Journal: Life Science Alliance

Article Title: The CDKL5 kinase undergoes liquid–liquid phase separation driven by a serine-rich C-terminal region

doi: 10.26508/lsa.202503402

Figure Lengend Snippet: (A) Central upper panel . Super-resolution (Airyscan, Zeiss) confocal fluorescence micrograph of a differentiated NG108-15 neuronal cell expressing CDKL5-GFP. The left , lower middle , and right panels show, respectively, magnified details of the somatic compartment ( s ), the axon (a), and a varicosity ( v ). Note the intra- and extranuclear condensate-like foci ( arrowheads ). Scale bar: 10 μm. The image upper corners have been filled in dark gray for graphical purposes. (B) Neuropil of intermeshed neurites, with varicosities, of NG108-15 cells expressing CDKL5-GFP. Arrowheads indicate condensate-like CDKL5 foci in a varicosity ( left ) and along a neurite ( right ). Scale bar: 10 μm. (C) Two HEK293 cells expressing CDKL5-GFP. Arrowheads indicate condensates. Scale bar: 10 μm. (D) Correlative light and electron microscopy (CLEM) images of a HEK293 cell expressing CDKL5-GFP. The first panel from the left shows a confocal fluorescence image with intranuclear CDKL5-GFP condensates ( green ). The nucleus is stained with DAPI ( blue ), and mitochondria ( white arrow ) are marked by the MitoTracker dye ( red ). The third panel shows an EM image of a cell section at the same level of the confocal fluorescence image. The second panel is an overlay of the fluorescence and EM images. The two fluorescent condensate-like foci are highlighted by arrowheads and correspond to denser areas (boxed in yellow in the EM image) within the nuclear compartment, which are magnified in the two right panels . The MitoTracker signal overlaps with mitochondria, as expected. The two condensates are membraneless, and the larger one has an internal cavity also visible in the fluorescence image (see the Results section). Scale bars: 2.5 μm (larger images), 250 nm (smaller panels). (E) As in panel (D), for cytoplasmic condensate-like foci. The fourth image on the right illustrates a cluster of them (see yellow box in the EM image), two of which ( asterisks ) appear to be coalescing with each other. (D) Scale bars as in panel (D).

Article Snippet: After rinsing with PBS (3x), the cells were incubated with secondary fluorescent antibodies (Jackson ImmunoResearch, anti-rabbit [cat. #711-175-152] or anti-rat [cat. #712-165-153]; 1:1,000 dilution) in PBS containing 3% NDS and 0.5% Triton X-100 for 1 h at RT and rinsed with PBS (3x).

Techniques: Fluorescence, Expressing, Electron Microscopy, Staining

Journal: Life Science Alliance

Article Title: The CDKL5 kinase undergoes liquid–liquid phase separation driven by a serine-rich C-terminal region

doi: 10.26508/lsa.202503402

Figure Lengend Snippet: (A) Representative confocal fluorescence images of HEK293 cells expressing either CDKL5-GFP ( upper row ) or GFP alone ( lower row ) and immunostained to reveal the presence of EB2 ( right column, purple ) or its S222 phosphorylated form (pEB2; left column, cyan ). Calibration bar: 10 μm. Note the strong increase of the pEB2 signal in cells expressing CDKL5-GFP. (B) Representative Western blot of lysates of HEK293 cells expressing either CDKL5-GFP ( left lane ) or GFP alone ( right lane ) to detect the levels of these two exogenous proteins (α-GFP immunoblotting, IB) and the endogenous CDKL5 target protein EB2, as such (α-EB2 IB) or phosphorylated at Ser222 (α-pEB2 IB). Vinculin, a housekeeping protein, was used as a lane loading control (α-vinculin IB). Note how EB2 is considerably more phosphorylated in CDKL5-GFP–expressing cells in comparison with what was observed in GFP-expressing cells. Together with the results shown in panel (A), these findings indicate that the exogenously expressed GFP-tagged kinase is catalytically active and dramatically enhances EB2 phosphorylation in HEK293 cells. (C) As in panel (A), for cells expressing ( green signal) either WT CDKL5, its two indicated disease-related mutants, or GFP alone (control). The cells were immunostained to reveal EB2 (in purple ) and pEB2 (in cyan ). Nuclei are stained using DAPI (in gray ). Images displaying the four merged channels for each construct are shown on the right ( merge ). Scale bar: 10 μm. (D) Bar graph displaying the quantification of the relative proportion of phosphorylated EB2 in the experiments shown in panel (C). Columns report for each group the mean ratio between the pEB2 and EB2 fluorescent intensities in each cell, expressed as variation (Δ) versus the GFP control group and normalized to the WT CDKL5-GFP group. Asterisks indicate statistically significant differences. Note how the relative phosphorylation level of EB2 is significantly lower in cells expressing the two truncated kinases than in cells expressing the full-length CDKL5-GFP kinase. (E) As in panel (B), for lysates of cells expressing either CDKL5-GFP, or one of the indicated GFP-tagged disease-related mutants, or GFP alone as a control. Immunoblotting was performed for each experimental group using α-pEB2 and α-EB2, α-GFP, and α-vinculin (vinc) antibodies. Vinculin was used as a lane loading control. (F) Bar graph displaying the optical density analysis of Western blotting experiments as shown in panel (E). The columns report the ratio of the vinculin-normalized band intensities for pEB2 and EB2, expressed as variation (Δ) versus the GFP control group, normalized to the WT CDKL5-GFP group in each experiment. Asterisks indicate statistically significant differences. Note how, after normalization to the expression level of the housekeeping protein, the relative phosphorylation level of EB2 is lower in cells expressing the two truncated kinases than in cells expressing the full-length CDKL5-GFP kinase. Source data are available for this figure.

Article Snippet: After rinsing with PBS (3x), the cells were incubated with secondary fluorescent antibodies (Jackson ImmunoResearch, anti-rabbit [cat. #711-175-152] or anti-rat [cat. #712-165-153]; 1:1,000 dilution) in PBS containing 3% NDS and 0.5% Triton X-100 for 1 h at RT and rinsed with PBS (3x).

Techniques: Fluorescence, Expressing, Western Blot, Control, Comparison, Phospho-proteomics, Staining, Construct

Journal: eLife

Article Title: A visual pathway for skylight polarization processing in Drosophila

doi: 10.7554/eLife.63225

Figure Lengend Snippet:

Article Snippet: Antibody , Anti-Rat conjugated to Cy5 (goat polyclonal) , Jackson ImmunoResearch , Cat#:112-175-143;RRID: AB_2338263 , (1:300).

Techniques: Full Display Name, Software, Imaging

Journal: Genes & Development

Article Title: Interaction of CCR4–NOT with EBF1 regulates gene-specific transcription and mRNA stability in B lymphopoiesis

doi: 10.1101/gad.285452.116

Figure Lengend Snippet: Cnot3 -deficient mice show impaired early B-cell differentiation that can be alleviated in part by the expression of Mzb1 . ( A ) Flow cytometric analysis of bone marrow B cells in Cnot3 +/+ RERT Cre and Cnot3 fl/fl RERT Cre mice to detect B220 + CD43 + pro-B, B220 int CD43 − late pre-B, and immature B cells as well as B220 hi CD43 − recirculating B cells in the living lymphocyte gate. ( B ) Further gating of pro-B cells to detect pre-pro-B (HSA − BP1 − ), early pro-B (HSA + BP1 − ) and late pro-B (HSA + BP1 + ) cells. ( C ) Statistical analysis of the total numbers of pro-B (pink) and pre-B (red) cells in Cnot3 +/+ RERT Cre (wild-type) and Cnot3 fl/fl RERT Cre (knockout) mice. Long horizontal bars indicate the mean, and short horizontal bars represent the SD of the mean. Statistical significance between wild type and knockout is assessed by an unpaired two-tail Student's t -test. ( D ) PCR analysis of genomic DNA from Cnot3 +/+ RERT Cre and Cnot3 fl/fl RERT Cre mice to detect the deletion status of Cnot3 . Cnot6 served as a loading control. ( E ) Flow cytometric analysis of splenic B cells to detect CD21 int CD23 + follicular B cells and CD21 hi CD23 − marginal zone B cells in Cnot3 +/+ RERT Cre and Cnot3 fl/fl RERT Cre mice. ( F ) Flow cytometric analysis of bone marrow cells in Cnot3 +/+ mb1 Cre and Cnot3 fl/fl mb1 Cre mice to detect the B-cell compartment as described in A . ( G ) Flow cytometric analysis of the effects of a Mzb1 transgene expression ( Mzb1 tg ) on early B-cell differentiation in Cnot3 +/+ mb1 Cre and Cnot3 fl/fl mb1 Cre mice. ( H , I ) Gating of bone marrow B220 + CD43 + pro-B cells to detect HSA + BP1 − early pro-B and HSA + BP1 + late pro-B stages. ( J , K ) Statistical analysis of the total numbers of pre-B (red), recirculating B (blue), early pro-B (orange), and late pro-B (green) cells in Cnot3 +/+ mb1 Cre , Cnot3 fl/fl mb1 Cre , Cnot3 +l+ mb1 Cre Mzb1 tg , and Cnot3 fl/fl mb1 Cre Mzb1 tg mice. Numbers in the FACS profiles indicate the percentage of cells within the gated population. The data are representative of four or more independent experiments.

Article Snippet: Anti-CD19 (1D3), BP1 (BP-1), CD25 (PC61) HSA (M1/69), CD43 (R2/60), B220 (RA-6B2), CD93 (AA4.1), CD23 (B3B4), CD21 (7G6), and α-IgMμ (Jackson ImmunoResearch, #115–175-075) were used.

Techniques: Cell Differentiation, Expressing, Knock-Out, Control

Journal:

Article Title: In vitro cloning of complex mixtures of DNA on microbeads: Physical separation of differentially expressed cDNAs

doi:

Figure Lengend Snippet: Model system for two-color competitive hybridization. A 34-mer, ggagatttgataaagtttgatgtgtaatagaggg, was synthesized with a 3′ FAM or Cy5 label. The oligonucleotides were brought to final concentration of 14 μM in 30 μl. The two labeled oligonucleotides were combined in nine separate mixtures in ratios of 1:0, 8:1, 4:1, 2:1, 1:1, 1:2, 1:4, 1:8, and 0:1. Hybridization of each mixture to 100,000 microbeads bearing the complementary oligonucleotide was performed, and 10,000 microbeads from each of the mixtures were analyzed with a Coulter Elite Flow Cytometer using 488-nm and 633-nm lasers.

Article Snippet: Thirty-five rounds of linear amplification with either R110 dUTP (Perkin–Elmer) or Cy5 dUTP (Amersham Pharmacia) were performed.

Techniques: Hybridization, Synthesized, Concentration Assay, Labeling, Flow Cytometry

Journal:

Article Title: In vitro cloning of complex mixtures of DNA on microbeads: Physical separation of differentially expressed cDNAs

doi:

Figure Lengend Snippet: A reference library of 2,000,000 microbeads was formed by mixing equal numbers of microbeads with attached cDNA derived from induced and noninduced THP-1 cells. Reference microbeads (100,000) were hybridized with 10 μg each of Cy5-labeled probe and R110-labeled probe, both derived from the same induced library to yield A. Microbeads (1,600,000) were hybridized with 10 μg of Cy5-labeled probe from the induced library and 10 μg of R110-labeled probe derived from the noninduced library to yield B.

Article Snippet: Thirty-five rounds of linear amplification with either R110 dUTP (Perkin–Elmer) or Cy5 dUTP (Amersham Pharmacia) were performed.

Techniques: Derivative Assay, Labeling