRa amplitaq dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Amplitaq Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 74 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplitaq dna polymerase/product/TaKaRa
    Average 90 stars, based on 74 article reviews
    Price from $9.99 to $1999.99
    amplitaq dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    78
    TaKaRa utaq dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Utaq Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/utaq dna polymerase/product/TaKaRa
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    utaq dna polymerase - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    92
    TaKaRa epitaq dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Epitaq Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/epitaq dna polymerase/product/TaKaRa
    Average 92 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    epitaq dna polymerase - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    89
    TaKaRa tksgflex dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Tksgflex Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 89/100, based on 160 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tksgflex dna polymerase/product/TaKaRa
    Average 89 stars, based on 160 article reviews
    Price from $9.99 to $1999.99
    tksgflex dna polymerase - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    80
    TaKaRa hf2 dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Hf2 Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 80/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hf2 dna polymerase/product/TaKaRa
    Average 80 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    hf2 dna polymerase - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    77
    TaKaRa pylobest dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Pylobest Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 77/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pylobest dna polymerase/product/TaKaRa
    Average 77 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    pylobest dna polymerase - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    82
    TaKaRa primerstar dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Primerstar Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 82/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primerstar dna polymerase/product/TaKaRa
    Average 82 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    primerstar dna polymerase - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    93
    TaKaRa q5 dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Q5 Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 dna polymerase/product/TaKaRa
    Average 93 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    q5 dna polymerase - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    81
    TaKaRa hotstarttaq dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Hotstarttaq Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 81/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstarttaq dna polymerase/product/TaKaRa
    Average 81 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    hotstarttaq dna polymerase - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    90
    TaKaRa advantaq dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Advantaq Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/advantaq dna polymerase/product/TaKaRa
    Average 90 stars, based on 44 article reviews
    Price from $9.99 to $1999.99
    advantaq dna polymerase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    87
    TaKaRa klenow dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Klenow Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 87/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/klenow dna polymerase/product/TaKaRa
    Average 87 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    klenow dna polymerase - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    92
    TaKaRa hotstartaq dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Hotstartaq Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstartaq dna polymerase/product/TaKaRa
    Average 92 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    hotstartaq dna polymerase - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    89
    TaKaRa pyrobesttm dna polymerase
    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using <t>MightyAmp</t> <t>DNA</t> polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration
    Pyrobesttm Dna Polymerase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 89/100, based on 35 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pyrobesttm dna polymerase/product/TaKaRa
    Average 89 stars, based on 35 article reviews
    Price from $9.99 to $1999.99
    pyrobesttm dna polymerase - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    Image Search Results


    Detection and determination of Has2 gene mutation A 454 bp region within exon2 of rat Has2 that contains the Cas9 mutation site was PCR amplified from genomic DNA of each cell clone as a template. The amplified product was gel-purified and then digested with Pas1. The final products were analyzed by agarose gel electrophoresis. DNA standards (std) are labeled. Panel A. Products amplified from RCS-o WT cells and clones 1 thru 7. Panel B. Pas1 digestion products of the amplified 454 bp products shown in panel A. Panel C. Products amplified from RCS-Cas9 WT cells and clones 3, 7, 39, 43, 53, 80 and 88. Panel D. Pas1 digestion products of the amplified 454 bp products shown in panel C. Panel E. Alignment of the targeted rat Has2 genomic sequences from RCS-Cas9 clone #7, allele 1 and allele 2 with the WT RCS-Cas9 cells. Deleted bases are indicated.

    Journal: Matrix biology : journal of the International Society for Matrix Biology

    Article Title: CRISPR/Cas9 knockout of HAS2 in rat chondrosarcoma chondrocytes demonstrates the requirement of hyaluronan for aggrecan retention

    doi: 10.1016/j.matbio.2016.04.002

    Figure Lengend Snippet: Detection and determination of Has2 gene mutation A 454 bp region within exon2 of rat Has2 that contains the Cas9 mutation site was PCR amplified from genomic DNA of each cell clone as a template. The amplified product was gel-purified and then digested with Pas1. The final products were analyzed by agarose gel electrophoresis. DNA standards (std) are labeled. Panel A. Products amplified from RCS-o WT cells and clones 1 thru 7. Panel B. Pas1 digestion products of the amplified 454 bp products shown in panel A. Panel C. Products amplified from RCS-Cas9 WT cells and clones 3, 7, 39, 43, 53, 80 and 88. Panel D. Pas1 digestion products of the amplified 454 bp products shown in panel C. Panel E. Alignment of the targeted rat Has2 genomic sequences from RCS-Cas9 clone #7, allele 1 and allele 2 with the WT RCS-Cas9 cells. Deleted bases are indicated.

    Article Snippet: To identify the mutation in the RCS-Cas9 clone #7, the same PCR product was also amplified but with a different DNA polymerase, TaKaRa LA Taq® DNA polymerase (Clontech), and this PCR product cloned into the pCR4-TOPO vector (Invitrogen) according to the manufacturer's instructions.

    Techniques: Mutagenesis, Polymerase Chain Reaction, Amplification, Purification, Agarose Gel Electrophoresis, Labeling, Clone Assay, Genomic Sequencing

    (A) Genotype in each generation of mutant mice confirmed by PCR analysis on isolated genomic DNA. PCR was performed on the isolated genomic DNA using taq DNA polymerase and primer sets (#1 and #2 are for wild-type and GluR2 delta7 KI, #3 and #4 are for

    Journal: Neuroscience letters

    Article Title: Involvement of GluR2 and GluR3 subunit C-termini in the trigeminal spinal subnucleus caudalis and C1-C2 neurons in trigeminal neuropathic pain

    doi: 10.1016/j.neulet.2010.12.060

    Figure Lengend Snippet: (A) Genotype in each generation of mutant mice confirmed by PCR analysis on isolated genomic DNA. PCR was performed on the isolated genomic DNA using taq DNA polymerase and primer sets (#1 and #2 are for wild-type and GluR2 delta7 KI, #3 and #4 are for

    Article Snippet: PCR was performed on the isolated genomic DNA using taq DNA polymerase (TaKaRa Ex Taq™, Takara, Otsu, Japan) and primer sets (primer #21–23 for GluR2 delta7: #21, 5′-ACA GAG GAA GGT AGT GGA AGG GAG-3′; #22, 5′-CTT GGT TTG GTT GTT GGT CAT AGC-3′; #23, 5′-CTA GTG AAC CTC TTC GAG GGA C-3′; primer #31–33 for GluR3 delta7: #31, 5′-CCA ATA CTC CAC AGG GGC AAT TTA TC-3′; #32, 5′-CCG TTG ACT GTT TTG AAT CTC ACA CC-3′; #33, 5′-CTA GTG AAC CTC TTC GAG GGA C-3′).

    Techniques: Mutagenesis, Mouse Assay, Polymerase Chain Reaction, Isolation

    PCR of subdivided genomic sequences. Three regions of human genomic DNA (GenBank accession nos AC006454 , AC093734 and X91835 , with 5103, 5193 and 12 114 bp, respectively) were subdivided into nine 567, 577 and 1346 bp PCR sites, respectively. PCR was performed for each subdivided site using primer sets (20 bp each) corresponding to the terminal sequence of each site using the Taq DNA polymerase ( ExTaq DNA polymerase plus ‘hot start’ antibody; Takara-bio). PCR was carried out in the absence and in the presence of Tth RecA protein and ATP. The products were electrophoresed and stained with ethidium bromide. ( a ) A diagrammatic representation of the subdivided region (5103 bp in GenBank accession no AC006454 ) (upper panel) and the electrophoretic patterns of the PCR products (lower panel). ( b ) A diagrammatic representation of the subdivided region (5193 bp in GenBank accession no AC093734 ) (upper panel) and the electrophoretic patterns of the PCR products (lower panel). ( c ) A diagrammatic representation of the subdivided region (12 114 bp in GenBank accession no X91835 ) (upper panel) and the electrophoretic patterns of the PCR products (lower panel). Throughout (a–c), nine subdivided sites for each region are indicated as a-1 to a-9, b-1 to b-9 and c-1 to c-9. Nucleotide (nt) numbers correspond to registries in GenBank. Locations of the specific PCR products are indicated by arrows.

    Journal: Nucleic Acids Research

    Article Title: Multiplex PCR: use of heat-stable Thermus thermophilus RecA protein to minimize non-specific PCR products

    doi: 10.1093/nar/gni111

    Figure Lengend Snippet: PCR of subdivided genomic sequences. Three regions of human genomic DNA (GenBank accession nos AC006454 , AC093734 and X91835 , with 5103, 5193 and 12 114 bp, respectively) were subdivided into nine 567, 577 and 1346 bp PCR sites, respectively. PCR was performed for each subdivided site using primer sets (20 bp each) corresponding to the terminal sequence of each site using the Taq DNA polymerase ( ExTaq DNA polymerase plus ‘hot start’ antibody; Takara-bio). PCR was carried out in the absence and in the presence of Tth RecA protein and ATP. The products were electrophoresed and stained with ethidium bromide. ( a ) A diagrammatic representation of the subdivided region (5103 bp in GenBank accession no AC006454 ) (upper panel) and the electrophoretic patterns of the PCR products (lower panel). ( b ) A diagrammatic representation of the subdivided region (5193 bp in GenBank accession no AC093734 ) (upper panel) and the electrophoretic patterns of the PCR products (lower panel). ( c ) A diagrammatic representation of the subdivided region (12 114 bp in GenBank accession no X91835 ) (upper panel) and the electrophoretic patterns of the PCR products (lower panel). Throughout (a–c), nine subdivided sites for each region are indicated as a-1 to a-9, b-1 to b-9 and c-1 to c-9. Nucleotide (nt) numbers correspond to registries in GenBank. Locations of the specific PCR products are indicated by arrows.

    Article Snippet: The same results were obtained by the other polymerase systems: LA Taq polymerase (Takara-bio), Tth polymerase (Applied-boisystems); Expand High Fidelity, Expand High FidelityPLUS and Expand Long Template polymerase (Roche-diagnostics); TITANIUM Taq polymerase (Becton-Dickinson-Clontech); and Taq polymerase (Promega).

    Techniques: Polymerase Chain Reaction, Genomic Sequencing, Sequencing, Staining

    PCR with primers carrying mismatched bases. PCR was performed at two human genomic sites with primers (20 bp), one of which (forward primer) carried one, two or three mismatched bases in the middle of the primer, in the absence (left) or presence (right) of Tth RecA protein and ATP using the Taq DNA polymerase ( rTaq DNA polymerase plus ‘hot start’ antibody). ( a ) Upper panel: a diagrammatic representation of the location of the PCR site (20 bp between nt 66 562 and nt 66 581 in GenBank accession no AC006454 ) and of the primers. Lower panel: lanes 1 and 5, PCR products using primers without mismatched bases (primer set a-1); lanes 2 and 6, PCR products using primers (primer set a-2 with one mismatched base at nt 66 566, T to C); lanes 3 and 7, PCR products using primers (primer set a-3 with two mismatched base at nt 66 566 and nt 66 571, both T to C); and lanes 4 and 8, PCR products using primers (primer set a-4 with three mismatched base at nt 66 566 and nt 66 571, T to C and nt 66 576, G to C). The oligonucleotide sequences used for the forward primers (mismatched bases are underlined) are as follows: primer set a-1, 5′-CATGGCACCTGCTCTGAGAC-3′; primer set a-2, 5′-CATGGCACC C GCTCTGAGAC-3′; primer set a-3, 5′-CATGGCACC C GCTC C GAGAC-3′; and primer set a-4, 5′-CATG C CACC C GCTC C GAGAC-3′. ( b ) Upper panel: a diagrammatic representation of the location of the PCR site (20 bp between nt 38 501 and nt 38 520 in GenBank accession no. AC0937734 ) and of the primers. Lower panel: lanes 1 and 5, PCR products using primers without mismatched bases (primer set b-1); lanes 2 and 6, PCR products using primers (primer set b-2 with one mismatched base at nt 38 505, G to A); lanes 3 and 7, PCR products using primers (primer set b-3 with two mismatched base at nt 38 505 and nt 38 510, both G to A); and lanes 4 and 8, PCR products using primers (primer set b-4 with three mismatched base at nt 38 505, nt 38 510 and nt 38 515, all G to A). The oligonucleotide sequences used for the forward primers are as follows: primer set b-1, 5′-ATCTGTGTGGTTCGGCTCTG-3′; primer set b-2, 5′-ATCTGTGTG A TTCGGCTCTG-3′; primer set b-3, 5′-ATCTGTGTG A TTCG A CTCTG-3′; and primer set b-4, 5′-ATCT A TGTG A TTCG A CTCTG-3′. ( c ) Upper panel: a diagrammatic representation of the location of the PCR site (20 bp between nt 63 957 and nt 63 976 in GenBank accession no. AC004975 ) and of the primers. Lower panel: lanes 1 and 5, PCR products using primers without mismatched bases (primer set c-1); lanes 2 and 6, PCR products using primers (primer set c-2 with one mismatched base at nt 63 961, A to T); lanes 3 and 7, PCR products using primers (primer set c-3 with two mismatched base at nt 63 961 and nt 63 966, A to T and C to T); and lanes 4 and 8, PCR products using primers (primer set c-4 with three mismatched base at nt 63 961, nt 63 966 and nt 63 971, A to T, C to T and G to T). The oligonucleotide sequences used for the forward primers are as follows: primer set c-1, 5′-GCAGGCACCAAGAACTACTG-3′; primer set c-2, 5′-GCAGGCACC T AGAACTACTG-3′; primer set c-3, 5′-GCAGGCACC T AGAA T TACTG-3′; and primer set c-4, 5′-GCAG T CACC T AGAA T TACTG-3′. The sequences for the backward primers are 5′-TCACCTCCCAGCCTGGCCCA-3′ for ( a ), 5′-AGGGAGATGTTCTCATAAAT-3′ and 5′-CTGTAAGTGGCAGACATTAC-3′ for ( b ). Nucleotide numbers correspond to registries in GenBank. Locations of the specific PCR products are indicated by arrows.

    Journal: Nucleic Acids Research

    Article Title: Multiplex PCR: use of heat-stable Thermus thermophilus RecA protein to minimize non-specific PCR products

    doi: 10.1093/nar/gni111

    Figure Lengend Snippet: PCR with primers carrying mismatched bases. PCR was performed at two human genomic sites with primers (20 bp), one of which (forward primer) carried one, two or three mismatched bases in the middle of the primer, in the absence (left) or presence (right) of Tth RecA protein and ATP using the Taq DNA polymerase ( rTaq DNA polymerase plus ‘hot start’ antibody). ( a ) Upper panel: a diagrammatic representation of the location of the PCR site (20 bp between nt 66 562 and nt 66 581 in GenBank accession no AC006454 ) and of the primers. Lower panel: lanes 1 and 5, PCR products using primers without mismatched bases (primer set a-1); lanes 2 and 6, PCR products using primers (primer set a-2 with one mismatched base at nt 66 566, T to C); lanes 3 and 7, PCR products using primers (primer set a-3 with two mismatched base at nt 66 566 and nt 66 571, both T to C); and lanes 4 and 8, PCR products using primers (primer set a-4 with three mismatched base at nt 66 566 and nt 66 571, T to C and nt 66 576, G to C). The oligonucleotide sequences used for the forward primers (mismatched bases are underlined) are as follows: primer set a-1, 5′-CATGGCACCTGCTCTGAGAC-3′; primer set a-2, 5′-CATGGCACC C GCTCTGAGAC-3′; primer set a-3, 5′-CATGGCACC C GCTC C GAGAC-3′; and primer set a-4, 5′-CATG C CACC C GCTC C GAGAC-3′. ( b ) Upper panel: a diagrammatic representation of the location of the PCR site (20 bp between nt 38 501 and nt 38 520 in GenBank accession no. AC0937734 ) and of the primers. Lower panel: lanes 1 and 5, PCR products using primers without mismatched bases (primer set b-1); lanes 2 and 6, PCR products using primers (primer set b-2 with one mismatched base at nt 38 505, G to A); lanes 3 and 7, PCR products using primers (primer set b-3 with two mismatched base at nt 38 505 and nt 38 510, both G to A); and lanes 4 and 8, PCR products using primers (primer set b-4 with three mismatched base at nt 38 505, nt 38 510 and nt 38 515, all G to A). The oligonucleotide sequences used for the forward primers are as follows: primer set b-1, 5′-ATCTGTGTGGTTCGGCTCTG-3′; primer set b-2, 5′-ATCTGTGTG A TTCGGCTCTG-3′; primer set b-3, 5′-ATCTGTGTG A TTCG A CTCTG-3′; and primer set b-4, 5′-ATCT A TGTG A TTCG A CTCTG-3′. ( c ) Upper panel: a diagrammatic representation of the location of the PCR site (20 bp between nt 63 957 and nt 63 976 in GenBank accession no. AC004975 ) and of the primers. Lower panel: lanes 1 and 5, PCR products using primers without mismatched bases (primer set c-1); lanes 2 and 6, PCR products using primers (primer set c-2 with one mismatched base at nt 63 961, A to T); lanes 3 and 7, PCR products using primers (primer set c-3 with two mismatched base at nt 63 961 and nt 63 966, A to T and C to T); and lanes 4 and 8, PCR products using primers (primer set c-4 with three mismatched base at nt 63 961, nt 63 966 and nt 63 971, A to T, C to T and G to T). The oligonucleotide sequences used for the forward primers are as follows: primer set c-1, 5′-GCAGGCACCAAGAACTACTG-3′; primer set c-2, 5′-GCAGGCACC T AGAACTACTG-3′; primer set c-3, 5′-GCAGGCACC T AGAA T TACTG-3′; and primer set c-4, 5′-GCAG T CACC T AGAA T TACTG-3′. The sequences for the backward primers are 5′-TCACCTCCCAGCCTGGCCCA-3′ for ( a ), 5′-AGGGAGATGTTCTCATAAAT-3′ and 5′-CTGTAAGTGGCAGACATTAC-3′ for ( b ). Nucleotide numbers correspond to registries in GenBank. Locations of the specific PCR products are indicated by arrows.

    Article Snippet: The same results were obtained by the other polymerase systems: LA Taq polymerase (Takara-bio), Tth polymerase (Applied-boisystems); Expand High Fidelity, Expand High FidelityPLUS and Expand Long Template polymerase (Roche-diagnostics); TITANIUM Taq polymerase (Becton-Dickinson-Clontech); and Taq polymerase (Promega).

    Techniques: Polymerase Chain Reaction

    Effect of T.thermophilus RecA protein on PCR. PCR with Taq DNA polymerase ( ExTaq DNA polymerase plus ‘hot start’ antibody; Takara-bio) for several randomly selected sequences (300–650 bp) in human genomic DNA was carried out in the absence or in the presence of the Tth RecA protein. ( a ) Control, PCR under the standard conditions described in Materials and Methods. ( b ) Similar to (a), but with Tth RecA protein (0.4 μg per 25 μl reaction mixture). ( c ) Similar to (a), but with ATP (400 μM). ( d ) Similar to (a), but with Tth RecA protein (0.4 μg per 25 μl reaction mixture) and ATP (300 μM). ( e ) Similar to (a), but with Tth RecA protein (0.4 μg per 25 μl reaction mixture) and ATP-γS (300 μM). The products were electrophoresed and stained with ethidium bromide. Molecular weight markers are indicated on the right-hand side of these panels. The oligonucleotide sequences used for the primers were as follows: 5′-ACAATGGGCTCACTCACCCA-3′ and 5′-CTAAGACCAATGGATAGCTG-3′ for lane 1 (300 bp); 5′-GCTCAGCATGGTGGTGGCAT-3′ and 5′-CCTCATACCTTCCCCCCCAT-3′ for lane 2 (319 bp); 5′-GACTACTCTAGCGACTGTCC-3′ and 5′-GACAGCCACCAGATCCAATC-3′ for lane 3 (360 bp); 5′-AACCTCACAACCTTGGCTGA-3′ and 5′-TTCACAACTTAAGATTTGGC-3′ for lane 4 (400 bp); 5′-AGGCAACTAGGATGGTGTGG-3′ and 5′-CAGGGAGCGTGTCCATAGGG-3′ for lane 5 (450 bp); 5′-CTGCTGAAAGAGATGCGGTG-3′ and 5′-AGGAAAACAGCCCAAGGGAC-3′ for lane 6 (469 bp); and 5′-ACTTTGTTCTGAGCCTCACA-3′ and 5′-GTTGCCCAATCGCCCCTCTC-3′ for lane 7 (650 bp).

    Journal: Nucleic Acids Research

    Article Title: Multiplex PCR: use of heat-stable Thermus thermophilus RecA protein to minimize non-specific PCR products

    doi: 10.1093/nar/gni111

    Figure Lengend Snippet: Effect of T.thermophilus RecA protein on PCR. PCR with Taq DNA polymerase ( ExTaq DNA polymerase plus ‘hot start’ antibody; Takara-bio) for several randomly selected sequences (300–650 bp) in human genomic DNA was carried out in the absence or in the presence of the Tth RecA protein. ( a ) Control, PCR under the standard conditions described in Materials and Methods. ( b ) Similar to (a), but with Tth RecA protein (0.4 μg per 25 μl reaction mixture). ( c ) Similar to (a), but with ATP (400 μM). ( d ) Similar to (a), but with Tth RecA protein (0.4 μg per 25 μl reaction mixture) and ATP (300 μM). ( e ) Similar to (a), but with Tth RecA protein (0.4 μg per 25 μl reaction mixture) and ATP-γS (300 μM). The products were electrophoresed and stained with ethidium bromide. Molecular weight markers are indicated on the right-hand side of these panels. The oligonucleotide sequences used for the primers were as follows: 5′-ACAATGGGCTCACTCACCCA-3′ and 5′-CTAAGACCAATGGATAGCTG-3′ for lane 1 (300 bp); 5′-GCTCAGCATGGTGGTGGCAT-3′ and 5′-CCTCATACCTTCCCCCCCAT-3′ for lane 2 (319 bp); 5′-GACTACTCTAGCGACTGTCC-3′ and 5′-GACAGCCACCAGATCCAATC-3′ for lane 3 (360 bp); 5′-AACCTCACAACCTTGGCTGA-3′ and 5′-TTCACAACTTAAGATTTGGC-3′ for lane 4 (400 bp); 5′-AGGCAACTAGGATGGTGTGG-3′ and 5′-CAGGGAGCGTGTCCATAGGG-3′ for lane 5 (450 bp); 5′-CTGCTGAAAGAGATGCGGTG-3′ and 5′-AGGAAAACAGCCCAAGGGAC-3′ for lane 6 (469 bp); and 5′-ACTTTGTTCTGAGCCTCACA-3′ and 5′-GTTGCCCAATCGCCCCTCTC-3′ for lane 7 (650 bp).

    Article Snippet: The same results were obtained by the other polymerase systems: LA Taq polymerase (Takara-bio), Tth polymerase (Applied-boisystems); Expand High Fidelity, Expand High FidelityPLUS and Expand Long Template polymerase (Roche-diagnostics); TITANIUM Taq polymerase (Becton-Dickinson-Clontech); and Taq polymerase (Promega).

    Techniques: Polymerase Chain Reaction, Staining, Molecular Weight

    The PCR product of a foreign gene was amplified by T4 DNA polymerase and dGTP, and then was ligated with the Bsu36I-digested pRTRA. The ligation mixture was transformed to the donor strain DH10β, and then the recombinant donor plasmid was obtained. We introduced the two different Bsu36I sites (CCTTAGG and CCTGAGG) in the pRTRA vector and the 4 nt TTAC(5′–3′) in the forward primer and the other 4 nt TGAC(5′–3′) in the reverse primer. The complete digestion of pRTRA with Bsu36I results in a linearized donor vector with overhang ends of 5′-TTA-3′ and 5′-TCA-3′, respectively. We made use of the 3′→5′ exonuclease activity and 5′→3′ polymerase activity of T4 DNA polymerase. When T4 DNA polymerase encounters the first Guanine nucleotide at the 5′ end of the DNA in the dGTP bath, the reaction will keep the balance between the exonuclease activity and polymerase activity. Therefore, the overhang ends of the gene fragments of interest will be digested to be perfectly compatible with the vector.

    Journal: Nucleic Acids Research

    Article Title: A novel and simple method for construction of recombinant adenoviruses

    doi: 10.1093/nar/gkl449

    Figure Lengend Snippet: The PCR product of a foreign gene was amplified by T4 DNA polymerase and dGTP, and then was ligated with the Bsu36I-digested pRTRA. The ligation mixture was transformed to the donor strain DH10β, and then the recombinant donor plasmid was obtained. We introduced the two different Bsu36I sites (CCTTAGG and CCTGAGG) in the pRTRA vector and the 4 nt TTAC(5′–3′) in the forward primer and the other 4 nt TGAC(5′–3′) in the reverse primer. The complete digestion of pRTRA with Bsu36I results in a linearized donor vector with overhang ends of 5′-TTA-3′ and 5′-TCA-3′, respectively. We made use of the 3′→5′ exonuclease activity and 5′→3′ polymerase activity of T4 DNA polymerase. When T4 DNA polymerase encounters the first Guanine nucleotide at the 5′ end of the DNA in the dGTP bath, the reaction will keep the balance between the exonuclease activity and polymerase activity. Therefore, the overhang ends of the gene fragments of interest will be digested to be perfectly compatible with the vector.

    Article Snippet: Cloning the foreign genes gfp and man into the donor plasmid using restriction enzyme Bsu36I and T4 DNA polymerase The gfp gene was amplified from pEGFP-1 (Clontech) by PCR.

    Techniques: Polymerase Chain Reaction, Amplification, Ligation, Transformation Assay, Recombinant, Plasmid Preparation, Activity Assay

    PCR-RFLP fragments of the 23S rRNA gene in 3% agarose gel electrophoresis digestion with Taq I. Lane M: 100 bp DNA ladder; lane 1: B. hyodysenteriae B204; lane 2: B. hyodysenteriae B234; lane 3: B. hyodysenteriae B169; lane 4: B. pilosicoli P43/6/78; lane 5 to 14: B. hyodysenteriae field isolates; lane 15: B. murdochii 56-150; lane 16: B. intermedia PWS/A; lane 17: B. innocens B256.

    Journal: Journal of Veterinary Science

    Article Title: The 23S rRNA gene PCR-RFLP used for characterization of porcine intestinal spirochete isolates

    doi: 10.4142/jvs.2006.7.3.277

    Figure Lengend Snippet: PCR-RFLP fragments of the 23S rRNA gene in 3% agarose gel electrophoresis digestion with Taq I. Lane M: 100 bp DNA ladder; lane 1: B. hyodysenteriae B204; lane 2: B. hyodysenteriae B234; lane 3: B. hyodysenteriae B169; lane 4: B. pilosicoli P43/6/78; lane 5 to 14: B. hyodysenteriae field isolates; lane 15: B. murdochii 56-150; lane 16: B. intermedia PWS/A; lane 17: B. innocens B256.

    Article Snippet: The PCR conditions consisted of 5 µl (50 ng/µl) of DNA and 1 µl each of primer (50 pM) in a 5 µl of 10× reaction buffer with 5 µl of 25 mM MgCl2 , 5 µl of 10 mM dNTP (each 2.5 mM) and 1 µl of 5 U Ex Taq DNA polymerase (TaKaRa, Japan) to a final volume of 50 µl on a thermal cycler (PTC-100; MJ Research, USA).

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Characterization of DNA analogs. ( A ) PCR assays analyzed by 5% native polyacrylamide gel electrophoresis. Total PCR volume 100 µl: 20 ng 418-bp DNA template (pJ1506), 0.4 mM each LJM-3222 (5'-G TA CGC AG T ) and LJM-3223 (5'-TGTGAGT AGCTCACTCAT AG ), 0.2 mM each dNTP with indicated analog triphosphate ( 1–9 ) completely replacing appropriate dNTP, and 5 U DNA polymerase (indicated with plus symbol) with associated buffer and cycle conditions. Taq DNA polymerase ( Taq ) conditions: Taq DNA polymerase buffer with 100 mg/ml BSA and 2 mM MgCl ; 98°C (3 min), 30 cycles of [94°C (30 s), 60°C (30 s), and 72°C (45 s)], 72°C (5 min). PrimeSTAR HS DNA polymerase (PS) conditions: PrimeSTAR GC buffer with 2 M betaine; 98°C (3 min), 30 cycles of [98°C (15 s), 60°C (5 s), and 72°C (45 s)], 72°C (5 min). Pwo SuperYield DNA Polymerase ( Pwo ) conditions: Pwo PCR buffer with GC-rich solution and 2 M betaine; 98°C (3 min), 30 cycles of [98°C (1 min), 60°C (2 min), and 72°C (8 min)], 72°C (5 min). Lane 1 is marker (M) DNA (100 bp DNA ladder, Invitrogen) with 400 - and 500-bp bands indicated. ( B ) Anion exchange chromatography of 98-bp DNA-like polymers (pJ1923). Following equilibration in 20 mM Tris–HCl, pH 8 (buffer A), samples were eluted over 25 min at a 1 ml/min flow rate in a linear gradient from 50 to 100% buffer B (buffer A plus 1 M NaCl). Eluent absorbance at 260 nm (milli-absorbance units) was monitored with elution time (min).

    Journal: Nucleic Acids Research

    Article Title: Mechanical properties of DNA-like polymers

    doi: 10.1093/nar/gkt808

    Figure Lengend Snippet: Characterization of DNA analogs. ( A ) PCR assays analyzed by 5% native polyacrylamide gel electrophoresis. Total PCR volume 100 µl: 20 ng 418-bp DNA template (pJ1506), 0.4 mM each LJM-3222 (5'-G TA CGC AG T ) and LJM-3223 (5'-TGTGAGT AGCTCACTCAT AG ), 0.2 mM each dNTP with indicated analog triphosphate ( 1–9 ) completely replacing appropriate dNTP, and 5 U DNA polymerase (indicated with plus symbol) with associated buffer and cycle conditions. Taq DNA polymerase ( Taq ) conditions: Taq DNA polymerase buffer with 100 mg/ml BSA and 2 mM MgCl ; 98°C (3 min), 30 cycles of [94°C (30 s), 60°C (30 s), and 72°C (45 s)], 72°C (5 min). PrimeSTAR HS DNA polymerase (PS) conditions: PrimeSTAR GC buffer with 2 M betaine; 98°C (3 min), 30 cycles of [98°C (15 s), 60°C (5 s), and 72°C (45 s)], 72°C (5 min). Pwo SuperYield DNA Polymerase ( Pwo ) conditions: Pwo PCR buffer with GC-rich solution and 2 M betaine; 98°C (3 min), 30 cycles of [98°C (1 min), 60°C (2 min), and 72°C (8 min)], 72°C (5 min). Lane 1 is marker (M) DNA (100 bp DNA ladder, Invitrogen) with 400 - and 500-bp bands indicated. ( B ) Anion exchange chromatography of 98-bp DNA-like polymers (pJ1923). Following equilibration in 20 mM Tris–HCl, pH 8 (buffer A), samples were eluted over 25 min at a 1 ml/min flow rate in a linear gradient from 50 to 100% buffer B (buffer A plus 1 M NaCl). Eluent absorbance at 260 nm (milli-absorbance units) was monitored with elution time (min).

    Article Snippet: For analogs 3 , 4 , 5 , 6 and 9 , PCR reactions (100 µl) included 20 ng template, 0.4 mM forward and reverse primers, PrimeSTAR GC buffer (Takara), 0.2 mM each dNTP (again with dTTP completely replaced with analog, except for variant 9 , which completely replaced dATP), 2 M betaine (Sigma-Aldrich) and 5 U PrimeSTAR HS DNA polymerase (Takara).

    Techniques: Polymerase Chain Reaction, Polyacrylamide Gel Electrophoresis, Marker, Chromatography, Flow Cytometry

    RT-PCR results for the expression of CIC-DUX4 in the tumor. A) The initial PCR with Premix Taq and the primer set CIC-4105F/DUX4-1538R (lane 1) as well as the nested PCR with the primers CIC-4283F/DUX4-1507R (lane 2) did not amplify any cDNA fragments. The primer set CIC-4238F/CIC-4958R (lane 3) amplified a CIC cDNA fragment suggesting the good quality of the synthesized cDNA. Lane 4, Blank, no RNA in cDNA synthesis. B) PCR amplifications using the PrimeSTAR GXL DNA polymerase and the primer combinations CIC-4377F/DUX4-1151R (lane 5) and CIC-4453F/DUX4-1053R (lane 6). Lane 7, Blank, no RNA in cDNA synthesis. M, 1 Kb DNA ladder (GeneRuler, Fermentas). C) Partial sequence chromatogram of the amplified cDNA fragment showing that CIC is fused to DUX4.

    Journal: PLoS ONE

    Article Title: The "Grep" Command But Not FusionMap, FusionFinder or ChimeraScan Captures the CIC-DUX4 Fusion Gene from Whole Transcriptome Sequencing Data on a Small Round Cell Tumor with t(4;19)(q35;q13)

    doi: 10.1371/journal.pone.0099439

    Figure Lengend Snippet: RT-PCR results for the expression of CIC-DUX4 in the tumor. A) The initial PCR with Premix Taq and the primer set CIC-4105F/DUX4-1538R (lane 1) as well as the nested PCR with the primers CIC-4283F/DUX4-1507R (lane 2) did not amplify any cDNA fragments. The primer set CIC-4238F/CIC-4958R (lane 3) amplified a CIC cDNA fragment suggesting the good quality of the synthesized cDNA. Lane 4, Blank, no RNA in cDNA synthesis. B) PCR amplifications using the PrimeSTAR GXL DNA polymerase and the primer combinations CIC-4377F/DUX4-1151R (lane 5) and CIC-4453F/DUX4-1053R (lane 6). Lane 7, Blank, no RNA in cDNA synthesis. M, 1 Kb DNA ladder (GeneRuler, Fermentas). C) Partial sequence chromatogram of the amplified cDNA fragment showing that CIC is fused to DUX4.

    Article Snippet: In subsequent PCR amplifications, PrimeSTAR GXL DNA polymerase was used (Takara Bio).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Polymerase Chain Reaction, Nested PCR, Amplification, Synthesized, Sequencing

    Subcellular localization of C-terminally GFP-tagged H2AX during the pre-zygotic stages. Wild-type strain (left) and the tagged strain (right) were mated. Approximately 1 kb of the ORFs (5′) and downstream UTRs (3′) of the H2AX (TTHERM_00790790) genomic loci were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (Takara) and the following primers: H2AX 5′ forward – AGTCGAGCTCTGAAGGTGATTCGTCATTGATTG, reverse – AGTCGGATTCAAGGTCTTGAGAAGCTTGACCTC; H2AX 3′ forward – AGTCCTCGAGTATAATGTGGCAAGTCTAAGTCTG, reverse – AGTCGGTACCACCTATGTAGCAACGAGTCATTTAT. The 5′ ORF sequence does not contain a stop codon. Amplified PCR products were purified and integrated into the backbone vector pEGFP-NEO4 as described in Materials and methods. The resulting vector (pH2AX-EGFP-NEO4) was linearized with SacI plus KpnI before biolistic transformation into Tetrahymena . Indirect immunofluorescence to visualize the tagged protein was carried out as described in Materials and methods. Scale bar denotes 10 μm. MAC-macronucleus; MIC-micronucleus. DOI: http://dx.doi.org/10.7554/eLife.26176.004

    Journal: eLife

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11

    doi: 10.7554/eLife.26176

    Figure Lengend Snippet: Subcellular localization of C-terminally GFP-tagged H2AX during the pre-zygotic stages. Wild-type strain (left) and the tagged strain (right) were mated. Approximately 1 kb of the ORFs (5′) and downstream UTRs (3′) of the H2AX (TTHERM_00790790) genomic loci were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (Takara) and the following primers: H2AX 5′ forward – AGTCGAGCTCTGAAGGTGATTCGTCATTGATTG, reverse – AGTCGGATTCAAGGTCTTGAGAAGCTTGACCTC; H2AX 3′ forward – AGTCCTCGAGTATAATGTGGCAAGTCTAAGTCTG, reverse – AGTCGGTACCACCTATGTAGCAACGAGTCATTTAT. The 5′ ORF sequence does not contain a stop codon. Amplified PCR products were purified and integrated into the backbone vector pEGFP-NEO4 as described in Materials and methods. The resulting vector (pH2AX-EGFP-NEO4) was linearized with SacI plus KpnI before biolistic transformation into Tetrahymena . Indirect immunofluorescence to visualize the tagged protein was carried out as described in Materials and methods. Scale bar denotes 10 μm. MAC-macronucleus; MIC-micronucleus. DOI: http://dx.doi.org/10.7554/eLife.26176.004

    Article Snippet: Construction of C-terminal epitope-tagged vectors Approximately 1 kb of the ORFs (5′) and downstream UTRs (3′) of the TOP2s , TOP2g , and SPO11 genomic loci were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (Takara, Kusatsu, Japan) and the following primers: TOP2s 5′ forward – AGTCGAGCTCACGCTAAGGAGCAGACCTCG, reverse – AGTCGGATCCGAAATAGCATTCATCCGATGATTC; TOP2s 3′ forward – AGTCCTCGAGCATGCATTCATTCAATCAATCAATC, reverse – AGTCGGTACCGGTCTTGGCAATTAACTCTCTCAC; TOP2g 5′ forward – AGTCGAGCTCCAGGTAAAGGGTTTACATAGAATG, reverse – AGTCGGATCCATCATCCTCATCCTCATCAAATAA; TOP2g 3′ forward – AGTCCTCGAGACAGTGATGTCAGAATGTTAAATC, reverse – AGTCGGTACCCTTAAAGGCAGAAAATTAAGAGGT; SPO11 5′ forward – AGTCGAGCTCGATTACTGGGAAAGGGTA, reverse – AGTCGGATCCTAAATATTTGTTTGATTAGATTTTA; and SPO11 3′ forward – AGTCCTCGAGTAATTTCTTATTTTTCTTTTTTGCT, reverse – AGTCGGTACCAATTTCTTCCATACAAAAAGCATCA).

    Techniques: Amplification, Sequencing, Polymerase Chain Reaction, Purification, Plasmid Preparation, Transformation Assay, Immunofluorescence

    Possible involvement of NHEJ in PM-DSB repair. ( A ) Construct for the ectopic expression of GFP-tagged DNA-PKcs (TTHERM_00203010). GFP under the cadmium-inducible MTT1 promoter was introduced into DNA-PKcs in the MAC. Approximately 1 kb of the DNA-PKcs 5′ UTR and ORF were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (TaKaRa) and the following primers: DNA-PKcs 5′ forward – AGTCGAGCTCACTTTAGCATTGGCTAATGCATG, reverse – AGTCGTCGACTTTTTAACGAATTCAAAAAAATAATAATAAGC; and DNA-PKcs 3′ forward – AGTCGGATCCATGTTAGAGCATTTACTTGAAAGCGC, reverse – AGTCGGTACCTGAGAATAAGCTGTCAACAC. Amplified forward and reverse target fragments were cloned into the SacI–SalI and BamHI–KpnI sites, respectively, of the backbone plasmid pBNMB1-EGFP (a gift from Dr Kazufumi Mochizuki, CNRS Institute of Human Genetics, Montpellier, France). The resulting vector (pEGFP-DNA-PKcs-NEO5) was linearized with Sac I plus Kpn I before biolistic transformation into Tetrahymena . ( B ) Localization of GFP-DNA-PKcs at the post-meiotic stage. Wild-type cells (left) were mated with tagged cells (right). Prior to pronuclear selection, DNA-PKcs localizes only to the MAC. Upon pronuclear selection, it appears in the selected pronucleus (red arrowhead). Scale bar denotes 10 μm. DOI: http://dx.doi.org/10.7554/eLife.26176.006

    Journal: eLife

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11

    doi: 10.7554/eLife.26176

    Figure Lengend Snippet: Possible involvement of NHEJ in PM-DSB repair. ( A ) Construct for the ectopic expression of GFP-tagged DNA-PKcs (TTHERM_00203010). GFP under the cadmium-inducible MTT1 promoter was introduced into DNA-PKcs in the MAC. Approximately 1 kb of the DNA-PKcs 5′ UTR and ORF were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (TaKaRa) and the following primers: DNA-PKcs 5′ forward – AGTCGAGCTCACTTTAGCATTGGCTAATGCATG, reverse – AGTCGTCGACTTTTTAACGAATTCAAAAAAATAATAATAAGC; and DNA-PKcs 3′ forward – AGTCGGATCCATGTTAGAGCATTTACTTGAAAGCGC, reverse – AGTCGGTACCTGAGAATAAGCTGTCAACAC. Amplified forward and reverse target fragments were cloned into the SacI–SalI and BamHI–KpnI sites, respectively, of the backbone plasmid pBNMB1-EGFP (a gift from Dr Kazufumi Mochizuki, CNRS Institute of Human Genetics, Montpellier, France). The resulting vector (pEGFP-DNA-PKcs-NEO5) was linearized with Sac I plus Kpn I before biolistic transformation into Tetrahymena . ( B ) Localization of GFP-DNA-PKcs at the post-meiotic stage. Wild-type cells (left) were mated with tagged cells (right). Prior to pronuclear selection, DNA-PKcs localizes only to the MAC. Upon pronuclear selection, it appears in the selected pronucleus (red arrowhead). Scale bar denotes 10 μm. DOI: http://dx.doi.org/10.7554/eLife.26176.006

    Article Snippet: Construction of C-terminal epitope-tagged vectors Approximately 1 kb of the ORFs (5′) and downstream UTRs (3′) of the TOP2s , TOP2g , and SPO11 genomic loci were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (Takara, Kusatsu, Japan) and the following primers: TOP2s 5′ forward – AGTCGAGCTCACGCTAAGGAGCAGACCTCG, reverse – AGTCGGATCCGAAATAGCATTCATCCGATGATTC; TOP2s 3′ forward – AGTCCTCGAGCATGCATTCATTCAATCAATCAATC, reverse – AGTCGGTACCGGTCTTGGCAATTAACTCTCTCAC; TOP2g 5′ forward – AGTCGAGCTCCAGGTAAAGGGTTTACATAGAATG, reverse – AGTCGGATCCATCATCCTCATCCTCATCAAATAA; TOP2g 3′ forward – AGTCCTCGAGACAGTGATGTCAGAATGTTAAATC, reverse – AGTCGGTACCCTTAAAGGCAGAAAATTAAGAGGT; SPO11 5′ forward – AGTCGAGCTCGATTACTGGGAAAGGGTA, reverse – AGTCGGATCCTAAATATTTGTTTGATTAGATTTTA; and SPO11 3′ forward – AGTCCTCGAGTAATTTCTTATTTTTCTTTTTTGCT, reverse – AGTCGGTACCAATTTCTTCCATACAAAAAGCATCA).

    Techniques: Non-Homologous End Joining, Construct, Expressing, Amplification, Clone Assay, Plasmid Preparation, Transformation Assay, Selection

    The QuikChange TM method PCR with different high fidelity DNA polymerases. ( A ) Gel electrophoresis of the PCR products produced by different DNA polymerases; 3 μl of each product was analyzed. Lane 1, PCR product of PrimeStar; Lane 2, PCR product of TransTaq; Lane 3, PCR product of Phusion; Lane 4, PCR product of Pyrobest; Lane 5, PCR product of KOD FX polymerase; Lane 6, PCR product of PfuTurbo; Lane 7, PCR product of Q5 DNA polymerase. ( B ) Colonies were formed after transformation of the PCR products. Five microliters of the QuikChange TM PCR product was transformed into E. coli XL-1 Blue MRF’ cells; colonies were counted. Dark gray column, blue colonies; Light gray column, white colonies. The data are averages of three experiments with standard deviations (error bar). The lane numbers in ( A ) correspond to the column numbers in ( B ).

    Journal: Nucleic Acids Research

    Article Title: New insights into the QuikChangeTM process guide the use of Phusion DNA polymerase for site-directed mutagenesis

    doi: 10.1093/nar/gku1189

    Figure Lengend Snippet: The QuikChange TM method PCR with different high fidelity DNA polymerases. ( A ) Gel electrophoresis of the PCR products produced by different DNA polymerases; 3 μl of each product was analyzed. Lane 1, PCR product of PrimeStar; Lane 2, PCR product of TransTaq; Lane 3, PCR product of Phusion; Lane 4, PCR product of Pyrobest; Lane 5, PCR product of KOD FX polymerase; Lane 6, PCR product of PfuTurbo; Lane 7, PCR product of Q5 DNA polymerase. ( B ) Colonies were formed after transformation of the PCR products. Five microliters of the QuikChange TM PCR product was transformed into E. coli XL-1 Blue MRF’ cells; colonies were counted. Dark gray column, blue colonies; Light gray column, white colonies. The data are averages of three experiments with standard deviations (error bar). The lane numbers in ( A ) correspond to the column numbers in ( B ).

    Article Snippet: The PCR reactions were also done with commercially available PfuTurbo (Agilent), PrimeStar (Takara), TransTaq (Transgene), Phusion (Fisher-Thermo Scientific), Pyrobest DNA polymerase (Takara), KOD FX DNA polymerase (Toyobo Life Science) and Q5 DNA polymerase (New England Lab) in 20 μl and optimized according to the suppliers’ instructions (Supplementary Figure S2A).

    Techniques: Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Produced, Transformation Assay

    Primer sensitivity. Representative data for the detection limit of GAS-specific primers using MightyAmp DNA polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration

    Journal: BMC Microbiology

    Article Title: DNA-based culture-independent analysis detects the presence of group a streptococcus in throat samples from healthy adults in Japan

    doi: 10.1186/s12866-016-0858-5

    Figure Lengend Snippet: Primer sensitivity. Representative data for the detection limit of GAS-specific primers using MightyAmp DNA polymerase. S. pyogenes JRS4 DNA was serially diluted (6.25 ng to 0.625 fg DNA corresponds to 3 × 10 6 to 0.3 genomic copies of GAS). Sterile deionized water was used for the negative control. Lane M, DNA marker; 1, 6.25 ng; 2, 625 pg; 3, 62.5 pg; 4, 6.25 pg; 5, 625 fg; 6, 62.5 fg; 7, 6.25 fg; 8, 0.625 fg; N, negative control. Arrows indicate the detection limits of the template DNA concentration

    Article Snippet: The 50 μl PCR mixture contained 25 μl of 2 X MightyAmp buffer Ver.2 (Takara), 4 μl of a 10 μM primer mix, 1 μl of MightyAmp DNA polymerase (Takara) and 5 μl of template DNA.

    Techniques: Negative Control, Marker, Concentration Assay