dna polymerase Roche Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Roche dna polymerase
    Antigenic region of the VacA gene from Helicobacter pylori amplified by <t>PCR.</t> Lane 1: <t>DNA</t> marker, Lane 2: PCR product
    Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 922 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase/product/Roche
    Average 95 stars, based on 922 article reviews
    Price from $9.99 to $1999.99
    dna polymerase - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    98
    Bio-Rad dna polymerase
    Antigenic region of the VacA gene from Helicobacter pylori amplified by <t>PCR.</t> Lane 1: <t>DNA</t> marker, Lane 2: PCR product
    Dna Polymerase, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 154 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase/product/Bio-Rad
    Average 98 stars, based on 154 article reviews
    Price from $9.99 to $1999.99
    dna polymerase - by Bioz Stars, 2020-02
    98/100 stars
      Buy from Supplier

    76
    Roche faststart hifi dnapol
    Antigenic region of the VacA gene from Helicobacter pylori amplified by <t>PCR.</t> Lane 1: <t>DNA</t> marker, Lane 2: PCR product
    Faststart Hifi Dnapol, supplied by Roche, used in various techniques. Bioz Stars score: 76/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststart hifi dnapol/product/Roche
    Average 76 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    faststart hifi dnapol - by Bioz Stars, 2020-02
    76/100 stars
      Buy from Supplier

    94
    Roche t4 dna polymerase
    Trf4 and Trf5 exhibit a poly(A) polymerase activity but no DNA polymerase activity. (A) DNA polymerase assays on a 29/75-nt primer/template partial duplex DNA substrate. The 29-nt primer was 32 P labeled at the 5′ end and annealed to a 75-nt template. Wild-type (wt) Trf4 (lane 3), Trf4 DD236,238AA (lane 4), and wild-type Trf5 (lane 5) (10 nM each) were incubated with the DNA substrate (20 nM) in the presence of each of the four dNTPs (100 μM). For positive and negative controls, parallel reactions were also carried out with <t>T4</t> DNA polymerase (lane 2), and no added protein (NP) (lane 1). Reaction products were analyzed on a 15% polyacrylamide gel containing 8 M urea and analyzed by a PhosphorImager. (B) DNA polymerase assays on an oligo(dT)/poly(dA) DNA substrate. A mixture of 12- to 18-nt oligo(dT) primers was 5′ end labeled and annealed to poly(dA) template. DNA polymerase reactions were carried out as described for panel A. (C) Poly(A) polymerase assays on a poly(A) substrate. Trf4 (lane 2), Trf4 DD236,238AA (lane 3), and Trf5 (lane 4) (10 nM each) were incubated with poly(A) RNA and [α- 32 P]ATP (50 μM) in the presence of 5 mM Mg 2+ and 0.5 mM Mn 2+ . A control reaction (lane 1) included no added protein (NP). Reaction products were resolved on a 15% polyacrylamide gel containing 8 M urea followed by PhosphorImager analyses of the incorporation of AMP into RNA tails. The sizes of the reaction products (in nucleotides) are indicated to the right of the gel.
    T4 Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 445 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna polymerase/product/Roche
    Average 94 stars, based on 445 article reviews
    Price from $9.99 to $1999.99
    t4 dna polymerase - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    94
    Roche amplitaq dna polymerase
    Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of <t>Amplitaq</t> <t>DNA</t> polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.
    Amplitaq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 437 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplitaq dna polymerase/product/Roche
    Average 94 stars, based on 437 article reviews
    Price from $9.99 to $1999.99
    amplitaq dna polymerase - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    82
    Roche hifi dna polymerase
    Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of <t>Amplitaq</t> <t>DNA</t> polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.
    Hifi Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 82/100, based on 29 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hifi dna polymerase/product/Roche
    Average 82 stars, based on 29 article reviews
    Price from $9.99 to $1999.99
    hifi dna polymerase - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    91
    Roche tgo dna polymerase
    Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of <t>Amplitaq</t> <t>DNA</t> polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.
    Tgo Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 135 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tgo dna polymerase/product/Roche
    Average 91 stars, based on 135 article reviews
    Price from $9.99 to $1999.99
    tgo dna polymerase - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    80
    Roche dna polymerase klenow
    Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of <t>Amplitaq</t> <t>DNA</t> polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.
    Dna Polymerase Klenow, supplied by Roche, used in various techniques. Bioz Stars score: 80/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase klenow/product/Roche
    Average 80 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    dna polymerase klenow - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    91
    Roche expand dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Expand Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 153 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand dna polymerase/product/Roche
    Average 91 stars, based on 153 article reviews
    Price from $9.99 to $1999.99
    expand dna polymerase - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    83
    Roche z05 dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Z05 Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 83/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/z05 dna polymerase/product/Roche
    Average 83 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    z05 dna polymerase - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    83
    Roche tma31fs dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Tma31fs Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 83/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tma31fs dna polymerase/product/Roche
    Average 83 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    tma31fs dna polymerase - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    99
    Roche faststart dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Faststart Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 255 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststart dna polymerase/product/Roche
    Average 99 stars, based on 255 article reviews
    Price from $9.99 to $1999.99
    faststart dna polymerase - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    PerkinElmer amplitaq dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Amplitaq Dna Polymerase, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 99/100, based on 3647 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplitaq dna polymerase/product/PerkinElmer
    Average 99 stars, based on 3647 article reviews
    Price from $9.99 to $1999.99
    amplitaq dna polymerase - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    83
    Roche fasttaq dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Fasttaq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 83/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fasttaq dna polymerase/product/Roche
    Average 83 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    fasttaq dna polymerase - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    81
    Roche pwoi dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Pwoi Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 81/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pwoi dna polymerase/product/Roche
    Average 81 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    pwoi dna polymerase - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    99
    Roche faststarttaq dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Faststarttaq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststarttaq dna polymerase/product/Roche
    Average 99 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    faststarttaq dna polymerase - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    83
    Roche goldstar dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Goldstar Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 83/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/goldstar dna polymerase/product/Roche
    Average 83 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    goldstar dna polymerase - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    89
    Roche phusion dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Phusion Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 89/100, based on 28 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion dna polymerase/product/Roche
    Average 89 stars, based on 28 article reviews
    Price from $9.99 to $1999.99
    phusion dna polymerase - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    77
    Roche hifidelity dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Hifidelity Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 77/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hifidelity dna polymerase/product/Roche
    Average 77 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    hifidelity dna polymerase - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    92
    Roche tth dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Tth Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 125 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tth dna polymerase/product/Roche
    Average 92 stars, based on 125 article reviews
    Price from $9.99 to $1999.99
    tth dna polymerase - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    79
    Roche faststartaq dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Faststartaq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 79/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststartaq dna polymerase/product/Roche
    Average 79 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    faststartaq dna polymerase - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    79
    Roche ehf dna polymerase
    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse <t>PCR</t> reaction used to recover the allele from genomic <t>DNA.</t> ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele
    Ehf Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 79/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ehf dna polymerase/product/Roche
    Average 79 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    ehf dna polymerase - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    81
    Roche amplitaqgold dna polymerase
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); <t>Amplitaq</t> = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq <t>DNA</t> Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Amplitaqgold Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 81/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplitaqgold dna polymerase/product/Roche
    Average 81 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    amplitaqgold dna polymerase - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    80
    Roche amplitag dna polymerase
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); <t>Amplitaq</t> = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq <t>DNA</t> Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Amplitag Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 80/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplitag dna polymerase/product/Roche
    Average 80 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    amplitag dna polymerase - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    95
    Roche rtth dna polymerase
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); <t>Amplitaq</t> = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq <t>DNA</t> Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Rtth Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rtth dna polymerase/product/Roche
    Average 95 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    rtth dna polymerase - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    77
    Roche hifitaq dna polymerase
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); <t>Amplitaq</t> = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq <t>DNA</t> Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Hifitaq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 77/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hifitaq dna polymerase/product/Roche
    Average 77 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    hifitaq dna polymerase - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    95
    Roche iproof dna polymerase
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); <t>Amplitaq</t> = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq <t>DNA</t> Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Iproof Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iproof dna polymerase/product/Roche
    Average 95 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    iproof dna polymerase - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    83
    Roche long dna polymerase
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); <t>Amplitaq</t> = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq <t>DNA</t> Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Long Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 83/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long dna polymerase/product/Roche
    Average 83 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    long dna polymerase - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    88
    Roche kapa dna polymerase
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); <t>Amplitaq</t> = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq <t>DNA</t> Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Kapa Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kapa dna polymerase/product/Roche
    Average 88 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    kapa dna polymerase - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    94
    Roche template dna polymerase
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); <t>Amplitaq</t> = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq <t>DNA</t> Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Template Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/template dna polymerase/product/Roche
    Average 94 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    template dna polymerase - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    81
    Roche taqgold dna polymerase
    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); <t>Amplitaq</t> = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq <t>DNA</t> Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.
    Taqgold Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 81/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqgold dna polymerase/product/Roche
    Average 81 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    taqgold dna polymerase - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    77
    Roche thermostable dna polymerase
    <t>PCR</t> analysis of three disruption mutants. P1 to P8 refer to priming sites. PCR amplification for identifying the deletion of each target gene was performed using each E. coli BL21 mutant genomic <t>DNA</t> as a template. (A) Salvage pathway gene disruptions. M, size marker; lane 1, deoC and deoB region including deoA (2.0 kb); lane 2, Δ deoC :: cat ::Δ deoB (1.3 kb); lane 3, Δ( deoC-deoB ) (0.4 kb), represented to Δ deoA ; lane 4, tdk (0.6 kb); lane 5, Δ tdk :: cat (1.1 kb); lane 6, Δ tdk (0.2 kb); lane 7, udp (0.7 kb); lane 8, Δ udp :: cat (1.1 kb); lane 9, Δ udp (0.2 kb). The FRT (black bar)-flanked chloramphenicol-resistant gene was amplified by PCR. The linear disruption PCR fragment (gray bar) was transformed into a strain expressing the λ Red recombinase, and then chloramphenicol-resistant transformants were selected. The selective marker was eliminated by FLP recombinase system. (B) ung disruption. Lane 1, ung (0.7 kb); lane 2, Δ ung :: cat (1.1 kb); lane 3, Δ ung (0.2 kb).
    Thermostable Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 77/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thermostable dna polymerase/product/Roche
    Average 77 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    thermostable dna polymerase - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    Image Search Results


    Antigenic region of the VacA gene from Helicobacter pylori amplified by PCR. Lane 1: DNA marker, Lane 2: PCR product

    Journal: Iranian Journal of Basic Medical Sciences

    Article Title: Expression and Antigenic Evaluation of VacA Antigenic Fragment of Helicobacter Pylori

    doi:

    Figure Lengend Snippet: Antigenic region of the VacA gene from Helicobacter pylori amplified by PCR. Lane 1: DNA marker, Lane 2: PCR product

    Article Snippet: PCR amplification was performed in a 50 μl total volume containing 3 μl of template DNA, 2 μl of each primers (10 picomole), 8 μl MgCl₂ (25 mM), 1.5 μl dNTP mixture, 5 μl PCR buffer (10X) and 1 μl of expand DNA polymerase (Roche, Germany).

    Techniques: Amplification, Polymerase Chain Reaction, Marker

    Anti-CBF-A antiserum recognizes TBP42. Purified CBF-A or qTBP42 proteins were incubated at 4°C for 90 min with rabbit anti-CBF-A antibodies adsorbed to protein A/G-agarose (see Materials and Methods). Control mixtures contained pre-immune rabbit serum adsorbed to protein A/G-agarose or protein A/G-agarose with no adsorbed protein. The protein A/G-agarose beads were removed by centrifugation and aliquots of the supernatant fractions were assayed for binding of 5′- 32 P G′2 5′-tail TeR2 DNA as described in Materials and Methods. Phosphorimages of protein-G′2 5′-tail TeR2 complexes resolved from unbound DNA by electrophoresis through non-denaturing 9% polyacrylamide mobility shift gels are shown.

    Journal: Nucleic Acids Research

    Article Title: Distinct domains in the CArG-box binding factor A destabilize tetraplex forms of the fragile X expanded sequence d(CGG)n

    doi:

    Figure Lengend Snippet: Anti-CBF-A antiserum recognizes TBP42. Purified CBF-A or qTBP42 proteins were incubated at 4°C for 90 min with rabbit anti-CBF-A antibodies adsorbed to protein A/G-agarose (see Materials and Methods). Control mixtures contained pre-immune rabbit serum adsorbed to protein A/G-agarose or protein A/G-agarose with no adsorbed protein. The protein A/G-agarose beads were removed by centrifugation and aliquots of the supernatant fractions were assayed for binding of 5′- 32 P G′2 5′-tail TeR2 DNA as described in Materials and Methods. Phosphorimages of protein-G′2 5′-tail TeR2 complexes resolved from unbound DNA by electrophoresis through non-denaturing 9% polyacrylamide mobility shift gels are shown.

    Article Snippet: Using primers with Eco RI ends, the CBF-A cDNA insert was amplified by polymerase chain reaction (PCR) using Pow DNA polymerase (Roche) and the product cDNA was cloned into pGEX-2T.

    Techniques: Purification, Incubation, Centrifugation, Binding Assay, Nucleic Acid Electrophoresis, Mobility Shift

    CBF-A and qTBP42 are heat-stable proteins that slow down denaturation of associated G′2 5′-tail TeR2 DNA. ( A ) Heat stability of CBF-A and qTBP42. Purified CBF-A at 100 µg/ml or qTBP42 protein to which bovine serum albumin was added to the same concentration, were incubated, each in duplicate, at temperatures ranging from 4 to 100°C for 10 min in a final volume of 10 µl of buffer D. The samples were rapidly cooled to 4°C and aliquots were assayed under standard conditions for the binding of 90 fmol of 5′- 32 P G′2 5′-tail TeR2 DNA. Protein–DNA complexes were resolved by electrophoresis at 4°C in 8% polyacrylamide gels, 0.5× TBE buffer, 10 mM KCl. Amounts of protein-bound 5′- 32 P G′2 5′-tail TeR2 DNA were quantified by phosphorimaging. Relative binding of 100% represents association of CBF-A or qTBP42 with 85.5–89 fmol of tetraplex DNA. Closed circles, qTBP42; open circles, CBF-A. ( B ) Binding of CBF-A and qTBP42 slows down the denaturation of G′2 5′-tail TeR2 DNA. DNA, 26 fmol of 5′- 32 P G′2 5′-tail TeR2, was incubated at 4°C for 20 min in 10 µl of buffer D, 10 mM KCl reaction mixtures that contained no protein or 167 pmol GST, 13 pmol of CBF-A, or qTBP42 (amount not determined, see Materials and Methods). The mixtures were transferred to 51°C for the indicated periods of time, rapidly cooled to 4°C and protein was removed from the DNA by adding 1% SDS to a final concentration of 0.3%. Intact and denatured G′2 5′-tail TeR2 DNA were resolved from one another by electrophoresis at 4°C in 10% polyacrylamide gels, 0.5× TBE buffer, 10 mM KCl. Amounts of G′2 and single-stranded DNA were quantified by phosphorimaging. A value of 100% G′2 5′-tail TeR2 DNA represents 57% G′2 out of the total 5′-tail TeR2 DNA in samples that were kept at 4°C. Closed circles, qTBP42; open circles, CBF-A; open boxes, GST; closed boxes, no protein.

    Journal: Nucleic Acids Research

    Article Title: Distinct domains in the CArG-box binding factor A destabilize tetraplex forms of the fragile X expanded sequence d(CGG)n

    doi:

    Figure Lengend Snippet: CBF-A and qTBP42 are heat-stable proteins that slow down denaturation of associated G′2 5′-tail TeR2 DNA. ( A ) Heat stability of CBF-A and qTBP42. Purified CBF-A at 100 µg/ml or qTBP42 protein to which bovine serum albumin was added to the same concentration, were incubated, each in duplicate, at temperatures ranging from 4 to 100°C for 10 min in a final volume of 10 µl of buffer D. The samples were rapidly cooled to 4°C and aliquots were assayed under standard conditions for the binding of 90 fmol of 5′- 32 P G′2 5′-tail TeR2 DNA. Protein–DNA complexes were resolved by electrophoresis at 4°C in 8% polyacrylamide gels, 0.5× TBE buffer, 10 mM KCl. Amounts of protein-bound 5′- 32 P G′2 5′-tail TeR2 DNA were quantified by phosphorimaging. Relative binding of 100% represents association of CBF-A or qTBP42 with 85.5–89 fmol of tetraplex DNA. Closed circles, qTBP42; open circles, CBF-A. ( B ) Binding of CBF-A and qTBP42 slows down the denaturation of G′2 5′-tail TeR2 DNA. DNA, 26 fmol of 5′- 32 P G′2 5′-tail TeR2, was incubated at 4°C for 20 min in 10 µl of buffer D, 10 mM KCl reaction mixtures that contained no protein or 167 pmol GST, 13 pmol of CBF-A, or qTBP42 (amount not determined, see Materials and Methods). The mixtures were transferred to 51°C for the indicated periods of time, rapidly cooled to 4°C and protein was removed from the DNA by adding 1% SDS to a final concentration of 0.3%. Intact and denatured G′2 5′-tail TeR2 DNA were resolved from one another by electrophoresis at 4°C in 10% polyacrylamide gels, 0.5× TBE buffer, 10 mM KCl. Amounts of G′2 and single-stranded DNA were quantified by phosphorimaging. A value of 100% G′2 5′-tail TeR2 DNA represents 57% G′2 out of the total 5′-tail TeR2 DNA in samples that were kept at 4°C. Closed circles, qTBP42; open circles, CBF-A; open boxes, GST; closed boxes, no protein.

    Article Snippet: Using primers with Eco RI ends, the CBF-A cDNA insert was amplified by polymerase chain reaction (PCR) using Pow DNA polymerase (Roche) and the product cDNA was cloned into pGEX-2T.

    Techniques: Purification, Concentration Assay, Incubation, Binding Assay, Electrophoresis

    Destabilization of G′2 3′-tail d(CGG) 7 . Wild-type CBF-A or hnRNP A1 proteins, at 33 pmol each or 165 pmol each of R1 1 R1 2 or 1–260 CBF-A mutant proteins were incubated at 37°C for 15 min with 0.16 pmol of 5′- 32 P G′2 3′-tail d(CGG) 7 under standard tetraplex DNA destabilization assay conditions. Control samples that did not contain protein were similarly incubated at 37 or 100°C to reveal the initial amount of G′2 3′-tail d(CGG) 7 and the position of displaced single-stranded DNA, respectively. The tetraplex unwinding reaction was terminated by the addition of 1% SDS to a final concentration of 0.3%, and tetraplex and single-stranded 3′-tail d(CGG) 7 were resolved by electrophoresis through a 10% polyacrylamide gel, 0.5× TBE buffer, 10 mM KCl. A phosphorimage of the electropherogram is shown.

    Journal: Nucleic Acids Research

    Article Title: Distinct domains in the CArG-box binding factor A destabilize tetraplex forms of the fragile X expanded sequence d(CGG)n

    doi:

    Figure Lengend Snippet: Destabilization of G′2 3′-tail d(CGG) 7 . Wild-type CBF-A or hnRNP A1 proteins, at 33 pmol each or 165 pmol each of R1 1 R1 2 or 1–260 CBF-A mutant proteins were incubated at 37°C for 15 min with 0.16 pmol of 5′- 32 P G′2 3′-tail d(CGG) 7 under standard tetraplex DNA destabilization assay conditions. Control samples that did not contain protein were similarly incubated at 37 or 100°C to reveal the initial amount of G′2 3′-tail d(CGG) 7 and the position of displaced single-stranded DNA, respectively. The tetraplex unwinding reaction was terminated by the addition of 1% SDS to a final concentration of 0.3%, and tetraplex and single-stranded 3′-tail d(CGG) 7 were resolved by electrophoresis through a 10% polyacrylamide gel, 0.5× TBE buffer, 10 mM KCl. A phosphorimage of the electropherogram is shown.

    Article Snippet: Using primers with Eco RI ends, the CBF-A cDNA insert was amplified by polymerase chain reaction (PCR) using Pow DNA polymerase (Roche) and the product cDNA was cloned into pGEX-2T.

    Techniques: Mutagenesis, Incubation, Concentration Assay, Electrophoresis

    CBF-A destabilizes bimolecular tetraplex G′2 3′-tail d(CGG) n and binds bimolecular tetraplex G′2 5′-tail TeR2. ( A ) Destabilization of G′2 3′-tail d(CGG) 7 by CBF-A. Increasing amounts of purified recombinant CBF-A, 5–2000 ng were incubated at 37°C for 15 min with 5′- 32 P G′2 3′-tail d(CGG) 7 under standard tetraplex DNA destabilization assay conditions (see Materials and Methods). Control G′2 3′-tail d(CGG) 7 with no added protein was either boiled for 10 min to denature the tetraplex DNA structure or was incubated at 37°C under standard tetraplex DNA destabilization conditions to reveal the initial amount of unwound G′2 3′-tail d(CGG) 7 . The reaction mixtures were cooled to 4°C and 1% SDS was added to a final concentration of 0.3% to denature DNA-bound protein. Intact and destabilized G′2 3′-tail d(CGG) 7 were resolved by electrophoresis at 4°C in 10% polyacrylamide gels in 0.5× TBE buffer, 10 mM KCl. A phosphorimage of the electropherogram is shown. ( B ) Binding of 5′-tail TeR2 DNA by CBF-A. Increasing amounts of CBF-A, 5–600 ng, were incubated at 4°C for 20 min with 5′- 32 P G′2 5′-tail TeR2 DNA under standard tetraplex DNA-binding conditions (see Materials and Methods). Control G′2 5′-tail TeR2 DNA without added protein was either boiled for 10 min to denature the tetraplex DNA structure or was incubated at 4°C under standard tetraplex DNA-binding conditions to reveal the initial amount of unbound G′2 5′-tail TeR2 DNA. A phosphorimage of a 9% polyacrylamide, 0.5× TBE buffer, 10 mM KCl gel is shown.

    Journal: Nucleic Acids Research

    Article Title: Distinct domains in the CArG-box binding factor A destabilize tetraplex forms of the fragile X expanded sequence d(CGG)n

    doi:

    Figure Lengend Snippet: CBF-A destabilizes bimolecular tetraplex G′2 3′-tail d(CGG) n and binds bimolecular tetraplex G′2 5′-tail TeR2. ( A ) Destabilization of G′2 3′-tail d(CGG) 7 by CBF-A. Increasing amounts of purified recombinant CBF-A, 5–2000 ng were incubated at 37°C for 15 min with 5′- 32 P G′2 3′-tail d(CGG) 7 under standard tetraplex DNA destabilization assay conditions (see Materials and Methods). Control G′2 3′-tail d(CGG) 7 with no added protein was either boiled for 10 min to denature the tetraplex DNA structure or was incubated at 37°C under standard tetraplex DNA destabilization conditions to reveal the initial amount of unwound G′2 3′-tail d(CGG) 7 . The reaction mixtures were cooled to 4°C and 1% SDS was added to a final concentration of 0.3% to denature DNA-bound protein. Intact and destabilized G′2 3′-tail d(CGG) 7 were resolved by electrophoresis at 4°C in 10% polyacrylamide gels in 0.5× TBE buffer, 10 mM KCl. A phosphorimage of the electropherogram is shown. ( B ) Binding of 5′-tail TeR2 DNA by CBF-A. Increasing amounts of CBF-A, 5–600 ng, were incubated at 4°C for 20 min with 5′- 32 P G′2 5′-tail TeR2 DNA under standard tetraplex DNA-binding conditions (see Materials and Methods). Control G′2 5′-tail TeR2 DNA without added protein was either boiled for 10 min to denature the tetraplex DNA structure or was incubated at 4°C under standard tetraplex DNA-binding conditions to reveal the initial amount of unbound G′2 5′-tail TeR2 DNA. A phosphorimage of a 9% polyacrylamide, 0.5× TBE buffer, 10 mM KCl gel is shown.

    Article Snippet: Using primers with Eco RI ends, the CBF-A cDNA insert was amplified by polymerase chain reaction (PCR) using Pow DNA polymerase (Roche) and the product cDNA was cloned into pGEX-2T.

    Techniques: Purification, Recombinant, Incubation, Concentration Assay, Electrophoresis, Binding Assay

    ( a ) Time-dependent primer extension using B-TTP and TTP: reaction was performed with 5 µM 5′5′- 32 P-primer/template, 0.4 mM of each dNTPs, 0.4 mM of B-TTP, and Klenow 0.04 units. Electrophoresis was conducted on 19% acrylamide gel. ( b ) Primer extension using B-TTP analyzed on 15% acrylamide gel: reaction was performed with 5 µM 5′5′- 32 P-primer/template, 0.4 mM of each dNTPs, 0.4 mM of B-TTP, and Klenow 0.04 units. From left to right, lane 1 (from left): M-TTP-DNA; lane 2: co-spot of M-TTP-DNA and TTP-DNA; lane 3: TTP-DNA; lane 4: co-spot of B-TTP-DNA, and TTP-DNA; lane 5 B-TTP-DNA, lane 6: primer.

    Journal: Nucleic Acids Research

    Article Title: Design and synthesis of boronic-acid-labeled thymidine triphosphate for incorporation into DNA

    doi: 10.1093/nar/gkl1091

    Figure Lengend Snippet: ( a ) Time-dependent primer extension using B-TTP and TTP: reaction was performed with 5 µM 5′5′- 32 P-primer/template, 0.4 mM of each dNTPs, 0.4 mM of B-TTP, and Klenow 0.04 units. Electrophoresis was conducted on 19% acrylamide gel. ( b ) Primer extension using B-TTP analyzed on 15% acrylamide gel: reaction was performed with 5 µM 5′5′- 32 P-primer/template, 0.4 mM of each dNTPs, 0.4 mM of B-TTP, and Klenow 0.04 units. From left to right, lane 1 (from left): M-TTP-DNA; lane 2: co-spot of M-TTP-DNA and TTP-DNA; lane 3: TTP-DNA; lane 4: co-spot of B-TTP-DNA, and TTP-DNA; lane 5 B-TTP-DNA, lane 6: primer.

    Article Snippet: Incorporation of B-TTP into DNA by PCR Each 50 μl reaction was performed with 1.2 μM primers 1 and 2/template, 0.25 mM of each dNTPs, 0.25 mM of labeled-TTP (B-TTP) and 3.5 units of high fidelity DNA polymerase (Roche, Indianapolis, Ind.) under conditions of 1 cycle at 94°C for 2 min, 30 cycles at 94°C for 20 s, 59°C for 30 s, 72°C for 1 min and 1 cycle at 72°C for 7 min. (Primer 1: 5′-CGCCGCCCCCGCCGCG-3′ Primer 2: 5′-CGGCGGCCCGCGGGCG; Template DNA: 5′-CGCCGCCCCCGCCGCG-40N-CGCCCGCGGGCCGCCG-3′.)

    Techniques: Electrophoresis, Acrylamide Gel Assay

    Primer extension using the full-length DNA and boronic acid-labeled DNA as templates. Each 50 µl reaction was performed with 1.2 µM primers 1 and 2/template, 0.25 mM of each dNTPs, 0.25 mM of labeled-TTP (B-TTP), and 3.5 units of high-fidelity DNA polymerase (Roche, Indianapolis, Ind.) under conditions of 1 cycle at 94°C for 2 min, 30 cycles at 94°C for 20 s, 59°C for 30 s, 72°C for 1 min and 1 cycle at 72°C for 7 min. Lane 1: Marker; lane 2: DNA synthesized using dNTPs; lane 3: DNA synthesized using B-TTP and the other three dNTPs. Primer 1: 5′-CGCCGCCCCCGCCGCG-3′ Primer 2: 5′-CGGCGGCCCGCGGGCG; Template DNA: 5′-CGCCGCCCCCGCCGCG-40N-CGCCCGCGGGCCGCCG-3′.

    Journal: Nucleic Acids Research

    Article Title: Design and synthesis of boronic-acid-labeled thymidine triphosphate for incorporation into DNA

    doi: 10.1093/nar/gkl1091

    Figure Lengend Snippet: Primer extension using the full-length DNA and boronic acid-labeled DNA as templates. Each 50 µl reaction was performed with 1.2 µM primers 1 and 2/template, 0.25 mM of each dNTPs, 0.25 mM of labeled-TTP (B-TTP), and 3.5 units of high-fidelity DNA polymerase (Roche, Indianapolis, Ind.) under conditions of 1 cycle at 94°C for 2 min, 30 cycles at 94°C for 20 s, 59°C for 30 s, 72°C for 1 min and 1 cycle at 72°C for 7 min. Lane 1: Marker; lane 2: DNA synthesized using dNTPs; lane 3: DNA synthesized using B-TTP and the other three dNTPs. Primer 1: 5′-CGCCGCCCCCGCCGCG-3′ Primer 2: 5′-CGGCGGCCCGCGGGCG; Template DNA: 5′-CGCCGCCCCCGCCGCG-40N-CGCCCGCGGGCCGCCG-3′.

    Article Snippet: Incorporation of B-TTP into DNA by PCR Each 50 μl reaction was performed with 1.2 μM primers 1 and 2/template, 0.25 mM of each dNTPs, 0.25 mM of labeled-TTP (B-TTP) and 3.5 units of high fidelity DNA polymerase (Roche, Indianapolis, Ind.) under conditions of 1 cycle at 94°C for 2 min, 30 cycles at 94°C for 20 s, 59°C for 30 s, 72°C for 1 min and 1 cycle at 72°C for 7 min. (Primer 1: 5′-CGCCGCCCCCGCCGCG-3′ Primer 2: 5′-CGGCGGCCCGCGGGCG; Template DNA: 5′-CGCCGCCCCCGCCGCG-40N-CGCCCGCGGGCCGCCG-3′.)

    Techniques: Labeling, Marker, Synthesized

    Gel-shifting experiments of full-length natural and boronic acid-labeled DNA using catechol-modified acrylamide gel: reaction was performed with 5 µM 5′- 32 P-primer/template, 0.4 mM of each dNTPs, 0.4 mM of B-TTP and Klenow 0.04 units for 1 h; the acrylamide gel was prepared with 19% acrylamide and 1% N -[2-(3,4-dihydroxyphenyl)-ethyl]-acrylamide co-loaded lane 1. From left to right: lane 1, M-TTP-derived DNA; lane 3, TTP-derived DNA; lane 5, B-TTP-derived DNA; lane 6, primer; lane 2, M-TTP and TTP-derived DNA co-loaded; lane 4, TTP and B-TTP-derived DNA co-loaded.

    Journal: Nucleic Acids Research

    Article Title: Design and synthesis of boronic-acid-labeled thymidine triphosphate for incorporation into DNA

    doi: 10.1093/nar/gkl1091

    Figure Lengend Snippet: Gel-shifting experiments of full-length natural and boronic acid-labeled DNA using catechol-modified acrylamide gel: reaction was performed with 5 µM 5′- 32 P-primer/template, 0.4 mM of each dNTPs, 0.4 mM of B-TTP and Klenow 0.04 units for 1 h; the acrylamide gel was prepared with 19% acrylamide and 1% N -[2-(3,4-dihydroxyphenyl)-ethyl]-acrylamide co-loaded lane 1. From left to right: lane 1, M-TTP-derived DNA; lane 3, TTP-derived DNA; lane 5, B-TTP-derived DNA; lane 6, primer; lane 2, M-TTP and TTP-derived DNA co-loaded; lane 4, TTP and B-TTP-derived DNA co-loaded.

    Article Snippet: Incorporation of B-TTP into DNA by PCR Each 50 μl reaction was performed with 1.2 μM primers 1 and 2/template, 0.25 mM of each dNTPs, 0.25 mM of labeled-TTP (B-TTP) and 3.5 units of high fidelity DNA polymerase (Roche, Indianapolis, Ind.) under conditions of 1 cycle at 94°C for 2 min, 30 cycles at 94°C for 20 s, 59°C for 30 s, 72°C for 1 min and 1 cycle at 72°C for 7 min. (Primer 1: 5′-CGCCGCCCCCGCCGCG-3′ Primer 2: 5′-CGGCGGCCCGCGGGCG; Template DNA: 5′-CGCCGCCCCCGCCGCG-40N-CGCCCGCGGGCCGCCG-3′.)

    Techniques: Labeling, Modification, Acrylamide Gel Assay, Derivative Assay

    Primer extension using the full-length DNA and boronic acid-labeled DNA as templates. Reaction was performed with 5 µM primer 1/template, 0.4 mM of each dNTPs, 0.4 mM of labeled-TTP (M-TTP and B-TTP), and Klenow 0.04 units for 1 h. After centrifugation–filtration, the reaction was performed with radio-labeled 5′- 32 P-primer 2 and 0.4 mM of each dNTPs. Co-spot 1: polymerization using M-TTP and TTP-derived DNA as templates, Co-spot 2: polymerization using B-TTP and TTP-derived DNA as templates. Primer 1: 5′-GCGTAATACGACTCACTATA-3′; Template DNA: 3′CGCATTATGCTGAGTGATATCCGTTGG A CT A CTCCGGCTT TCCGGCTTTGC A TGT-5′; Primer 2: 5′-TGTACGTTTCGGCCTTTCGG-3′.

    Journal: Nucleic Acids Research

    Article Title: Design and synthesis of boronic-acid-labeled thymidine triphosphate for incorporation into DNA

    doi: 10.1093/nar/gkl1091

    Figure Lengend Snippet: Primer extension using the full-length DNA and boronic acid-labeled DNA as templates. Reaction was performed with 5 µM primer 1/template, 0.4 mM of each dNTPs, 0.4 mM of labeled-TTP (M-TTP and B-TTP), and Klenow 0.04 units for 1 h. After centrifugation–filtration, the reaction was performed with radio-labeled 5′- 32 P-primer 2 and 0.4 mM of each dNTPs. Co-spot 1: polymerization using M-TTP and TTP-derived DNA as templates, Co-spot 2: polymerization using B-TTP and TTP-derived DNA as templates. Primer 1: 5′-GCGTAATACGACTCACTATA-3′; Template DNA: 3′CGCATTATGCTGAGTGATATCCGTTGG A CT A CTCCGGCTT TCCGGCTTTGC A TGT-5′; Primer 2: 5′-TGTACGTTTCGGCCTTTCGG-3′.

    Article Snippet: Incorporation of B-TTP into DNA by PCR Each 50 μl reaction was performed with 1.2 μM primers 1 and 2/template, 0.25 mM of each dNTPs, 0.25 mM of labeled-TTP (B-TTP) and 3.5 units of high fidelity DNA polymerase (Roche, Indianapolis, Ind.) under conditions of 1 cycle at 94°C for 2 min, 30 cycles at 94°C for 20 s, 59°C for 30 s, 72°C for 1 min and 1 cycle at 72°C for 7 min. (Primer 1: 5′-CGCCGCCCCCGCCGCG-3′ Primer 2: 5′-CGGCGGCCCGCGGGCG; Template DNA: 5′-CGCCGCCCCCGCCGCG-40N-CGCCCGCGGGCCGCCG-3′.)

    Techniques: Labeling, Centrifugation, Filtration, Derivative Assay

    POLβ is specifically enriched at CAG expansions in the striatum but not in the cerebellum of HD mice. ChIP of CAG-expanded and Hdh loci from striatum and cerebellum of R6/1 (A) and R6/2 (B) mice using α-POLβ antibody (upper panels) and as control, α-AcH3K9/14 antibody (lower panels). (A) R6/1 mice at both 6 and 37 weeks of age and R6/2 mice at 12 weeks of age were analyzed. Each ChIP experiment was performed by pooling striata and cerebella from 2 to 4 mice. The values plotted on the graphs represent the mean values obtained from 3 to 4 independent experiments. The values correspond to percentage of enrichment, calculated as follows: % enrichment = (relative DNA concentration after ChIP with POLβ or AcH3—relative DNA concentration after ChIP with no antibody)/input. Relative DNA concentrations were measured using quantitative PCR. Error bars are sem.

    Journal: PLoS Genetics

    Article Title: Stoichiometry of Base Excision Repair Proteins Correlates with Increased Somatic CAG Instability in Striatum over Cerebellum in Huntington's Disease Transgenic Mice

    doi: 10.1371/journal.pgen.1000749

    Figure Lengend Snippet: POLβ is specifically enriched at CAG expansions in the striatum but not in the cerebellum of HD mice. ChIP of CAG-expanded and Hdh loci from striatum and cerebellum of R6/1 (A) and R6/2 (B) mice using α-POLβ antibody (upper panels) and as control, α-AcH3K9/14 antibody (lower panels). (A) R6/1 mice at both 6 and 37 weeks of age and R6/2 mice at 12 weeks of age were analyzed. Each ChIP experiment was performed by pooling striata and cerebella from 2 to 4 mice. The values plotted on the graphs represent the mean values obtained from 3 to 4 independent experiments. The values correspond to percentage of enrichment, calculated as follows: % enrichment = (relative DNA concentration after ChIP with POLβ or AcH3—relative DNA concentration after ChIP with no antibody)/input. Relative DNA concentrations were measured using quantitative PCR. Error bars are sem.

    Article Snippet: PCR reactions were performed using the expand high fidelity DNA polymerase (Roche), according to manufacturer's instructions.

    Techniques: Mouse Assay, Chromatin Immunoprecipitation, Concentration Assay, Real-time Polymerase Chain Reaction

    Trf4 and Trf5 exhibit a poly(A) polymerase activity but no DNA polymerase activity. (A) DNA polymerase assays on a 29/75-nt primer/template partial duplex DNA substrate. The 29-nt primer was 32 P labeled at the 5′ end and annealed to a 75-nt template. Wild-type (wt) Trf4 (lane 3), Trf4 DD236,238AA (lane 4), and wild-type Trf5 (lane 5) (10 nM each) were incubated with the DNA substrate (20 nM) in the presence of each of the four dNTPs (100 μM). For positive and negative controls, parallel reactions were also carried out with T4 DNA polymerase (lane 2), and no added protein (NP) (lane 1). Reaction products were analyzed on a 15% polyacrylamide gel containing 8 M urea and analyzed by a PhosphorImager. (B) DNA polymerase assays on an oligo(dT)/poly(dA) DNA substrate. A mixture of 12- to 18-nt oligo(dT) primers was 5′ end labeled and annealed to poly(dA) template. DNA polymerase reactions were carried out as described for panel A. (C) Poly(A) polymerase assays on a poly(A) substrate. Trf4 (lane 2), Trf4 DD236,238AA (lane 3), and Trf5 (lane 4) (10 nM each) were incubated with poly(A) RNA and [α- 32 P]ATP (50 μM) in the presence of 5 mM Mg 2+ and 0.5 mM Mn 2+ . A control reaction (lane 1) included no added protein (NP). Reaction products were resolved on a 15% polyacrylamide gel containing 8 M urea followed by PhosphorImager analyses of the incorporation of AMP into RNA tails. The sizes of the reaction products (in nucleotides) are indicated to the right of the gel.

    Journal: Molecular and Cellular Biology

    Article Title: Trf4 and Trf5 Proteins of Saccharomyces cerevisiae Exhibit Poly(A) RNA Polymerase Activity but No DNA Polymerase Activity

    doi: 10.1128/MCB.25.22.10183-10189.2005

    Figure Lengend Snippet: Trf4 and Trf5 exhibit a poly(A) polymerase activity but no DNA polymerase activity. (A) DNA polymerase assays on a 29/75-nt primer/template partial duplex DNA substrate. The 29-nt primer was 32 P labeled at the 5′ end and annealed to a 75-nt template. Wild-type (wt) Trf4 (lane 3), Trf4 DD236,238AA (lane 4), and wild-type Trf5 (lane 5) (10 nM each) were incubated with the DNA substrate (20 nM) in the presence of each of the four dNTPs (100 μM). For positive and negative controls, parallel reactions were also carried out with T4 DNA polymerase (lane 2), and no added protein (NP) (lane 1). Reaction products were analyzed on a 15% polyacrylamide gel containing 8 M urea and analyzed by a PhosphorImager. (B) DNA polymerase assays on an oligo(dT)/poly(dA) DNA substrate. A mixture of 12- to 18-nt oligo(dT) primers was 5′ end labeled and annealed to poly(dA) template. DNA polymerase reactions were carried out as described for panel A. (C) Poly(A) polymerase assays on a poly(A) substrate. Trf4 (lane 2), Trf4 DD236,238AA (lane 3), and Trf5 (lane 4) (10 nM each) were incubated with poly(A) RNA and [α- 32 P]ATP (50 μM) in the presence of 5 mM Mg 2+ and 0.5 mM Mn 2+ . A control reaction (lane 1) included no added protein (NP). Reaction products were resolved on a 15% polyacrylamide gel containing 8 M urea followed by PhosphorImager analyses of the incorporation of AMP into RNA tails. The sizes of the reaction products (in nucleotides) are indicated to the right of the gel.

    Article Snippet: The T4 DNA polymerase was purchased from Roche (Indianapolis, IN).

    Techniques: Activity Assay, Labeling, Incubation

    Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.

    Article Snippet: Two polymerases not designed specifically for qPCR (no anti-Taq antibody) were also tested: Amplitaq DNA polymerase (ABI, CA; Roche lot # C00622); Qiagen Taq DNA polymerase (Qiagen, CA; Cat # 201205, lot # 127132149.

    Techniques: Labeling

    ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse PCR reaction used to recover the allele from genomic DNA. ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele

    Journal: RNA

    Article Title: A novel strategy to identify the location of necessary and sufficient cis-acting regulatory mRNA elements in trypanosomes

    doi: 10.1261/rna.2510505

    Figure Lengend Snippet: ( a ) Diagram showing the location of the HindIII sites in the GPI-PLC A allele and the location of the primers used for the inverse PCR reaction used to recover the allele from genomic DNA. ( b ) Gel showing the inverse PCR products from the GPI-PLC A allele

    Article Snippet: The PCR reaction was carried out by using 100 ng of self-ligated genomic DNA in a 50 μL PCR reaction using Expand DNA polymerase (Roche) and the oligonucleotides 5′cgccatcgccttctatcgcc and 5′GCGTGCAATCCATCTTGTTC, both of which prime outward from inside the neoR ORF (Fig. 4a ).

    Techniques: Planar Chromatography, Inverse PCR

    A: Pattern of nucleosomal DNA laddering in transfected and untransfected B7 cells with/without exposure to stretch-stimulation at high frequency and magnitude, and in the presence/absence of CRM197. Nucleosomal DNA laddering was present in untransfected B7 cells following apoptotic stretch-stimulation. In contrast, cells transfected with pro-HB-EGF did not undergo apoptosis in response to apoptotic-stretch. However, in the presence of CRM197 (a specific inhibitor of human HB-EGF), apoptotic stretch was able to induce apoptosis in these cells. B: Quantification of apoptosis using DNA fragmentation enzyme-linked immunosorbent assay in untransfected and transfected B7 cells with/without exposure to stretch-stimulation at high frequency and magnitude, and in the presence/absence of CRM197. Results were obtained from two independent experiments and expressed as a ratio to the values obtained in cells not exposed to stretch.

    Journal: The American Journal of Pathology

    Article Title: Heparin-Binding EGF-Like Growth Factor Is Up-Regulated in the Obstructed Kidney in a Cell- and Region-Specific Manner and Acts to Inhibit Apoptosis

    doi:

    Figure Lengend Snippet: A: Pattern of nucleosomal DNA laddering in transfected and untransfected B7 cells with/without exposure to stretch-stimulation at high frequency and magnitude, and in the presence/absence of CRM197. Nucleosomal DNA laddering was present in untransfected B7 cells following apoptotic stretch-stimulation. In contrast, cells transfected with pro-HB-EGF did not undergo apoptosis in response to apoptotic-stretch. However, in the presence of CRM197 (a specific inhibitor of human HB-EGF), apoptotic stretch was able to induce apoptosis in these cells. B: Quantification of apoptosis using DNA fragmentation enzyme-linked immunosorbent assay in untransfected and transfected B7 cells with/without exposure to stretch-stimulation at high frequency and magnitude, and in the presence/absence of CRM197. Results were obtained from two independent experiments and expressed as a ratio to the values obtained in cells not exposed to stretch.

    Article Snippet: Primers specific for pro-HB-EGF were used to subsequently amplify a 667-bp fragment corresponding to pro-HB-EGF using the high fidelity Expand DNA polymerase (Roche Molecular Biochemicals, Indianapolis, IN).

    Techniques: DNA Laddering, Transfection, Enzyme-linked Immunosorbent Assay

    Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.

    Journal: Scientific Reports

    Article Title: A novel perspective on MOL-PCR optimization and MAGPIX analysis of in-house multiplex foodborne pathogens detection assay

    doi: 10.1038/s41598-019-40035-5

    Figure Lengend Snippet: Impact evaluation of Master Mix used in singleplex PCR. In graph: Elizyme = 2X EliZyme HS Robust MIX (Elisabeth Pharmacon, Czech Republic); Accustart II = AccuStart II PCR ToughMix (QuantaBio, Massachusetts, USA); Amplitaq = AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, Massachusetts, USA); OneTaq = OneTaq Hot Start 2X Master Mix with GC Buffer (New England BioLabs, Massachusetts, USA); Platinum = Platinum Hot Start PCR 2X Master Mix (Invitrogen, California, USA); HotStarTaq = HotStarTaq DNA Polymerase (Qiagen, Germany). YE = Y . enterocolitica; TG = T . gondii ; plus sign in legend = positive sample; minus sign = NTC.

    Article Snippet: Optimization of the multiplex oligonucleotide ligation step In the very first paper dealing with MOL-PCR by Deshpande et al ., ligation and PCR were conducted in a single reaction using Ampligase (Epicentre, Wisconsin, USA) and Amplitaq Gold DNA polymerase (Roche, Switzerland).

    Techniques: Polymerase Chain Reaction, Hot Start PCR

    PCR analysis of three disruption mutants. P1 to P8 refer to priming sites. PCR amplification for identifying the deletion of each target gene was performed using each E. coli BL21 mutant genomic DNA as a template. (A) Salvage pathway gene disruptions. M, size marker; lane 1, deoC and deoB region including deoA (2.0 kb); lane 2, Δ deoC :: cat ::Δ deoB (1.3 kb); lane 3, Δ( deoC-deoB ) (0.4 kb), represented to Δ deoA ; lane 4, tdk (0.6 kb); lane 5, Δ tdk :: cat (1.1 kb); lane 6, Δ tdk (0.2 kb); lane 7, udp (0.7 kb); lane 8, Δ udp :: cat (1.1 kb); lane 9, Δ udp (0.2 kb). The FRT (black bar)-flanked chloramphenicol-resistant gene was amplified by PCR. The linear disruption PCR fragment (gray bar) was transformed into a strain expressing the λ Red recombinase, and then chloramphenicol-resistant transformants were selected. The selective marker was eliminated by FLP recombinase system. (B) ung disruption. Lane 1, ung (0.7 kb); lane 2, Δ ung :: cat (1.1 kb); lane 3, Δ ung (0.2 kb).

    Journal: Applied and Environmental Microbiology

    Article Title: Fermentative Production of Thymidine by a Metabolically Engineered Escherichia coli Strain ▿

    doi: 10.1128/AEM.02328-08

    Figure Lengend Snippet: PCR analysis of three disruption mutants. P1 to P8 refer to priming sites. PCR amplification for identifying the deletion of each target gene was performed using each E. coli BL21 mutant genomic DNA as a template. (A) Salvage pathway gene disruptions. M, size marker; lane 1, deoC and deoB region including deoA (2.0 kb); lane 2, Δ deoC :: cat ::Δ deoB (1.3 kb); lane 3, Δ( deoC-deoB ) (0.4 kb), represented to Δ deoA ; lane 4, tdk (0.6 kb); lane 5, Δ tdk :: cat (1.1 kb); lane 6, Δ tdk (0.2 kb); lane 7, udp (0.7 kb); lane 8, Δ udp :: cat (1.1 kb); lane 9, Δ udp (0.2 kb). The FRT (black bar)-flanked chloramphenicol-resistant gene was amplified by PCR. The linear disruption PCR fragment (gray bar) was transformed into a strain expressing the λ Red recombinase, and then chloramphenicol-resistant transformants were selected. The selective marker was eliminated by FLP recombinase system. (B) ung disruption. Lane 1, ung (0.7 kb); lane 2, Δ ung :: cat (1.1 kb); lane 3, Δ ung (0.2 kb).

    Article Snippet: PCR mixtures containing 1 U thermostable DNA polymerase (Roche Molecular Biomedicals, Basel, Switzerland), 20 mM Tris (pH 8.4), 1.5 mM MgCl2 , 1 μM gene disruption primers, 0.2 mM deoxynucleoside triphosphates, and 0.5 μg ml−1 of plasmid pKD3 were incubated at 94°C for 5 min, followed by 30 cycles at 94°C (45 s), 55°C (45 s), and 72°C (1 min), and followed by a final extension time of 10 min at 72°C.

    Techniques: Polymerase Chain Reaction, Amplification, Mutagenesis, Marker, Transformation Assay, Expressing