cxcr2 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher cxcr1
    <t>CXCR1/2</t> receptors blockade with SCH 527123 antagonist prevent contact-dependent cell death . (A) Gating strategy for neutrophil and HepG2/HepG2.2.15 coculture. For coculture experiments, neutrophils were isolated from health subjects and patient groups ( n = 15). During quantification of cell death, neutrophils were excluded during flow cytometry analysis and only HepG2 and HepG2.2.15 cells were analyzed. (B) Coculture of HepG2 and HepG2.2.15 cells with increasing no. of neutrophils resulted in significant contact-dependent cell death of HepG2 and HepG2.2.15 cells through apoptosis and necrosis. (C) In liver tissue, hepatocytes showed intense caspase-3 and receptor-interacting protein kinase 3 (RIP-3) staining in acute-on-chronic liver failure (ACLF) (magnification: 20×). (D) In IHC staining, mean intensity score caspase-3 and RIP-3 was higher in ACLF groups than CHB. (E) RT-PCR data revealed high relative mRNA expression of caspase-3 and RIP-3 in ACLF. (F) CXCR1/2 blockade with SCH 527123 antagonist resulted in significant reduction of apoptotic (annexin V-positive cells) and necrotic (PI-positive cells) cell death.
    Cxcr1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 56 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr1/product/Thermo Fisher
    Average 99 stars, based on 56 article reviews
    Price from $9.99 to $1999.99
    cxcr1 - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Millipore anti cxcr2 antibody
    CXCL5 recruits macrophages to the gastrointestinal tract during inflammatory mucosal injury in mouse pups. A : intestinal macrophages express <t>CXCR2,</t> the cognate receptor for CXCL5. Fluorescence photomicrographs (×1,000) show CXCR2 staining on intestinal
    Anti Cxcr2 Antibody, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti cxcr2 antibody/product/Millipore
    Average 99 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    anti cxcr2 antibody - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    cxcr2  (Abcam)
    99
    Abcam cxcr2
    Cellular localization of <t>CXCR2</t> expression in vlPAG after BCP. Immunofluorescence triple staining of CXCR2 ( a , f , k ), GFAP ( g ), Neun ( l ), CD11 ( b ), and DAPI in vlPAG at day 6 after BCP show that all glial cells and neurons express DAPI + cells ( d , i , n ). Scale bar in ( k ): 100 μm. Immunofluorescence triple staining of high-magnification images, indicated in the white boxes of ( c , h , m , d , i , n ), mainly mainly co-localized with Neun ( o ), but not with astrocyte ( j ) and microglia ( e ). Scale bar in ( o ): 20 μm. Aq, aqueduct. n = 4
    Cxcr2, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 253 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2/product/Abcam
    Average 99 stars, based on 253 article reviews
    Price from $9.99 to $1999.99
    cxcr2 - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    90
    R&D Systems apc conjugated cxcr 2
    FACS analysis data representative for each investigated group: healthy volunteers ( a - e ), ICU controls ( f - j ) and septic patients ( k - o ); histograms show the percentage of CXCR-4, <t>CXCR-2,</t> c-Kit, RAGE and PSGL-1 expression in the population of CD34/CD133-positive cells. The dotted line in histograms represents the negative control. <t>APC</t> , allophycocyanin; FITC , fluorescein; PE , phycoerythrin; CXCR-4 , CXC-motive-chemokine receptor 4; c-Kit , tyrosine kinase KIT; CXCR-2 , CXC-motive-chemokine receptor 2; RAGE , receptor for advanced glycation products; PSGL-1 , P-selectin ligand 1
    Apc Conjugated Cxcr 2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/apc conjugated cxcr 2/product/R&D Systems
    Average 90 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    apc conjugated cxcr 2 - by Bioz Stars, 2020-03
    90/100 stars
      Buy from Supplier

    99
    Biorbyt cxcr2
    Immunohistochemical Expression of CXCL8, CXCR1 and <t>CXCR2</t> in GBM and Diffuse Astrocytoma. Image Resolution Is X400.
    Cxcr2, supplied by Biorbyt, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2/product/Biorbyt
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    cxcr2 - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Abcam anti cxcr2
    <t>CXCR2</t> and CXCL2 expression in mouse colon tissues. CXCR2 ( A ) and CXCL1 , CXCL2 , CXCL3 , and CXCL5 ( B ) mRNA expression in the colons of the two groups sacrificed at the indicated times was assessed by quantitative RT-PCR. Each value represents mean ± SD (n = 7 mice/group). *p
    Anti Cxcr2, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 50 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti cxcr2/product/Abcam
    Average 99 stars, based on 50 article reviews
    Price from $9.99 to $1999.99
    anti cxcr2 - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    97
    Boster Bio cxcr2 primary antibody
    SNL induces <t>CXCR2</t> upregulation in spinal cord neurons. CXCR2 is expressed in the spinal cord of naïve animals (A) and increased at 3 d after SNL (B). Scale bar, 100 μm. B. Western blot shows the expression of CXCR2 in the spinal cord in
    Cxcr2 Primary Antibody, supplied by Boster Bio, used in various techniques. Bioz Stars score: 97/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2 primary antibody/product/Boster Bio
    Average 97 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    cxcr2 primary antibody - by Bioz Stars, 2020-03
    97/100 stars
      Buy from Supplier

    99
    Abcam anti cxcr1 antibody
    Immunostaining of candidate genes. ( A , B ) Presentative IHC images of <t>CXCR1</t> and ARID3B with different ( A ) 100X; ( B ) 400X. ( C ) Statistical analysis of the immunohistochemistry results for CXCR1 and ARID3B. Student t-test, *p
    Anti Cxcr1 Antibody, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti cxcr1 antibody/product/Abcam
    Average 99 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    anti cxcr1 antibody - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    91
    Tocris rats nvp cxcr2 20
    Immunostaining of candidate genes. ( A , B ) Presentative IHC images of <t>CXCR1</t> and ARID3B with different ( A ) 100X; ( B ) 400X. ( C ) Statistical analysis of the immunohistochemistry results for CXCR1 and ARID3B. Student t-test, *p
    Rats Nvp Cxcr2 20, supplied by Tocris, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rats nvp cxcr2 20/product/Tocris
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rats nvp cxcr2 20 - by Bioz Stars, 2020-03
    91/100 stars
      Buy from Supplier

    95
    Abcam rabbit anti cxcr2
    <t>CXCR1/2</t> antagonism by G31P inhibits NSCLC cell proliferation A. cells were treated with G31P (at concentrations of 0, 1, 10, 50, and 100 ng/ml) for 48 h. Cell proliferation was measured by CCK8 assay at 450 nm. G31P at 100 ng/ml showed significant inhibition of growth, (*, p
    Rabbit Anti Cxcr2, supplied by Abcam, used in various techniques. Bioz Stars score: 95/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit anti cxcr2/product/Abcam
    Average 95 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    rabbit anti cxcr2 - by Bioz Stars, 2020-03
    95/100 stars
      Buy from Supplier

    77
    Millipore cxcr2 inhibition cxcr2 inhibitor sb255002
    <t>CXCR1/2</t> antagonism by G31P inhibits NSCLC cell proliferation A. cells were treated with G31P (at concentrations of 0, 1, 10, 50, and 100 ng/ml) for 48 h. Cell proliferation was measured by CCK8 assay at 450 nm. G31P at 100 ng/ml showed significant inhibition of growth, (*, p
    Cxcr2 Inhibition Cxcr2 Inhibitor Sb255002, supplied by Millipore, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2 inhibition cxcr2 inhibitor sb255002/product/Millipore
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cxcr2 inhibition cxcr2 inhibitor sb255002 - by Bioz Stars, 2020-03
    77/100 stars
      Buy from Supplier

    78
    Millipore cxcr2 antagonist treatment cxcr2 antagonist sb225002
    Effect of <t>CXCR2</t> downregulation and inhibition In vitro (A-B) properties of shRNA clones (clone-1 and -3) compared to scrambled control: (A) mRNA expression by reverse-transcription PCR relative to standard, (B) invasion assay using co-cultures with cancer-associated fibroblasts (CAF) and mitomycin C to block tumor cell proliferation. In vitro CXCR2 inhibition with CXCR2-antagonist (C, D): invasion assay using co-cultures of 344P (C) and 344SQ (D) cell lines treated with increasing concentrations of <t>SB225002.</t> In vivo properties of shRNA clones (clone-1 and -3) compared to scrambled control (E, F): number of left lung tumor nodules, (E) number of distant metastases (F). Median and inter-quartile range are shown in the dot plots (E, F). Wilcoxon rank sum test (A, B, E, and F) between scrambled control and shRNA single clones (clone-1 and clone-3) or between different concentrations of SB225002and the control (C, D).
    Cxcr2 Antagonist Treatment Cxcr2 Antagonist Sb225002, supplied by Millipore, used in various techniques. Bioz Stars score: 78/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2 antagonist treatment cxcr2 antagonist sb225002/product/Millipore
    Average 78 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    cxcr2 antagonist treatment cxcr2 antagonist sb225002 - by Bioz Stars, 2020-03
    78/100 stars
      Buy from Supplier

    99
    BioLegend cxcr2 apc
    Effect of <t>CXCR2</t> downregulation and inhibition In vitro (A-B) properties of shRNA clones (clone-1 and -3) compared to scrambled control: (A) mRNA expression by reverse-transcription PCR relative to standard, (B) invasion assay using co-cultures with cancer-associated fibroblasts (CAF) and mitomycin C to block tumor cell proliferation. In vitro CXCR2 inhibition with CXCR2-antagonist (C, D): invasion assay using co-cultures of 344P (C) and 344SQ (D) cell lines treated with increasing concentrations of <t>SB225002.</t> In vivo properties of shRNA clones (clone-1 and -3) compared to scrambled control (E, F): number of left lung tumor nodules, (E) number of distant metastases (F). Median and inter-quartile range are shown in the dot plots (E, F). Wilcoxon rank sum test (A, B, E, and F) between scrambled control and shRNA single clones (clone-1 and clone-3) or between different concentrations of SB225002and the control (C, D).
    Cxcr2 Apc, supplied by BioLegend, used in various techniques. Bioz Stars score: 99/100, based on 79 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2 apc/product/BioLegend
    Average 99 stars, based on 79 article reviews
    Price from $9.99 to $1999.99
    cxcr2 apc - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    79
    Millipore cxcr2 inhibitor
    Effect of <t>CXCR2</t> downregulation and inhibition In vitro (A-B) properties of shRNA clones (clone-1 and -3) compared to scrambled control: (A) mRNA expression by reverse-transcription PCR relative to standard, (B) invasion assay using co-cultures with cancer-associated fibroblasts (CAF) and mitomycin C to block tumor cell proliferation. In vitro CXCR2 inhibition with CXCR2-antagonist (C, D): invasion assay using co-cultures of 344P (C) and 344SQ (D) cell lines treated with increasing concentrations of <t>SB225002.</t> In vivo properties of shRNA clones (clone-1 and -3) compared to scrambled control (E, F): number of left lung tumor nodules, (E) number of distant metastases (F). Median and inter-quartile range are shown in the dot plots (E, F). Wilcoxon rank sum test (A, B, E, and F) between scrambled control and shRNA single clones (clone-1 and clone-3) or between different concentrations of SB225002and the control (C, D).
    Cxcr2 Inhibitor, supplied by Millipore, used in various techniques. Bioz Stars score: 79/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2 inhibitor/product/Millipore
    Average 79 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    cxcr2 inhibitor - by Bioz Stars, 2020-03
    79/100 stars
      Buy from Supplier

    92
    Tocris cxcr2 antagonist
    Systemic inhibition of <t>CXCR2</t> results in functional improvement in MOG 35-55 peptide induced EAE animals (A) Injection of MOG 35-55 peptide induces a robust functional deficit after 7-10 days that plateaus in the 2 nd week (circles). Systemic daily delivery of CXCR2 inhibitor (20ng/kg) results in a slowing of disease progression and functional recovery that is maintained with continuous treatment (squares). Data represent mean clinical scores for 12 animals from 3 separate studies. Luxol fast blue staining on transverse spinal cord sections showed areas of demyelination in control EAE animals (B) that were significantly reduced in animals treated with CXCR2 antagonists (C). Control EAE animals showed significant cellular infiltrates in areas of demyelination (D) that were reduced in animals treated with CXCR2 antagonists (E). Quantitation of the relative lesion load in the spinal cord of control EAE animals and CXCR2 antagonist treated animals at day 28 after immunization (F). Data represents the mean +/− standard deviation taken from 20 Luxol stained sections from each of 4 animals in each group. p= 0.0001. Bar = 100μm in B and C and 50μm in D and E.
    Cxcr2 Antagonist, supplied by Tocris, used in various techniques. Bioz Stars score: 92/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2 antagonist/product/Tocris
    Average 92 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    cxcr2 antagonist - by Bioz Stars, 2020-03
    92/100 stars
      Buy from Supplier

    97
    Millipore cxcr2 antagonist
    A novel mechanism underlying the contribution of primary tumor to pre-metastatic niche formation and liver metastasis Primary malignant cell-secreted VEGF-A stimulates primary tumor-associated macrophages to produce CXCL1 that recruits <t>CXCR2-positive</t> MDSCs from circulatory system into pre-metastatic liver. MDSCs in pre-metastatic liver promote liver metastases via induction of cancer cell survival in a mouse orthotopic model of CRC.
    Cxcr2 Antagonist, supplied by Millipore, used in various techniques. Bioz Stars score: 97/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2 antagonist/product/Millipore
    Average 97 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    cxcr2 antagonist - by Bioz Stars, 2020-03
    97/100 stars
      Buy from Supplier

    90
    Thermo Fisher anti cxcr2 polyclonal antibodies
    A novel mechanism underlying the contribution of primary tumor to pre-metastatic niche formation and liver metastasis Primary malignant cell-secreted VEGF-A stimulates primary tumor-associated macrophages to produce CXCL1 that recruits <t>CXCR2-positive</t> MDSCs from circulatory system into pre-metastatic liver. MDSCs in pre-metastatic liver promote liver metastases via induction of cancer cell survival in a mouse orthotopic model of CRC.
    Anti Cxcr2 Polyclonal Antibodies, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti cxcr2 polyclonal antibodies/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti cxcr2 polyclonal antibodies - by Bioz Stars, 2020-03
    90/100 stars
      Buy from Supplier

    78
    The Jackson Laboratory cxcr2 receptor
    Lack of effect of deletion of <t>CXCR2</t> receptors on changes in lymphatics and blood vessels induced by IL-1β overexpression. Tracheal whole mounts from CCSP/IL-1β bi-transgenic mice ( A ) and CCSP/IL-1β/CXCR2 −/− triple-transgenic
    Cxcr2 Receptor, supplied by The Jackson Laboratory, used in various techniques. Bioz Stars score: 78/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2 receptor/product/The Jackson Laboratory
    Average 78 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    cxcr2 receptor - by Bioz Stars, 2020-03
    78/100 stars
      Buy from Supplier

    99
    Abcam phosphorylated cxcr2
    A <t>CXCR2</t> antagonist SB625610 significantly abrogates mammary cancer cell line migration. (A) Representative photomicrographs of PyMT-Luc cell migration to MSC-CM in the presence or absence of SB625610 (1μM). (B) Analysis of PyMT-Luc migration in
    Phosphorylated Cxcr2, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphorylated cxcr2/product/Abcam
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    phosphorylated cxcr2 - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    80
    R&D Systems cxcr2 antagonist
    Resting <t>CXCR2</t> KO mice show limited differences in neutrophil, mast cell, macrophage, eosinophil or blood vessel numbers in subcutaneous fat . Skin was dissected from adult female mice before processing and staining (scale bars: 50 μm) to detect (A) neutrophils, (B) mast cells, (C) macrophages, and (D) von Willebrand factor positive vessels from wild‐type and CXCR2 KO mice. (E) The numbers of mast cells (i), macrophages (ii), and blood vessels (iii) were quantified and plotted as the mean number per field of view. (F) (i) Mast cell and (ii) macrophage numbers were also expressed as ratio of cell number to adipocyte number. (G and H) Flow cytometry was used to analyze leukocyte content of skin, inguinal WAT, and perigonadal WAT. (G) CXCR2 positive staining in CD45+CD11b+Ly6G+ cells from skin samples. (H) Quantification of neutrophil (CD45+CD11b+Ly6g+), macrophage (CD45+CD11b+SiglecF‐F4/80+), eosinophil (CD45+CD11b+F480+SiglecF+) and mast cell (CD45+CD117+) content of skin, inguinal WAT, and perigonadal WAT. Data are plotted as mean (± sem ), where each symbol represents data from an individual mouse and analyzed using an unpaired t test, representative of two separate experiments (A‐F), ns = not significant
    Cxcr2 Antagonist, supplied by R&D Systems, used in various techniques. Bioz Stars score: 80/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2 antagonist/product/R&D Systems
    Average 80 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    cxcr2 antagonist - by Bioz Stars, 2020-03
    80/100 stars
      Buy from Supplier

    cxcr1  (Bioss)
    90
    Bioss cxcr1
    Mouse lung staining for <t>CXCR1</t> (A,C,E,G) and CXCR2 (B,D,F,H). Both receptors were clearly expressed in alveolar epithelium, bronchial epithelium, and alveolar macrophages. Levels of both receptors in Saline (A,B) appeared reduced in G31P treated animals
    Cxcr1, supplied by Bioss, used in various techniques. Bioz Stars score: 90/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr1/product/Bioss
    Average 90 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    cxcr1 - by Bioz Stars, 2020-03
    90/100 stars
      Buy from Supplier

    79
    R&D Systems cxcr 2 r d systems antibodies
    Mouse lung staining for <t>CXCR1</t> (A,C,E,G) and CXCR2 (B,D,F,H). Both receptors were clearly expressed in alveolar epithelium, bronchial epithelium, and alveolar macrophages. Levels of both receptors in Saline (A,B) appeared reduced in G31P treated animals
    Cxcr 2 R D Systems Antibodies, supplied by R&D Systems, used in various techniques. Bioz Stars score: 79/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr 2 r d systems antibodies/product/R&D Systems
    Average 79 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    cxcr 2 r d systems antibodies - by Bioz Stars, 2020-03
    79/100 stars
      Buy from Supplier

    88
    BioLegend pe cxcr2
    Recombinant human milk fat globule-epidermal growth factor-factor 8 (rhMFG-E8) regulates <t>CXCR2</t> and G protein-coupled receptor kinase 2 (GRK2) expression through the p38 and ERK pathways. (A) Differentiated HL-60 (dHL-60) cells were placed into 1.5 ml microfuge tubes at a density of 1.5×10 6 cells/ml of Opti-MEM. The cells were then pre-treated with the p38 inhibitor, SB203580, of the ERK inhibitor, PD98059, at a concentration of 10 µ M of each for 1 h at 37°C. Following incubation, the cells were then stimulated with rhMFG-E8 (500 ng/ml) or PBS for 2 h followed by the assessment of CXCR2 by flow cytometry. Mean fluorescence intensities (MFI) obtained from 3 independent experiments are plotted into the bar diagram. * P
    Pe Cxcr2, supplied by BioLegend, used in various techniques. Bioz Stars score: 88/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pe cxcr2/product/BioLegend
    Average 88 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    pe cxcr2 - by Bioz Stars, 2020-03
    88/100 stars
      Buy from Supplier

    86
    R&D Systems pe cxcr2
    Recombinant human milk fat globule-epidermal growth factor-factor 8 (rhMFG-E8) regulates <t>CXCR2</t> and G protein-coupled receptor kinase 2 (GRK2) expression through the p38 and ERK pathways. (A) Differentiated HL-60 (dHL-60) cells were placed into 1.5 ml microfuge tubes at a density of 1.5×10 6 cells/ml of Opti-MEM. The cells were then pre-treated with the p38 inhibitor, SB203580, of the ERK inhibitor, PD98059, at a concentration of 10 µ M of each for 1 h at 37°C. Following incubation, the cells were then stimulated with rhMFG-E8 (500 ng/ml) or PBS for 2 h followed by the assessment of CXCR2 by flow cytometry. Mean fluorescence intensities (MFI) obtained from 3 independent experiments are plotted into the bar diagram. * P
    Pe Cxcr2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 86/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pe cxcr2/product/R&D Systems
    Average 86 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    pe cxcr2 - by Bioz Stars, 2020-03
    86/100 stars
      Buy from Supplier

    89
    Becton Dickinson cxcr2 pe
    Angiotensin II promotes myeloid-derived <t>CXCR2-positive</t> cells. A , Flow cytometry analysis of CD45 + CXCR2 + cells in aortic samples before and after angiotensin II infusion at day 1, 3, 7, and 14 ( top ). The percentage of CD45 + CXCR2 + cells was shown as the histogram ( bottom ). B , Aortic mRNA level of CXCR2 was measured by quantitative real-time polymerase chain reaction (qPCR) after saline and angiotensin II infusion for 14 days. C , Immunohistochemical staining of the CXCR2-positive cells in aortic sections. Arrows indicate the CXCR2-positive cells. Scale bar, 50 μm. * P
    Cxcr2 Pe, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 89/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2 pe/product/Becton Dickinson
    Average 89 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    cxcr2 pe - by Bioz Stars, 2020-03
    89/100 stars
      Buy from Supplier

    96
    Proteintech rabbit cxcr2 polyclonal
    Angiotensin II promotes myeloid-derived <t>CXCR2-positive</t> cells. A , Flow cytometry analysis of CD45 + CXCR2 + cells in aortic samples before and after angiotensin II infusion at day 1, 3, 7, and 14 ( top ). The percentage of CD45 + CXCR2 + cells was shown as the histogram ( bottom ). B , Aortic mRNA level of CXCR2 was measured by quantitative real-time polymerase chain reaction (qPCR) after saline and angiotensin II infusion for 14 days. C , Immunohistochemical staining of the CXCR2-positive cells in aortic sections. Arrows indicate the CXCR2-positive cells. Scale bar, 50 μm. * P
    Rabbit Cxcr2 Polyclonal, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit cxcr2 polyclonal/product/Proteintech
    Average 96 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    rabbit cxcr2 polyclonal - by Bioz Stars, 2020-03
    96/100 stars
      Buy from Supplier

    95
    Thermo Fisher snp cxcr2 c 8841198 10
    Angiotensin II promotes myeloid-derived <t>CXCR2-positive</t> cells. A , Flow cytometry analysis of CD45 + CXCR2 + cells in aortic samples before and after angiotensin II infusion at day 1, 3, 7, and 14 ( top ). The percentage of CD45 + CXCR2 + cells was shown as the histogram ( bottom ). B , Aortic mRNA level of CXCR2 was measured by quantitative real-time polymerase chain reaction (qPCR) after saline and angiotensin II infusion for 14 days. C , Immunohistochemical staining of the CXCR2-positive cells in aortic sections. Arrows indicate the CXCR2-positive cells. Scale bar, 50 μm. * P
    Snp Cxcr2 C 8841198 10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snp cxcr2 c 8841198 10/product/Thermo Fisher
    Average 95 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    snp cxcr2 c 8841198 10 - by Bioz Stars, 2020-03
    95/100 stars
      Buy from Supplier

    82
    BioLegend cxcr2 pe
    Age reduces expression of receptors and ligand required for proper neutrophil clearance. Neutrophils isolated from the blood of naïve young and aged mice were stained for neutrophil identification markers (CD45 + /CD11b + /Ly6C Int /Ly6G Hi ), surface chemokine receptors <t>CXCR2</t> ( A ), CXCR4 ( B ) and the adhesion molecules L-selectin ( C ) and CD44 ( D ). Serum was taken from young (3 month) or aged (22 month) old animals 24 hours following sham or stroke surgery. n=7-12 animals/group. CXCL12 and CXCL2 were measured via multiplex ( E ). Two-way ANOVA was performed, followed by individual T-Tests with Sidak’s correction. ( F ) A schematic figure of the differential roles of CXCL12 and CXCL2 in circulating neutrophil homeostasis. *p≤0.05, **p=
    Cxcr2 Pe, supplied by BioLegend, used in various techniques. Bioz Stars score: 82/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2 pe/product/BioLegend
    Average 82 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    cxcr2 pe - by Bioz Stars, 2020-03
    82/100 stars
      Buy from Supplier

    99
    Thermo Fisher anti cxcr2 phycoerythrin
    Neutrophil changes in response to 10 weeks of high-intensity interval training (HIIT). Representative flow cytometric histograms showing ( a ) improved neutrophil phagocytosis of Escherichia coli , ( b ) phagocytic capacity, ( c ) representative diagram of the kinetic phorbol 12-myristate 13-acetate-stimulated ROS production, and ( d ) ROS generation (AUC) and neutrophil surface receptor expression pre- and post-HIIT training for ( e ) CXC chemokine receptor 2 <t>(CXCR2),</t> ( f ) cluster of differentiation 11b (CD11b)/CD18, ( g ) Toll-like receptor 4 (TLR4), and ( h ) CD16. All data are mean ± SEM ( n = 12). MFI Median fluorescence intensity
    Anti Cxcr2 Phycoerythrin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti cxcr2 phycoerythrin/product/Thermo Fisher
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    anti cxcr2 phycoerythrin - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    BioLegend cxcr2
    Effects of <t>CXCR2</t> or CXCL1 deficiency on the expression of P-selectin, E-selectin, and adhesion molecules in vivo and on BBB permeability. a The protein expression of P-selectin, E-selectin, VCAM-1, and ICAM-1 (4 h after i.c.v. saline injection) in the saline-treated control group of WT mice and LPS-treated (4 h after i.c.v. LPS injection) WT, CXCR2 −/− , and CXCL1 −/− mice was determined via Western blot analysis. Effects of CXCR2 or CXCL1 deficiency on P-selectin ( b ), VCAM-1 ( c ), and ICAM-1 ( d ) expression in the brain. e Western blotting analysis of the albumin levels in the brains of WT and CXCR2 −/− mice 4, 12, and 24 h after the intraventricular injection of LPS was performed. Optical densities were determined using a computer imaging analysis system. n = 5 mice per group. ** P
    Cxcr2, supplied by BioLegend, used in various techniques. Bioz Stars score: 99/100, based on 189 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cxcr2/product/BioLegend
    Average 99 stars, based on 189 article reviews
    Price from $9.99 to $1999.99
    cxcr2 - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    CXCR1/2 receptors blockade with SCH 527123 antagonist prevent contact-dependent cell death . (A) Gating strategy for neutrophil and HepG2/HepG2.2.15 coculture. For coculture experiments, neutrophils were isolated from health subjects and patient groups ( n = 15). During quantification of cell death, neutrophils were excluded during flow cytometry analysis and only HepG2 and HepG2.2.15 cells were analyzed. (B) Coculture of HepG2 and HepG2.2.15 cells with increasing no. of neutrophils resulted in significant contact-dependent cell death of HepG2 and HepG2.2.15 cells through apoptosis and necrosis. (C) In liver tissue, hepatocytes showed intense caspase-3 and receptor-interacting protein kinase 3 (RIP-3) staining in acute-on-chronic liver failure (ACLF) (magnification: 20×). (D) In IHC staining, mean intensity score caspase-3 and RIP-3 was higher in ACLF groups than CHB. (E) RT-PCR data revealed high relative mRNA expression of caspase-3 and RIP-3 in ACLF. (F) CXCR1/2 blockade with SCH 527123 antagonist resulted in significant reduction of apoptotic (annexin V-positive cells) and necrotic (PI-positive cells) cell death.

    Journal: Frontiers in Immunology

    Article Title: Blockade of Neutrophil’s Chemokine Receptors CXCR1/2 Abrogate Liver Damage in Acute-on-Chronic Liver Failure

    doi: 10.3389/fimmu.2017.00464

    Figure Lengend Snippet: CXCR1/2 receptors blockade with SCH 527123 antagonist prevent contact-dependent cell death . (A) Gating strategy for neutrophil and HepG2/HepG2.2.15 coculture. For coculture experiments, neutrophils were isolated from health subjects and patient groups ( n = 15). During quantification of cell death, neutrophils were excluded during flow cytometry analysis and only HepG2 and HepG2.2.15 cells were analyzed. (B) Coculture of HepG2 and HepG2.2.15 cells with increasing no. of neutrophils resulted in significant contact-dependent cell death of HepG2 and HepG2.2.15 cells through apoptosis and necrosis. (C) In liver tissue, hepatocytes showed intense caspase-3 and receptor-interacting protein kinase 3 (RIP-3) staining in acute-on-chronic liver failure (ACLF) (magnification: 20×). (D) In IHC staining, mean intensity score caspase-3 and RIP-3 was higher in ACLF groups than CHB. (E) RT-PCR data revealed high relative mRNA expression of caspase-3 and RIP-3 in ACLF. (F) CXCR1/2 blockade with SCH 527123 antagonist resulted in significant reduction of apoptotic (annexin V-positive cells) and necrotic (PI-positive cells) cell death.

    Article Snippet: Sections were incubated overnight with primary anti-human antibodies for CXCR1, CXCR2 (eBioscience USA, 1:50 dilution) (GeneTex USA, 1:50 dilution), caspase-3 (GeneTex; USA, 1:50 dilution) and receptor-interacting protein kinase 3 (RIP-3) at 4°, washed twice with TBS, and 30 µl of polymer super enhancer (secondary antibody) (SuperSensitive™ Polymer-HRP IHC Detection System/DAB large volume Biogenex, USA) was applied for 20–30 min at room temperature in a humid chamber.

    Techniques: Isolation, Flow Cytometry, Cytometry, Staining, Immunohistochemistry, Reverse Transcription Polymerase Chain Reaction, Expressing

    Mechanism of neutrophil-mediated liver damage in ACLF . Induction of neutrophils by virus (HBV) or alcohol leads to hyper activation resulting in increased CXCR1/2. Neutrophil then migrate toward liver where they contact to hepatocytes in CXCR1/2-dependent mechanism and induce cell death. High CXCR1/2 increases the production of reactive oxygen species (ROS) and pro-inflammatory cytokines which leads to protracted inflammation, tissue destruction, and ultimately organ dysfunction. Blockade of CXCR1/2 not only reduced contact-dependent cell death but also abridged production of ROS and pro-inflammatory mediators, thereby decreasing the inflammatory response and liver damage.

    Journal: Frontiers in Immunology

    Article Title: Blockade of Neutrophil’s Chemokine Receptors CXCR1/2 Abrogate Liver Damage in Acute-on-Chronic Liver Failure

    doi: 10.3389/fimmu.2017.00464

    Figure Lengend Snippet: Mechanism of neutrophil-mediated liver damage in ACLF . Induction of neutrophils by virus (HBV) or alcohol leads to hyper activation resulting in increased CXCR1/2. Neutrophil then migrate toward liver where they contact to hepatocytes in CXCR1/2-dependent mechanism and induce cell death. High CXCR1/2 increases the production of reactive oxygen species (ROS) and pro-inflammatory cytokines which leads to protracted inflammation, tissue destruction, and ultimately organ dysfunction. Blockade of CXCR1/2 not only reduced contact-dependent cell death but also abridged production of ROS and pro-inflammatory mediators, thereby decreasing the inflammatory response and liver damage.

    Article Snippet: Sections were incubated overnight with primary anti-human antibodies for CXCR1, CXCR2 (eBioscience USA, 1:50 dilution) (GeneTex USA, 1:50 dilution), caspase-3 (GeneTex; USA, 1:50 dilution) and receptor-interacting protein kinase 3 (RIP-3) at 4°, washed twice with TBS, and 30 µl of polymer super enhancer (secondary antibody) (SuperSensitive™ Polymer-HRP IHC Detection System/DAB large volume Biogenex, USA) was applied for 20–30 min at room temperature in a humid chamber.

    Techniques: Activation Assay

    High level of CXCL8/IL-8 (CXCR1/2 ligand) in acute-on-chronic liver failure (ACLF) patients . (A) Flow cytometry results showed increased CXCL8/IL-8 production by peripheral neutrophils of ACLF patients compared to chronic hepatitis B (CHB) and healthy controls (HC). (B) Also, in liver, CXCL8/IL-8 relative mRNA expression was markedly upregulated in ACLF groups than CHB. (C) Flow cytometry plot and bar graphs illustrate increased production of other inflammatory cytokines/chemokines (IL-6, IL-17, IL-23, GM-CSF, and CCL-20) in peripheral blood of ACLF [hepatitis B virus (HBV)-ACLF n = 17, alcoholic-ACLF n = 19] compared to CHB ( n = 30) and HC ( n = 18).

    Journal: Frontiers in Immunology

    Article Title: Blockade of Neutrophil’s Chemokine Receptors CXCR1/2 Abrogate Liver Damage in Acute-on-Chronic Liver Failure

    doi: 10.3389/fimmu.2017.00464

    Figure Lengend Snippet: High level of CXCL8/IL-8 (CXCR1/2 ligand) in acute-on-chronic liver failure (ACLF) patients . (A) Flow cytometry results showed increased CXCL8/IL-8 production by peripheral neutrophils of ACLF patients compared to chronic hepatitis B (CHB) and healthy controls (HC). (B) Also, in liver, CXCL8/IL-8 relative mRNA expression was markedly upregulated in ACLF groups than CHB. (C) Flow cytometry plot and bar graphs illustrate increased production of other inflammatory cytokines/chemokines (IL-6, IL-17, IL-23, GM-CSF, and CCL-20) in peripheral blood of ACLF [hepatitis B virus (HBV)-ACLF n = 17, alcoholic-ACLF n = 19] compared to CHB ( n = 30) and HC ( n = 18).

    Article Snippet: Sections were incubated overnight with primary anti-human antibodies for CXCR1, CXCR2 (eBioscience USA, 1:50 dilution) (GeneTex USA, 1:50 dilution), caspase-3 (GeneTex; USA, 1:50 dilution) and receptor-interacting protein kinase 3 (RIP-3) at 4°, washed twice with TBS, and 30 µl of polymer super enhancer (secondary antibody) (SuperSensitive™ Polymer-HRP IHC Detection System/DAB large volume Biogenex, USA) was applied for 20–30 min at room temperature in a humid chamber.

    Techniques: Flow Cytometry, Cytometry, Expressing

    Blocking of CXCR1/2 receptors inhibit production of neutrophil’s inflammatory mediators and reduce cell death . (A) Culture of HepG2 and HepG2.2.15 cells with resting and LPS-activated neutrophil’s supernatant (from ACLF patients) resulted in marked apoptosis and necrosis of both cell types. (B) CXCR1/2 blockade showed significant reduction in inflammatory cytokines/chemokines, including CXCL8/IL-8, IL-6, IL-23, and CCL20. However, GM-CSF and IL-17 was increased. Bar graphs demonstrate cytokines production after LPS stimulation (C) To investigate the effect of CXCR1/2 blockade on reactive oxygen species (ROS) production, cells were stimulated with E. coli for 18 h, and production of ROS was measured. Bar graph illustrates significant reduction in ROS after CXCR1/2 blockade. (D) Immunofluorescence confirmed significant reduction in ROS which started at 3 h completely depleted at 18 h (magnification: 20×) ( n = 15). (E) MFI of ROS was calculated at different time point after CXCR1/2 blockade and shown in bar graph.

    Journal: Frontiers in Immunology

    Article Title: Blockade of Neutrophil’s Chemokine Receptors CXCR1/2 Abrogate Liver Damage in Acute-on-Chronic Liver Failure

    doi: 10.3389/fimmu.2017.00464

    Figure Lengend Snippet: Blocking of CXCR1/2 receptors inhibit production of neutrophil’s inflammatory mediators and reduce cell death . (A) Culture of HepG2 and HepG2.2.15 cells with resting and LPS-activated neutrophil’s supernatant (from ACLF patients) resulted in marked apoptosis and necrosis of both cell types. (B) CXCR1/2 blockade showed significant reduction in inflammatory cytokines/chemokines, including CXCL8/IL-8, IL-6, IL-23, and CCL20. However, GM-CSF and IL-17 was increased. Bar graphs demonstrate cytokines production after LPS stimulation (C) To investigate the effect of CXCR1/2 blockade on reactive oxygen species (ROS) production, cells were stimulated with E. coli for 18 h, and production of ROS was measured. Bar graph illustrates significant reduction in ROS after CXCR1/2 blockade. (D) Immunofluorescence confirmed significant reduction in ROS which started at 3 h completely depleted at 18 h (magnification: 20×) ( n = 15). (E) MFI of ROS was calculated at different time point after CXCR1/2 blockade and shown in bar graph.

    Article Snippet: Sections were incubated overnight with primary anti-human antibodies for CXCR1, CXCR2 (eBioscience USA, 1:50 dilution) (GeneTex USA, 1:50 dilution), caspase-3 (GeneTex; USA, 1:50 dilution) and receptor-interacting protein kinase 3 (RIP-3) at 4°, washed twice with TBS, and 30 µl of polymer super enhancer (secondary antibody) (SuperSensitive™ Polymer-HRP IHC Detection System/DAB large volume Biogenex, USA) was applied for 20–30 min at room temperature in a humid chamber.

    Techniques: Blocking Assay, Immunofluorescence

    Acute-on-chronic liver failure (ACLF) patients have increased neutrophils, which express high CXCR1 and CXCR2 . (A) Representative pseudo color plot indicate the percentage of (i) CD11b and CD16 double positive neutrophils, (ii) expression of CXCR1, and (iii) CXCR2 in peripheral blood. (B,C) Bar graphs demonstrate percentage of neutrophils, CXCR1, and CXCR2 in peripheral blood as well as liver. (D) RT-PCR results indicate intrahepatic relative mRNA expression of CXCR1 and CXCR2. Data are expressed as mean ± SD.

    Journal: Frontiers in Immunology

    Article Title: Blockade of Neutrophil’s Chemokine Receptors CXCR1/2 Abrogate Liver Damage in Acute-on-Chronic Liver Failure

    doi: 10.3389/fimmu.2017.00464

    Figure Lengend Snippet: Acute-on-chronic liver failure (ACLF) patients have increased neutrophils, which express high CXCR1 and CXCR2 . (A) Representative pseudo color plot indicate the percentage of (i) CD11b and CD16 double positive neutrophils, (ii) expression of CXCR1, and (iii) CXCR2 in peripheral blood. (B,C) Bar graphs demonstrate percentage of neutrophils, CXCR1, and CXCR2 in peripheral blood as well as liver. (D) RT-PCR results indicate intrahepatic relative mRNA expression of CXCR1 and CXCR2. Data are expressed as mean ± SD.

    Article Snippet: Sections were incubated overnight with primary anti-human antibodies for CXCR1, CXCR2 (eBioscience USA, 1:50 dilution) (GeneTex USA, 1:50 dilution), caspase-3 (GeneTex; USA, 1:50 dilution) and receptor-interacting protein kinase 3 (RIP-3) at 4°, washed twice with TBS, and 30 µl of polymer super enhancer (secondary antibody) (SuperSensitive™ Polymer-HRP IHC Detection System/DAB large volume Biogenex, USA) was applied for 20–30 min at room temperature in a humid chamber.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction

    Plasma membrane sustenance of Cxcr2 is required for neutrophil dispersal. a Confocal projections of neutrophil distribution in Tg( lyz: Cxcr2-WT-FT) /cxcr2 −/− larvae, Tg( lyz: Cxcr2-ala-FT) /cxcr2 −/− , and Tg( lyz: Cxcr2-chim-FT) /cxcr2 −/− at ~2 hpw. Dashed line indicates occupied wound area (owa). CHT: caudal hematopoietic tissue, VF: ventral fin, W: wound. Scale bar = 32 µm. b Neutrophil speed in relation to distance from the owa. Average speeds per cell per distance bin are shown. n = 558–2651 steps per bin (WT), n = 95–1266 steps per bin (ala), n = 494–2000 steps per bin (chim), and n = 1168–2823 steps per bin for ( cxcr2 −/− ). c Net reverse traffic. n = 6 (WT), n = 9 (ala), n = 8 (chim), n = 11 (−; cxcr2 −/− ) larvae. Kruskal–Wallis test with Dunn’s multiple comparisons test. In b and c , data are from 6 (WT), 9 (ala), 8 (chim), and 11 (−; cxcr2 −/− ) larvae from 3, 4, 3, and 8 imaging sessions, respectively. Cells were analyzed from the start of the movie (~15 mpw) up to 2 hpw. Error bars represent S.E.M. across cell steps (b) or larvae (c). Source data are provided as a Source Data file

    Journal: Nature Communications

    Article Title: Chemokine receptor trafficking coordinates neutrophil clustering and dispersal at wounds in zebrafish

    doi: 10.1038/s41467-019-13107-3

    Figure Lengend Snippet: Plasma membrane sustenance of Cxcr2 is required for neutrophil dispersal. a Confocal projections of neutrophil distribution in Tg( lyz: Cxcr2-WT-FT) /cxcr2 −/− larvae, Tg( lyz: Cxcr2-ala-FT) /cxcr2 −/− , and Tg( lyz: Cxcr2-chim-FT) /cxcr2 −/− at ~2 hpw. Dashed line indicates occupied wound area (owa). CHT: caudal hematopoietic tissue, VF: ventral fin, W: wound. Scale bar = 32 µm. b Neutrophil speed in relation to distance from the owa. Average speeds per cell per distance bin are shown. n = 558–2651 steps per bin (WT), n = 95–1266 steps per bin (ala), n = 494–2000 steps per bin (chim), and n = 1168–2823 steps per bin for ( cxcr2 −/− ). c Net reverse traffic. n = 6 (WT), n = 9 (ala), n = 8 (chim), n = 11 (−; cxcr2 −/− ) larvae. Kruskal–Wallis test with Dunn’s multiple comparisons test. In b and c , data are from 6 (WT), 9 (ala), 8 (chim), and 11 (−; cxcr2 −/− ) larvae from 3, 4, 3, and 8 imaging sessions, respectively. Cells were analyzed from the start of the movie (~15 mpw) up to 2 hpw. Error bars represent S.E.M. across cell steps (b) or larvae (c). Source data are provided as a Source Data file

    Article Snippet: Chemokine receptor internalization assays in early embryos For mRNA production, the pCS2+ plasmids containing the Cxcr1-FT, Cxcr2-FT, Cxcr2-chim-FT, Cxcl8a, and Cxcl8b constructs were linearized and transcribed with an mMessage mMachine SP6 kit (Ambion) followed by polyA addition (Ambion). mCFP template for in vitro transcription was prepared from a Clontech Plasmid containing the cDNA for mCFP (p-ECFP-mem; Catalog #6918-1) and the following primers: Fw: 5′-GGGGATTTAGGTGACACTATAGAAGCCGCCACCATGCTGTGCTGTATGAGA AGAAC-3′, Rv: 5′-TCGCGGCCGCTTTACTTGTACAGCTCGTC-3′.

    Techniques: Imaging

    Receptor internalization limits neutrophil motion at wounds. a Confocal projections of neutrophil distribution in Tg( lyz: Cxcr1-WT-FT) /cxcr1 −/− larvae (WT), Tg( lyz: Cxcr1-ala-FT) /cxcr1 −/− (ala), Tg( lyz: Cxcr1-chim-FT) /cxcr1 −/− (chim) at ~2 hpw. Dashed line indicates occupied wound area (owa). CHT: caudal hematopoietic tissue, VF: ventral fin, W: wound. Scale bar = 32 µm. b Quantification of neutrophil cluster size, n = 8 (WT), n = 6 (ala), and n = 4 (chim) larvae from 3 imaging sessions per condition. One-way ANOVA test with Tukeyʼs multiple comparisons test. c Quantification of speed within the owa. n = 9 (WT), n = 6 (ala), and n = 7 (chim) larvae. One-way ANOVA test with Tukeyʼs multiple comparisons test. d Neutrophil speed in relation to distance from the owa. Average speeds per cell step per distance bin are shown. n = 316–1942 steps per bin (WT), n = 105–706 steps per bin (ala), n = 83–896 steps per bin (chim). e Neutrophil speed in relation to cosine of angle θ . Average speeds per cell per cos θ bin are shown. n = 128–849 steps per bin (WT), n = 22–445 steps per bin (ala), and n = 44–417 steps per bin (chim). f Net reverse traffic. n = 9 (WT), n = 6 (ala), and N = 7 (chim) larvae. Kruskal–Wallis test with Dunn’s multiple comparisons test. g Summary of phenotypes observed in Cxcr1 rescue experiments and their interpretation. PM, plasma membrane. For c – f , data are from 9 (WT), 6 (ala), and 7 (chim) larvae from 3, 6, and 3 imaging sessions, respectively. For all panels, analysis was focused on the post initial arrival window of 1–2 hpw. Error bars represent S.E.M. across cell steps (d,e) or larvae (b,c,f). Source data are provided as a Source Data file

    Journal: Nature Communications

    Article Title: Chemokine receptor trafficking coordinates neutrophil clustering and dispersal at wounds in zebrafish

    doi: 10.1038/s41467-019-13107-3

    Figure Lengend Snippet: Receptor internalization limits neutrophil motion at wounds. a Confocal projections of neutrophil distribution in Tg( lyz: Cxcr1-WT-FT) /cxcr1 −/− larvae (WT), Tg( lyz: Cxcr1-ala-FT) /cxcr1 −/− (ala), Tg( lyz: Cxcr1-chim-FT) /cxcr1 −/− (chim) at ~2 hpw. Dashed line indicates occupied wound area (owa). CHT: caudal hematopoietic tissue, VF: ventral fin, W: wound. Scale bar = 32 µm. b Quantification of neutrophil cluster size, n = 8 (WT), n = 6 (ala), and n = 4 (chim) larvae from 3 imaging sessions per condition. One-way ANOVA test with Tukeyʼs multiple comparisons test. c Quantification of speed within the owa. n = 9 (WT), n = 6 (ala), and n = 7 (chim) larvae. One-way ANOVA test with Tukeyʼs multiple comparisons test. d Neutrophil speed in relation to distance from the owa. Average speeds per cell step per distance bin are shown. n = 316–1942 steps per bin (WT), n = 105–706 steps per bin (ala), n = 83–896 steps per bin (chim). e Neutrophil speed in relation to cosine of angle θ . Average speeds per cell per cos θ bin are shown. n = 128–849 steps per bin (WT), n = 22–445 steps per bin (ala), and n = 44–417 steps per bin (chim). f Net reverse traffic. n = 9 (WT), n = 6 (ala), and N = 7 (chim) larvae. Kruskal–Wallis test with Dunn’s multiple comparisons test. g Summary of phenotypes observed in Cxcr1 rescue experiments and their interpretation. PM, plasma membrane. For c – f , data are from 9 (WT), 6 (ala), and 7 (chim) larvae from 3, 6, and 3 imaging sessions, respectively. For all panels, analysis was focused on the post initial arrival window of 1–2 hpw. Error bars represent S.E.M. across cell steps (d,e) or larvae (b,c,f). Source data are provided as a Source Data file

    Article Snippet: Chemokine receptor internalization assays in early embryos For mRNA production, the pCS2+ plasmids containing the Cxcr1-FT, Cxcr2-FT, Cxcr2-chim-FT, Cxcl8a, and Cxcl8b constructs were linearized and transcribed with an mMessage mMachine SP6 kit (Ambion) followed by polyA addition (Ambion). mCFP template for in vitro transcription was prepared from a Clontech Plasmid containing the cDNA for mCFP (p-ECFP-mem; Catalog #6918-1) and the following primers: Fw: 5′-GGGGATTTAGGTGACACTATAGAAGCCGCCACCATGCTGTGCTGTATGAGA AGAAC-3′, Rv: 5′-TCGCGGCCGCTTTACTTGTACAGCTCGTC-3′.

    Techniques: Imaging

    Model for coordination of neutrophil clustering and dispersal through chemokine receptor trafficking. (Top) Cxcr1/Cxcl8a and Cxcr2/Cxcl8b can partly compensate for each other during initial chemotaxis to the wounded tissue. However, Cxcr1 specifically promotes clustering and this contribution is limited by desensitization and downregulation. Conversely, Cxcr2 is recycled after internalization and promotes persistent bidirectional motility in the wounded tissue through sustained, intermittent signaling. This facilitates dispersal from the site. Bottom left: in the absence of Cxcr1, neutrophils are recruited, through Cxcr2/Cxcl8b and other endogenous signals, but show a loss in clustering. Bottom right: in the absence of Cxcr2, neutrophils are recruited, through Cxcr1/Cxcl8a and other endogenous signals. Once at the target, Cxcr1 is maximally downregulated and neutrophils lack signal input for motility, leading to a defect in dispersal

    Journal: Nature Communications

    Article Title: Chemokine receptor trafficking coordinates neutrophil clustering and dispersal at wounds in zebrafish

    doi: 10.1038/s41467-019-13107-3

    Figure Lengend Snippet: Model for coordination of neutrophil clustering and dispersal through chemokine receptor trafficking. (Top) Cxcr1/Cxcl8a and Cxcr2/Cxcl8b can partly compensate for each other during initial chemotaxis to the wounded tissue. However, Cxcr1 specifically promotes clustering and this contribution is limited by desensitization and downregulation. Conversely, Cxcr2 is recycled after internalization and promotes persistent bidirectional motility in the wounded tissue through sustained, intermittent signaling. This facilitates dispersal from the site. Bottom left: in the absence of Cxcr1, neutrophils are recruited, through Cxcr2/Cxcl8b and other endogenous signals, but show a loss in clustering. Bottom right: in the absence of Cxcr2, neutrophils are recruited, through Cxcr1/Cxcl8a and other endogenous signals. Once at the target, Cxcr1 is maximally downregulated and neutrophils lack signal input for motility, leading to a defect in dispersal

    Article Snippet: Chemokine receptor internalization assays in early embryos For mRNA production, the pCS2+ plasmids containing the Cxcr1-FT, Cxcr2-FT, Cxcr2-chim-FT, Cxcl8a, and Cxcl8b constructs were linearized and transcribed with an mMessage mMachine SP6 kit (Ambion) followed by polyA addition (Ambion). mCFP template for in vitro transcription was prepared from a Clontech Plasmid containing the cDNA for mCFP (p-ECFP-mem; Catalog #6918-1) and the following primers: Fw: 5′-GGGGATTTAGGTGACACTATAGAAGCCGCCACCATGCTGTGCTGTATGAGA AGAAC-3′, Rv: 5′-TCGCGGCCGCTTTACTTGTACAGCTCGTC-3′.

    Techniques: Chemotaxis Assay

    Live imaging of chemokine receptor trafficking in neutrophils. a Constructs used for neutrophil-specific transgenic expression of Cxcr1-FT (Fluorescent Timer) and Cxcr2-FT. Confocal projections of neutrophils in the head of a 3 days post fertilization (dpf) transgenic larva (Tg( lyz :Cxcr1-FT), top; Tg( lyz :Cxcr2-FT), bottom) showing tRFP (tagRFP; magenta) and sfGFP (green) channels. Scale bar = 20 µm. b Anatomical scheme of 3 dpf larva showing the location of the caudal hematopoietic tissue (CHT), the venus circulation (VC, blue), the ventral fin (VF), and the wound site. Below the larva are schemes depicting the area of the wound (W) with neutrophils getting mobilized from the CHT (top) or performing chemotaxis upon entering the ventral fin (bottom). The Caudal Vein plexus (CVP) of the CHT tissue is drawn in blue. Dashed square indicates area imaged in snapshots on the right. c Neutrophils in Tg( lyz :Cxcr1-FT) larvae (sfGFP is shown) upon mobilization from the CHT (top panels) or chemotaxis towards the wound (bottom panels). Arrows show the same cells over time. Time points on the right image are minutes elapsed after image on the left. Scale bar = 10 µm. d Schematic of Cxcr1/2-FT construct behavior in neutrophils. Newly synthesized receptors fluoresce in green due to short residence time at the plasma membrane. Older receptors fluoresce in red and green, and accumulate in intracellular compartments through constitutive turnover. Upon exposure to ligands at wounds, the receptor may internalize and subsequently be degraded or recycled

    Journal: Nature Communications

    Article Title: Chemokine receptor trafficking coordinates neutrophil clustering and dispersal at wounds in zebrafish

    doi: 10.1038/s41467-019-13107-3

    Figure Lengend Snippet: Live imaging of chemokine receptor trafficking in neutrophils. a Constructs used for neutrophil-specific transgenic expression of Cxcr1-FT (Fluorescent Timer) and Cxcr2-FT. Confocal projections of neutrophils in the head of a 3 days post fertilization (dpf) transgenic larva (Tg( lyz :Cxcr1-FT), top; Tg( lyz :Cxcr2-FT), bottom) showing tRFP (tagRFP; magenta) and sfGFP (green) channels. Scale bar = 20 µm. b Anatomical scheme of 3 dpf larva showing the location of the caudal hematopoietic tissue (CHT), the venus circulation (VC, blue), the ventral fin (VF), and the wound site. Below the larva are schemes depicting the area of the wound (W) with neutrophils getting mobilized from the CHT (top) or performing chemotaxis upon entering the ventral fin (bottom). The Caudal Vein plexus (CVP) of the CHT tissue is drawn in blue. Dashed square indicates area imaged in snapshots on the right. c Neutrophils in Tg( lyz :Cxcr1-FT) larvae (sfGFP is shown) upon mobilization from the CHT (top panels) or chemotaxis towards the wound (bottom panels). Arrows show the same cells over time. Time points on the right image are minutes elapsed after image on the left. Scale bar = 10 µm. d Schematic of Cxcr1/2-FT construct behavior in neutrophils. Newly synthesized receptors fluoresce in green due to short residence time at the plasma membrane. Older receptors fluoresce in red and green, and accumulate in intracellular compartments through constitutive turnover. Upon exposure to ligands at wounds, the receptor may internalize and subsequently be degraded or recycled

    Article Snippet: Chemokine receptor internalization assays in early embryos For mRNA production, the pCS2+ plasmids containing the Cxcr1-FT, Cxcr2-FT, Cxcr2-chim-FT, Cxcl8a, and Cxcl8b constructs were linearized and transcribed with an mMessage mMachine SP6 kit (Ambion) followed by polyA addition (Ambion). mCFP template for in vitro transcription was prepared from a Clontech Plasmid containing the cDNA for mCFP (p-ECFP-mem; Catalog #6918-1) and the following primers: Fw: 5′-GGGGATTTAGGTGACACTATAGAAGCCGCCACCATGCTGTGCTGTATGAGA AGAAC-3′, Rv: 5′-TCGCGGCCGCTTTACTTGTACAGCTCGTC-3′.

    Techniques: Imaging, Construct, Transgenic Assay, Expressing, Chemotaxis Assay, Synthesized

    Distinct trafficking of Cxcr1 and Cxcr2 during neutrophil migration to wounds. a Overview of receptor distribution patterns and corresponding quantitative approach. Confocal projection of neutrophils in a representative wounded or unwounded Tg( lyz :Cxcr1-FT) larva. Examples of cells are shown in different colors: single (blue) or clustered (green) cells at the wound, cells in the CHT of the same wounded larva (red) or cells in the CHT of an unwounded larva (orange). CHT: caudal hematopoietic tissue, VF: ventral fin, W: wound. b Calculation of contrast from the cells segmented in a . n = 3 (green, blue, red), n = 11 (orange) cells. Scale bar = 25 µm, scale bar (insets) = 10 µm. c Confocal projection of neutrophils in Tg( lyz :Cxcr1-FT) or Tg( lyz :Cxcr2-FT) larvae at the wound focus. Scale bar = 10 µm. mpw = minutes post wound. d Normalized contrast (contrast per individual neutrophil normalized to the mean contrast of non-mobilized cells in the CHT). Cxcl8a refers to injection of a splice-blocking together with a translation-blocking morpholino for cxcl8a . cxcl8b refers to injection with a splice-blocking morpholino for Cxcl8b. For Tg( lyz :Cxcr1-FT): n = 24 cells (CHT), n = 47 cells (wound) from 8 larvae. For Tg( lyz :Cxcr1-FT) with morpholinos: n = 28 cells (Cxcl8a-MO) from 5 larvae, n = 16 cells (Cxcl8b-MO) from 5 larvae. For Tg( lyz :Cxcr2-FT): n = 10 cells (CHT) and n = 20 cells (wound) from 3 larvae. Data were pooled from independent larvae acquired in 1 to 5 imaging sessions. Kruskal–Wallis test with Dunn’s multiple comparisons test for Tg( lyz :Cxcr1-FT), two-tailed unpaired Mann–Whitney test for Tg( lyz :Cxcr2-FT). e Top: cartoon depicting neutrophils in the CHT after mobilization to the ventral fin in response to an exogenous LTB4 gradient. Bottom: confocal projections of Cxcr1-FT neutrophils 30 min after LTB4 addition, right before (middle) and 1 h after wound (bottom). Scale bar = 50 µm. f Same larva as in e , at 10 mpw. Orange dashed line shows the wound margin. Graph below shows normalized contrast of individual neutrophils as a function of distance from the nearest point in the wound margin. For normalization, values were divided by the maximum contrast of each movie. n > 92 cells or clustered cells per bin, from 3 larvae in 3 imaging sessions. Two-tailed unpaired Mann–Whitney test. Error bars represent S.E.M. across cells. Source data are provided as a Source Data file

    Journal: Nature Communications

    Article Title: Chemokine receptor trafficking coordinates neutrophil clustering and dispersal at wounds in zebrafish

    doi: 10.1038/s41467-019-13107-3

    Figure Lengend Snippet: Distinct trafficking of Cxcr1 and Cxcr2 during neutrophil migration to wounds. a Overview of receptor distribution patterns and corresponding quantitative approach. Confocal projection of neutrophils in a representative wounded or unwounded Tg( lyz :Cxcr1-FT) larva. Examples of cells are shown in different colors: single (blue) or clustered (green) cells at the wound, cells in the CHT of the same wounded larva (red) or cells in the CHT of an unwounded larva (orange). CHT: caudal hematopoietic tissue, VF: ventral fin, W: wound. b Calculation of contrast from the cells segmented in a . n = 3 (green, blue, red), n = 11 (orange) cells. Scale bar = 25 µm, scale bar (insets) = 10 µm. c Confocal projection of neutrophils in Tg( lyz :Cxcr1-FT) or Tg( lyz :Cxcr2-FT) larvae at the wound focus. Scale bar = 10 µm. mpw = minutes post wound. d Normalized contrast (contrast per individual neutrophil normalized to the mean contrast of non-mobilized cells in the CHT). Cxcl8a refers to injection of a splice-blocking together with a translation-blocking morpholino for cxcl8a . cxcl8b refers to injection with a splice-blocking morpholino for Cxcl8b. For Tg( lyz :Cxcr1-FT): n = 24 cells (CHT), n = 47 cells (wound) from 8 larvae. For Tg( lyz :Cxcr1-FT) with morpholinos: n = 28 cells (Cxcl8a-MO) from 5 larvae, n = 16 cells (Cxcl8b-MO) from 5 larvae. For Tg( lyz :Cxcr2-FT): n = 10 cells (CHT) and n = 20 cells (wound) from 3 larvae. Data were pooled from independent larvae acquired in 1 to 5 imaging sessions. Kruskal–Wallis test with Dunn’s multiple comparisons test for Tg( lyz :Cxcr1-FT), two-tailed unpaired Mann–Whitney test for Tg( lyz :Cxcr2-FT). e Top: cartoon depicting neutrophils in the CHT after mobilization to the ventral fin in response to an exogenous LTB4 gradient. Bottom: confocal projections of Cxcr1-FT neutrophils 30 min after LTB4 addition, right before (middle) and 1 h after wound (bottom). Scale bar = 50 µm. f Same larva as in e , at 10 mpw. Orange dashed line shows the wound margin. Graph below shows normalized contrast of individual neutrophils as a function of distance from the nearest point in the wound margin. For normalization, values were divided by the maximum contrast of each movie. n > 92 cells or clustered cells per bin, from 3 larvae in 3 imaging sessions. Two-tailed unpaired Mann–Whitney test. Error bars represent S.E.M. across cells. Source data are provided as a Source Data file

    Article Snippet: Chemokine receptor internalization assays in early embryos For mRNA production, the pCS2+ plasmids containing the Cxcr1-FT, Cxcr2-FT, Cxcr2-chim-FT, Cxcl8a, and Cxcl8b constructs were linearized and transcribed with an mMessage mMachine SP6 kit (Ambion) followed by polyA addition (Ambion). mCFP template for in vitro transcription was prepared from a Clontech Plasmid containing the cDNA for mCFP (p-ECFP-mem; Catalog #6918-1) and the following primers: Fw: 5′-GGGGATTTAGGTGACACTATAGAAGCCGCCACCATGCTGTGCTGTATGAGA AGAAC-3′, Rv: 5′-TCGCGGCCGCTTTACTTGTACAGCTCGTC-3′.

    Techniques: Migration, Injection, Blocking Assay, Imaging, Two Tailed Test, MANN-WHITNEY

    Receptor mutagenesis alters Cxcr1 and Cxcr2 trafficking. a Mutagenesis of Cxcr1. Amino acid sequence of the C-terminus is shown with candidate phosphorylation targets (serines) or transplanted sequences highlighted in red. b Neutrophils in cxcr1 −/− / cxcr2 −/− larvae rescued by transgenic neutrophil-specific expression of Cxcr1-FT/Cxcr2-FT, Cxcr1-ala-FT/Cxcr2-ala-FT, or Cxcr1-chim-FT/Cxcr2-chim-FT receptors. Arrows point to neutrophils at the center of the wound, with representative distribution of the receptor. Scale bar = 15 µm. c Quantification of contrast in cxcr1 −/− or cxcr1 −/+ neutrophils rescued by the different Cxcr1-FT receptor variants. n = 23 cells (WT) from 7 larvae, n = 26 cells (ala) from 6 larvae, n = 19 cells (chim) from 5 larvae. Data were acquired in 2 to 4 imaging sessions. Kruskal–Wallis test with Dunn’s multiple comparisons test. d Quantification of contrast in cxcr2 −/− neutrophils rescued by the different Cxcr1-FT receptor variants. n = 33 cells (WT) from 5 larvae, n = 18 cells (ala) from 5 larvae, n = 33 cells (chim) from 8 larvae. Data are from independent larvae in 3 to 5 imaging sessions. Kruskal–Wallis test with Dunn’s multiple comparisons test. Error bars represent S.E.M. across cells. Source data are provided as a Source Data file

    Journal: Nature Communications

    Article Title: Chemokine receptor trafficking coordinates neutrophil clustering and dispersal at wounds in zebrafish

    doi: 10.1038/s41467-019-13107-3

    Figure Lengend Snippet: Receptor mutagenesis alters Cxcr1 and Cxcr2 trafficking. a Mutagenesis of Cxcr1. Amino acid sequence of the C-terminus is shown with candidate phosphorylation targets (serines) or transplanted sequences highlighted in red. b Neutrophils in cxcr1 −/− / cxcr2 −/− larvae rescued by transgenic neutrophil-specific expression of Cxcr1-FT/Cxcr2-FT, Cxcr1-ala-FT/Cxcr2-ala-FT, or Cxcr1-chim-FT/Cxcr2-chim-FT receptors. Arrows point to neutrophils at the center of the wound, with representative distribution of the receptor. Scale bar = 15 µm. c Quantification of contrast in cxcr1 −/− or cxcr1 −/+ neutrophils rescued by the different Cxcr1-FT receptor variants. n = 23 cells (WT) from 7 larvae, n = 26 cells (ala) from 6 larvae, n = 19 cells (chim) from 5 larvae. Data were acquired in 2 to 4 imaging sessions. Kruskal–Wallis test with Dunn’s multiple comparisons test. d Quantification of contrast in cxcr2 −/− neutrophils rescued by the different Cxcr1-FT receptor variants. n = 33 cells (WT) from 5 larvae, n = 18 cells (ala) from 5 larvae, n = 33 cells (chim) from 8 larvae. Data are from independent larvae in 3 to 5 imaging sessions. Kruskal–Wallis test with Dunn’s multiple comparisons test. Error bars represent S.E.M. across cells. Source data are provided as a Source Data file

    Article Snippet: Chemokine receptor internalization assays in early embryos For mRNA production, the pCS2+ plasmids containing the Cxcr1-FT, Cxcr2-FT, Cxcr2-chim-FT, Cxcl8a, and Cxcl8b constructs were linearized and transcribed with an mMessage mMachine SP6 kit (Ambion) followed by polyA addition (Ambion). mCFP template for in vitro transcription was prepared from a Clontech Plasmid containing the cDNA for mCFP (p-ECFP-mem; Catalog #6918-1) and the following primers: Fw: 5′-GGGGATTTAGGTGACACTATAGAAGCCGCCACCATGCTGTGCTGTATGAGA AGAAC-3′, Rv: 5′-TCGCGGCCGCTTTACTTGTACAGCTCGTC-3′.

    Techniques: Mutagenesis, Sequencing, Transgenic Assay, Expressing, Imaging

    Differential contributions of Cxcr1 and Cxcr2 in neutrophil clustering and dispersal. a Confocal projections showing distribution of neutrophils at wounds of wild-type (WT) Tg( mpx :GFP) i114 , cxcr1 −/− ( cxcr1 −/− /Tg( mpx :GFP) i114 ), or cxcr2 −/− ( cxcr2 −/− /Tg( mpx :GFP) i114 ) larvae at 2 hpw. CHT: caudal hematopoietic tissue, VF: ventral fin. Cartoon on the left indicates area imaged. Dashed lines show VF and CHT outlines. Scale bar = 25 µm. b Number of recruited neutrophils at 1 and 2 hpw, within a square area of 200 × 200 µm around the wound. One-way ANOVA with Tukeyʼs multiple comparisons test. n = 12 (WT), n = 17 ( cxcr1 −/− ), and n = 11 ( cxcr2 −/− ) larvae. Larvae shown in a are represented with a red dot. c Average neutrophil cluster size per larva. n = 12 (WT), n = 17 ( cxcr1 −/− ), and n = 11 ( cxcr2 −/− ) larvae. Kruskal–Wallis test with Dunn’s multiple comparisons test. d Cartoon depicting trajectory parameters measured. The occupied wound area (owa) is the area occupied by the neutrophil cluster. Forward (magenta) and reverse (orange) segments of cell trajectories are defined as the path of neutrophils prior to entering and after leaving the owa, respectively. d t , shortest distance from owa at time point t . v t , speed at time point t . θ t = approach angle to owa at time point t . e Neutrophil track straightness within the owa and an area extending 50 µm beyond. n = 680 tracks (WT), n = 603 tracks ( cxcr1 −/− ), and n = 319 tracks ( cxcr2 −/− ). Kruskal–Wallis test with Dunn’s multiple comparisons test. f Neutrophil speed in relation to the cosine of the angle θ , within a zone of 0–50 µm from the owa are shown. n = 131–2423 steps per bin (WT), n = 11–3008 steps per bin ( cxcr1 −/− ), n = 88–2823 steps per bin ( cxcr2 −/− ). g Neutrophil speed in relation to distance from the owa. n = 133–1227 cell steps per bin (WT), n = 231–1436 steps per bin ( cxcr1 −/− ), n = 202–1382 steps per bin ( cxcr2 −/− ). h Net reverse traffic. n = 12 (WT), n = 17 ( cxcr1 −/− ), and n = 11 ( cxcr2 −/− ) larvae. In all panels, data are from the same 12 WT, 17 cxcr1 −/− , and 11 cxcr2 −/− larvae from 6, 10, and 8 imaging sessions, respectively. Cells were analyzed from the start of the movie (~15 mpw) up to 2 hpw. Error bars represent S.E.M. across cell steps (f,g) or cell tracks (e) or larvae (b,c,h). Source data are provided as a Source Data file

    Journal: Nature Communications

    Article Title: Chemokine receptor trafficking coordinates neutrophil clustering and dispersal at wounds in zebrafish

    doi: 10.1038/s41467-019-13107-3

    Figure Lengend Snippet: Differential contributions of Cxcr1 and Cxcr2 in neutrophil clustering and dispersal. a Confocal projections showing distribution of neutrophils at wounds of wild-type (WT) Tg( mpx :GFP) i114 , cxcr1 −/− ( cxcr1 −/− /Tg( mpx :GFP) i114 ), or cxcr2 −/− ( cxcr2 −/− /Tg( mpx :GFP) i114 ) larvae at 2 hpw. CHT: caudal hematopoietic tissue, VF: ventral fin. Cartoon on the left indicates area imaged. Dashed lines show VF and CHT outlines. Scale bar = 25 µm. b Number of recruited neutrophils at 1 and 2 hpw, within a square area of 200 × 200 µm around the wound. One-way ANOVA with Tukeyʼs multiple comparisons test. n = 12 (WT), n = 17 ( cxcr1 −/− ), and n = 11 ( cxcr2 −/− ) larvae. Larvae shown in a are represented with a red dot. c Average neutrophil cluster size per larva. n = 12 (WT), n = 17 ( cxcr1 −/− ), and n = 11 ( cxcr2 −/− ) larvae. Kruskal–Wallis test with Dunn’s multiple comparisons test. d Cartoon depicting trajectory parameters measured. The occupied wound area (owa) is the area occupied by the neutrophil cluster. Forward (magenta) and reverse (orange) segments of cell trajectories are defined as the path of neutrophils prior to entering and after leaving the owa, respectively. d t , shortest distance from owa at time point t . v t , speed at time point t . θ t = approach angle to owa at time point t . e Neutrophil track straightness within the owa and an area extending 50 µm beyond. n = 680 tracks (WT), n = 603 tracks ( cxcr1 −/− ), and n = 319 tracks ( cxcr2 −/− ). Kruskal–Wallis test with Dunn’s multiple comparisons test. f Neutrophil speed in relation to the cosine of the angle θ , within a zone of 0–50 µm from the owa are shown. n = 131–2423 steps per bin (WT), n = 11–3008 steps per bin ( cxcr1 −/− ), n = 88–2823 steps per bin ( cxcr2 −/− ). g Neutrophil speed in relation to distance from the owa. n = 133–1227 cell steps per bin (WT), n = 231–1436 steps per bin ( cxcr1 −/− ), n = 202–1382 steps per bin ( cxcr2 −/− ). h Net reverse traffic. n = 12 (WT), n = 17 ( cxcr1 −/− ), and n = 11 ( cxcr2 −/− ) larvae. In all panels, data are from the same 12 WT, 17 cxcr1 −/− , and 11 cxcr2 −/− larvae from 6, 10, and 8 imaging sessions, respectively. Cells were analyzed from the start of the movie (~15 mpw) up to 2 hpw. Error bars represent S.E.M. across cell steps (f,g) or cell tracks (e) or larvae (b,c,h). Source data are provided as a Source Data file

    Article Snippet: Chemokine receptor internalization assays in early embryos For mRNA production, the pCS2+ plasmids containing the Cxcr1-FT, Cxcr2-FT, Cxcr2-chim-FT, Cxcl8a, and Cxcl8b constructs were linearized and transcribed with an mMessage mMachine SP6 kit (Ambion) followed by polyA addition (Ambion). mCFP template for in vitro transcription was prepared from a Clontech Plasmid containing the cDNA for mCFP (p-ECFP-mem; Catalog #6918-1) and the following primers: Fw: 5′-GGGGATTTAGGTGACACTATAGAAGCCGCCACCATGCTGTGCTGTATGAGA AGAAC-3′, Rv: 5′-TCGCGGCCGCTTTACTTGTACAGCTCGTC-3′.

    Techniques: Imaging

    CXCL5 recruits macrophages to the gastrointestinal tract during inflammatory mucosal injury in mouse pups. A : intestinal macrophages express CXCR2, the cognate receptor for CXCL5. Fluorescence photomicrographs (×1,000) show CXCR2 staining on intestinal

    Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

    Article Title: Gut mucosal injury in neonates is marked by macrophage infiltration in contrast to pleomorphic infiltrates in adult: evidence from an animal model

    doi: 10.1152/ajpgi.00016.2012

    Figure Lengend Snippet: CXCL5 recruits macrophages to the gastrointestinal tract during inflammatory mucosal injury in mouse pups. A : intestinal macrophages express CXCR2, the cognate receptor for CXCL5. Fluorescence photomicrographs (×1,000) show CXCR2 staining on intestinal

    Article Snippet: Additional experiments were performed after pretreatment of BMDMs with anti-CXCR2 antibody or with SB225002 (10 nM; Sigma), a small molecule inhibitor of CXCR2.

    Techniques: Fluorescence, Staining

    Expression of CXCR2 and IL-22BP proteins in GA via immunohistochemistry, western blotting and immunocytochemistry. Expression two proteins were defined as positive if distinct staining of the cytoplasm, cytomembrane or nuclear was observed in at least

    Journal: Oncology Letters

    Article Title: Association between CXCR2 and IL-22BP expression indicate a poor outcome for gastric adenocarcinoma progression

    doi: 10.3892/ol.2016.4790

    Figure Lengend Snippet: Expression of CXCR2 and IL-22BP proteins in GA via immunohistochemistry, western blotting and immunocytochemistry. Expression two proteins were defined as positive if distinct staining of the cytoplasm, cytomembrane or nuclear was observed in at least

    Article Snippet: Blots were incubated at 4°C for > 12 h with anti-CXCR2 (1:400), anti-IL-22BP (1:200) and anti-β-actin (clone AC-15; mouse monoclonal; dilution, 1:10,000; catalog no., A5441; Sigma-Aldrich, St. Louis, MO, USA).

    Techniques: Expressing, Immunohistochemistry, Western Blot, Immunocytochemistry, Staining

    Association between CXCR2 and IL-22BP expression and clinical characteristics

    Journal: Oncology Letters

    Article Title: Association between CXCR2 and IL-22BP expression indicate a poor outcome for gastric adenocarcinoma progression

    doi: 10.3892/ol.2016.4790

    Figure Lengend Snippet: Association between CXCR2 and IL-22BP expression and clinical characteristics

    Article Snippet: Blots were incubated at 4°C for > 12 h with anti-CXCR2 (1:400), anti-IL-22BP (1:200) and anti-β-actin (clone AC-15; mouse monoclonal; dilution, 1:10,000; catalog no., A5441; Sigma-Aldrich, St. Louis, MO, USA).

    Techniques: Expressing

    Association of CXCR2 and IL-22BP expression with OS

    Journal: Oncology Letters

    Article Title: Association between CXCR2 and IL-22BP expression indicate a poor outcome for gastric adenocarcinoma progression

    doi: 10.3892/ol.2016.4790

    Figure Lengend Snippet: Association of CXCR2 and IL-22BP expression with OS

    Article Snippet: Blots were incubated at 4°C for > 12 h with anti-CXCR2 (1:400), anti-IL-22BP (1:200) and anti-β-actin (clone AC-15; mouse monoclonal; dilution, 1:10,000; catalog no., A5441; Sigma-Aldrich, St. Louis, MO, USA).

    Techniques: Expressing

    Evaluation of (A) CXCR2 and (B) IL-22BP as a predictor for OS by Kaplan-Meier plots. Association between CXCR2 and IL-22BP expression and OS was observed, and indicated that positive CXCR2 and IL-22BP expression is associated with shorter OS time. Through

    Journal: Oncology Letters

    Article Title: Association between CXCR2 and IL-22BP expression indicate a poor outcome for gastric adenocarcinoma progression

    doi: 10.3892/ol.2016.4790

    Figure Lengend Snippet: Evaluation of (A) CXCR2 and (B) IL-22BP as a predictor for OS by Kaplan-Meier plots. Association between CXCR2 and IL-22BP expression and OS was observed, and indicated that positive CXCR2 and IL-22BP expression is associated with shorter OS time. Through

    Article Snippet: Blots were incubated at 4°C for > 12 h with anti-CXCR2 (1:400), anti-IL-22BP (1:200) and anti-β-actin (clone AC-15; mouse monoclonal; dilution, 1:10,000; catalog no., A5441; Sigma-Aldrich, St. Louis, MO, USA).

    Techniques: Expressing

    Analysis of CXCR2 and IL-22BP expression via western blotting and RT-qPCR. Expression of CXCR2 and IL-22BP in the MKN-45, BGC-823 and SGC-7901 cell lines via (Aa) western blotting and (Ab) quantification. Using (Ba) RT-qPCR and (Bb) additional quantification,

    Journal: Oncology Letters

    Article Title: Association between CXCR2 and IL-22BP expression indicate a poor outcome for gastric adenocarcinoma progression

    doi: 10.3892/ol.2016.4790

    Figure Lengend Snippet: Analysis of CXCR2 and IL-22BP expression via western blotting and RT-qPCR. Expression of CXCR2 and IL-22BP in the MKN-45, BGC-823 and SGC-7901 cell lines via (Aa) western blotting and (Ab) quantification. Using (Ba) RT-qPCR and (Bb) additional quantification,

    Article Snippet: Blots were incubated at 4°C for > 12 h with anti-CXCR2 (1:400), anti-IL-22BP (1:200) and anti-β-actin (clone AC-15; mouse monoclonal; dilution, 1:10,000; catalog no., A5441; Sigma-Aldrich, St. Louis, MO, USA).

    Techniques: Expressing, Western Blot, Quantitative RT-PCR

    Expression pattern of CXCR2 and IL-22BP in GA

    Journal: Oncology Letters

    Article Title: Association between CXCR2 and IL-22BP expression indicate a poor outcome for gastric adenocarcinoma progression

    doi: 10.3892/ol.2016.4790

    Figure Lengend Snippet: Expression pattern of CXCR2 and IL-22BP in GA

    Article Snippet: Blots were incubated at 4°C for > 12 h with anti-CXCR2 (1:400), anti-IL-22BP (1:200) and anti-β-actin (clone AC-15; mouse monoclonal; dilution, 1:10,000; catalog no., A5441; Sigma-Aldrich, St. Louis, MO, USA).

    Techniques: Expressing

    Cellular localization of CXCR2 expression in vlPAG after BCP. Immunofluorescence triple staining of CXCR2 ( a , f , k ), GFAP ( g ), Neun ( l ), CD11 ( b ), and DAPI in vlPAG at day 6 after BCP show that all glial cells and neurons express DAPI + cells ( d , i , n ). Scale bar in ( k ): 100 μm. Immunofluorescence triple staining of high-magnification images, indicated in the white boxes of ( c , h , m , d , i , n ), mainly mainly co-localized with Neun ( o ), but not with astrocyte ( j ) and microglia ( e ). Scale bar in ( o ): 20 μm. Aq, aqueduct. n = 4

    Journal: Journal of Neuroinflammation

    Article Title: Crosstalk between NFκB-dependent astrocytic CXCL1 and neuron CXCR2 plays a role in descending pain facilitation

    doi: 10.1186/s12974-018-1391-2

    Figure Lengend Snippet: Cellular localization of CXCR2 expression in vlPAG after BCP. Immunofluorescence triple staining of CXCR2 ( a , f , k ), GFAP ( g ), Neun ( l ), CD11 ( b ), and DAPI in vlPAG at day 6 after BCP show that all glial cells and neurons express DAPI + cells ( d , i , n ). Scale bar in ( k ): 100 μm. Immunofluorescence triple staining of high-magnification images, indicated in the white boxes of ( c , h , m , d , i , n ), mainly mainly co-localized with Neun ( o ), but not with astrocyte ( j ) and microglia ( e ). Scale bar in ( o ): 20 μm. Aq, aqueduct. n = 4

    Article Snippet: To further define the cellular localization of CXCR2 in vlPAG, we performed triple staining of CXCR2 with three different cell markers (Neun, GFAP, and CD11) and DAPI.

    Techniques: Expressing, Immunofluorescence, Staining

    BCP increases CXCR2 mRNA and protein expression in the vlPAG. a Expression levels of CXCR2 in the vlPAG in sham group. b – d Upregulation of CXCR2 in vlPAG on POD 6, 12, and 18. Scale bars: 100 μm; Aq, aqueduct. e The statistical analysis of CXCR2 intensity confirmed the increase of CXCR2 expression in vlPAG after BCP. *** p

    Journal: Journal of Neuroinflammation

    Article Title: Crosstalk between NFκB-dependent astrocytic CXCL1 and neuron CXCR2 plays a role in descending pain facilitation

    doi: 10.1186/s12974-018-1391-2

    Figure Lengend Snippet: BCP increases CXCR2 mRNA and protein expression in the vlPAG. a Expression levels of CXCR2 in the vlPAG in sham group. b – d Upregulation of CXCR2 in vlPAG on POD 6, 12, and 18. Scale bars: 100 μm; Aq, aqueduct. e The statistical analysis of CXCR2 intensity confirmed the increase of CXCR2 expression in vlPAG after BCP. *** p

    Article Snippet: To further define the cellular localization of CXCR2 in vlPAG, we performed triple staining of CXCR2 with three different cell markers (Neun, GFAP, and CD11) and DAPI.

    Techniques: Expressing

    VlPAG micro-injection of CXCL1 induces mechanical allodynia via CXCR2. a Micro-injection of CXCL1 (10 or 100 ng) induces a dose-dependent mechanical allodynia. n = 8, *** p

    Journal: Journal of Neuroinflammation

    Article Title: Crosstalk between NFκB-dependent astrocytic CXCL1 and neuron CXCR2 plays a role in descending pain facilitation

    doi: 10.1186/s12974-018-1391-2

    Figure Lengend Snippet: VlPAG micro-injection of CXCL1 induces mechanical allodynia via CXCR2. a Micro-injection of CXCL1 (10 or 100 ng) induces a dose-dependent mechanical allodynia. n = 8, *** p

    Article Snippet: To further define the cellular localization of CXCR2 in vlPAG, we performed triple staining of CXCR2 with three different cell markers (Neun, GFAP, and CD11) and DAPI.

    Techniques: Injection

    FACS analysis data representative for each investigated group: healthy volunteers ( a - e ), ICU controls ( f - j ) and septic patients ( k - o ); histograms show the percentage of CXCR-4, CXCR-2, c-Kit, RAGE and PSGL-1 expression in the population of CD34/CD133-positive cells. The dotted line in histograms represents the negative control. APC , allophycocyanin; FITC , fluorescein; PE , phycoerythrin; CXCR-4 , CXC-motive-chemokine receptor 4; c-Kit , tyrosine kinase KIT; CXCR-2 , CXC-motive-chemokine receptor 2; RAGE , receptor for advanced glycation products; PSGL-1 , P-selectin ligand 1

    Journal: Journal of Inflammation (London, England)

    Article Title: CXCR-4 expression by circulating endothelial progenitor cells and SDF-1 serum levels are elevated in septic patients

    doi: 10.1186/s12950-018-0186-7

    Figure Lengend Snippet: FACS analysis data representative for each investigated group: healthy volunteers ( a - e ), ICU controls ( f - j ) and septic patients ( k - o ); histograms show the percentage of CXCR-4, CXCR-2, c-Kit, RAGE and PSGL-1 expression in the population of CD34/CD133-positive cells. The dotted line in histograms represents the negative control. APC , allophycocyanin; FITC , fluorescein; PE , phycoerythrin; CXCR-4 , CXC-motive-chemokine receptor 4; c-Kit , tyrosine kinase KIT; CXCR-2 , CXC-motive-chemokine receptor 2; RAGE , receptor for advanced glycation products; PSGL-1 , P-selectin ligand 1

    Article Snippet: We used the following monoclonal antibodies (anti-human): PE-conjugated CD133 (Miltenyi Biotec, Bergisch-Gladbach, Germany), PerCP-conjugated CD34 (BD Biosciences, Heidelberg, Germany), and either FITC-conjugated CXCR-4 or APC-conjugated c-Kit, APC-conjugated CXCR-2 (all R & D Systems, Wiesbaden-Nordenstadt, Germany), PE-conjugated PSGL1 (BD Biosciences, Heidelberg, Germany) or the indirect rabbit anti-human polyclonal RAGE antibody (Biozol, Eching, Germany), for which a FITC-conjugated anti-rabbit IgG antibody (Invitrogen, Karlsruhe, Germany) was used.

    Techniques: FACS, Expressing, Negative Control

    Immunohistochemical Expression of CXCL8, CXCR1 and CXCR2 in GBM and Diffuse Astrocytoma. Image Resolution Is X400.

    Journal: Asian Pacific Journal of Cancer Prevention : APJCP

    Article Title: Gene Expression Profiling of Chemokines and Their Receptors in Low and High Grade Astrocytoma

    doi: 10.22034/APJCP.2017.18.5.1307

    Figure Lengend Snippet: Immunohistochemical Expression of CXCL8, CXCR1 and CXCR2 in GBM and Diffuse Astrocytoma. Image Resolution Is X400.

    Article Snippet: Antibodies against CXCL8, CXCR2 were purchased from Biorbyt (UK), CXCR1 from Boster Bio (USA), GFAP (DAKO, Denmark), EnVision polymer detection system (Dako, Denmark), Anti-Rabbit / PE (Abcam, UK), Anti-Mouse/FITC(Dako, Denmark) and fluoroshield with DAPI from Sigma Alderich, USA.

    Techniques: Immunohistochemistry, Expressing

    Bar Graph Representing Percentage Immuno Positivity for CXCL8, CXCR1 and CXCR2 in GBM and Diffuse Astrocytoma. *** Indicates P

    Journal: Asian Pacific Journal of Cancer Prevention : APJCP

    Article Title: Gene Expression Profiling of Chemokines and Their Receptors in Low and High Grade Astrocytoma

    doi: 10.22034/APJCP.2017.18.5.1307

    Figure Lengend Snippet: Bar Graph Representing Percentage Immuno Positivity for CXCL8, CXCR1 and CXCR2 in GBM and Diffuse Astrocytoma. *** Indicates P

    Article Snippet: Antibodies against CXCL8, CXCR2 were purchased from Biorbyt (UK), CXCR1 from Boster Bio (USA), GFAP (DAKO, Denmark), EnVision polymer detection system (Dako, Denmark), Anti-Rabbit / PE (Abcam, UK), Anti-Mouse/FITC(Dako, Denmark) and fluoroshield with DAPI from Sigma Alderich, USA.

    Techniques:

    Anti-CXCR1 Staining in GBM, Red Arrow Indicates CXCR1+ / CD34-Micro Vessel and Yellow Arrow Indicates CXCR1+/CD34+ Vessel. Image Resolution Is100x.

    Journal: Asian Pacific Journal of Cancer Prevention : APJCP

    Article Title: Gene Expression Profiling of Chemokines and Their Receptors in Low and High Grade Astrocytoma

    doi: 10.22034/APJCP.2017.18.5.1307

    Figure Lengend Snippet: Anti-CXCR1 Staining in GBM, Red Arrow Indicates CXCR1+ / CD34-Micro Vessel and Yellow Arrow Indicates CXCR1+/CD34+ Vessel. Image Resolution Is100x.

    Article Snippet: Antibodies against CXCL8, CXCR2 were purchased from Biorbyt (UK), CXCR1 from Boster Bio (USA), GFAP (DAKO, Denmark), EnVision polymer detection system (Dako, Denmark), Anti-Rabbit / PE (Abcam, UK), Anti-Mouse/FITC(Dako, Denmark) and fluoroshield with DAPI from Sigma Alderich, USA.

    Techniques: Staining

    CXCR2 and CXCL2 expression in mouse colon tissues. CXCR2 ( A ) and CXCL1 , CXCL2 , CXCL3 , and CXCL5 ( B ) mRNA expression in the colons of the two groups sacrificed at the indicated times was assessed by quantitative RT-PCR. Each value represents mean ± SD (n = 7 mice/group). *p

    Journal: PLoS ONE

    Article Title: Crucial Involvement of Tumor-Associated Neutrophils in the Regulation of Chronic Colitis-Associated Carcinogenesis in Mice

    doi: 10.1371/journal.pone.0051848

    Figure Lengend Snippet: CXCR2 and CXCL2 expression in mouse colon tissues. CXCR2 ( A ) and CXCL1 , CXCL2 , CXCL3 , and CXCL5 ( B ) mRNA expression in the colons of the two groups sacrificed at the indicated times was assessed by quantitative RT-PCR. Each value represents mean ± SD (n = 7 mice/group). *p

    Article Snippet: Endogenous peroxidase activity was blocked with 3% H2 O2 for 15 min. Antigen retrieval was performed by boiling the sections for 10 min in citrate buffer (pH 6.0) and cooling at RT, followed by blocking with 10% NGS for 1 h. The sections were incubated with optimal dilutions of anti-CXCR2 (Abcam), anti-CXCL2 (R & D),anti-F4/80 (AbD Serotec), anti-MMP-9 (Abcam), anti-CD31 (Abcam), and anti-PCNA antibodies (Cell Signaling Technology) overnight at 4°C.

    Techniques: Expressing, Quantitative RT-PCR, Mouse Assay

    Induction of p53 and plasminogen activator inhibitor-1 (PAI-1) contributes to lung inflammation in mice exposed to passive cigarette smoke (CS) and patients with chronic obstructive pulmonary disease (COPD). Lung tissues ( A ) and bronchoalveolar lavage (BAL) fluids ( B ) collected from wild-type (WT) and p53- and PAI-1-deficient (KO) mice ( n = 5/group) exposed to ambient air (AIR) or passive CS (PCS) for 20 wk were analyzed for myeloperoxidase (MPO) activity. MPO activity quantification is expressed as mean ± SD of 3 independent analyses. C : lung sections from patients with COPD and histologically “normal” donor subjects ( n = 5) were subjected to immunohistochemical (IHC) analysis using CXCL1, CXCL2, CXCR2, and ICAM-1 antibodies. Images are representative of IHC staining pattern of 10 fields (×200 magnification) and graphs show IHC scores (H-scores). D : total RNA isolated from the lung tissues of patients with COPD or normal subjects ( n = 5) were analyzed for CXCL1, CXCL2, CXCR2, and ICAM-1 mRNAs by real-time PCR. Bar represents mean ± SD of 3 independent analyses. NS, not significant.

    Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology

    Article Title: p53- and PAI-1-mediated induction of C-X-C chemokines and CXCR2: importance in pulmonary inflammation due to cigarette smoke exposure

    doi: 10.1152/ajplung.00290.2015

    Figure Lengend Snippet: Induction of p53 and plasminogen activator inhibitor-1 (PAI-1) contributes to lung inflammation in mice exposed to passive cigarette smoke (CS) and patients with chronic obstructive pulmonary disease (COPD). Lung tissues ( A ) and bronchoalveolar lavage (BAL) fluids ( B ) collected from wild-type (WT) and p53- and PAI-1-deficient (KO) mice ( n = 5/group) exposed to ambient air (AIR) or passive CS (PCS) for 20 wk were analyzed for myeloperoxidase (MPO) activity. MPO activity quantification is expressed as mean ± SD of 3 independent analyses. C : lung sections from patients with COPD and histologically “normal” donor subjects ( n = 5) were subjected to immunohistochemical (IHC) analysis using CXCL1, CXCL2, CXCR2, and ICAM-1 antibodies. Images are representative of IHC staining pattern of 10 fields (×200 magnification) and graphs show IHC scores (H-scores). D : total RNA isolated from the lung tissues of patients with COPD or normal subjects ( n = 5) were analyzed for CXCL1, CXCL2, CXCR2, and ICAM-1 mRNAs by real-time PCR. Bar represents mean ± SD of 3 independent analyses. NS, not significant.

    Article Snippet: CXCL1, CXCL2, and CXCR2 antibodies were purchased from Abcam.

    Techniques: Mouse Assay, Activity Assay, Immunohistochemistry, Staining, Isolation, Real-time Polymerase Chain Reaction

    p53 and PAI-1 augment pulmonary CXCR2 expression in mice exposed to PCS. WT and p53- and PAI-1-deficient mice ( n = 5/group) were exposed to ambient air or PCS for 20 wk. A : lung homogenates ( n = 5/group) were immunoblotted for CXCR2 by use of anti-CXCR2 antibody. Representative blot from triplicate analyses is showed. B : total RNA from lung tissues ( n = 5/group) was analyzed for CXCR2 mRNA by real-time PCR. Bar represents mean ± SD of 3 independent analyses. C : lung sections of the mice ( n = 5/group) exposed to air or PCS were subjected to IHC analysis for CXCR2 antigens. Images are representative of IHC staining pattern of 10 fields (×200 magnification) and graph shows the H-scores.

    Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology

    Article Title: p53- and PAI-1-mediated induction of C-X-C chemokines and CXCR2: importance in pulmonary inflammation due to cigarette smoke exposure

    doi: 10.1152/ajplung.00290.2015

    Figure Lengend Snippet: p53 and PAI-1 augment pulmonary CXCR2 expression in mice exposed to PCS. WT and p53- and PAI-1-deficient mice ( n = 5/group) were exposed to ambient air or PCS for 20 wk. A : lung homogenates ( n = 5/group) were immunoblotted for CXCR2 by use of anti-CXCR2 antibody. Representative blot from triplicate analyses is showed. B : total RNA from lung tissues ( n = 5/group) was analyzed for CXCR2 mRNA by real-time PCR. Bar represents mean ± SD of 3 independent analyses. C : lung sections of the mice ( n = 5/group) exposed to air or PCS were subjected to IHC analysis for CXCR2 antigens. Images are representative of IHC staining pattern of 10 fields (×200 magnification) and graph shows the H-scores.

    Article Snippet: CXCL1, CXCL2, and CXCR2 antibodies were purchased from Abcam.

    Techniques: Expressing, Mouse Assay, Real-time Polymerase Chain Reaction, Immunohistochemistry, Staining

    CSP inhibits PCS exposure induced pulmonary CXCR2 expression. WT mice were exposed to ambient air or PCS ( n = 5/group) as described above. After 4 wk of PCS exposure, mice exposed to PCS were intraperitoneally injected with or without 18.75 mg/kg body wt of CSP or CP once every week for 4 more wk. After 20 wk of PCS exposure the mice were euthanized. A : lung homogenates ( n = 5/group) were immunoblotted for CXCR2 and β-actin for loading equality. Representative image from triplicate analyses is showed. B : total RNA obtained from mice ( n = 5/group) lung were analyzed for CXCR2 mRNA by RT-PCR as previously described. Bar graph represents mean ± SD of 3 independent analyses. C : lung sections from all groups of mice ( n = 5/group) were subjected to IHC analysis using anti-CXCR2 antibody. Images are representative of IHC staining pattern of 10 fields (×200 magnification) and bar graph shows H-scores.

    Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology

    Article Title: p53- and PAI-1-mediated induction of C-X-C chemokines and CXCR2: importance in pulmonary inflammation due to cigarette smoke exposure

    doi: 10.1152/ajplung.00290.2015

    Figure Lengend Snippet: CSP inhibits PCS exposure induced pulmonary CXCR2 expression. WT mice were exposed to ambient air or PCS ( n = 5/group) as described above. After 4 wk of PCS exposure, mice exposed to PCS were intraperitoneally injected with or without 18.75 mg/kg body wt of CSP or CP once every week for 4 more wk. After 20 wk of PCS exposure the mice were euthanized. A : lung homogenates ( n = 5/group) were immunoblotted for CXCR2 and β-actin for loading equality. Representative image from triplicate analyses is showed. B : total RNA obtained from mice ( n = 5/group) lung were analyzed for CXCR2 mRNA by RT-PCR as previously described. Bar graph represents mean ± SD of 3 independent analyses. C : lung sections from all groups of mice ( n = 5/group) were subjected to IHC analysis using anti-CXCR2 antibody. Images are representative of IHC staining pattern of 10 fields (×200 magnification) and bar graph shows H-scores.

    Article Snippet: CXCL1, CXCL2, and CXCR2 antibodies were purchased from Abcam.

    Techniques: Expressing, Mouse Assay, Injection, Reverse Transcription Polymerase Chain Reaction, Immunohistochemistry, Staining

    Effect of the CXCR1/2 antagonist SCH527123 on TEER of HPAEC monolayers transduced with BMPR-II sh, NTCsh, or an EV. Confirmation of efficient knockdown of BMPR-II using lentivirus transduction of HPAECs transduced with BMPR-II shRNA, NTC shRNA, or an EV

    Journal: Blood

    Article Title: Attenuation of leukocyte recruitment via CXCR1/2 inhibition stops the progression of PAH in mice with genetic ablation of endothelial BMPR-II

    doi: 10.1182/blood-2011-05-347393

    Figure Lengend Snippet: Effect of the CXCR1/2 antagonist SCH527123 on TEER of HPAEC monolayers transduced with BMPR-II sh, NTCsh, or an EV. Confirmation of efficient knockdown of BMPR-II using lentivirus transduction of HPAECs transduced with BMPR-II shRNA, NTC shRNA, or an EV

    Article Snippet: Blots were probed with murine anti-CXCR2 antibody (Abcam) overnight at 4°C and then incubated with an HRP-conjugated goat anti–mouse secondary antibody (Zymed) for 2 hours at room temperature.

    Techniques: Transduction, shRNA

    RVSP pressure, Fulton index, and cardiac output in L1Cre(−)BMPR2 f/f and L1Cre(+)Bmpr2 f/f mice treated with vehicle or SCH527123. L1Cre(−)Bmpr2 f/f mice or L1Cre(+)Bmpr2 f/f mice were treated with vehicle or the CXCR1/2 antagonist SCH527123

    Journal: Blood

    Article Title: Attenuation of leukocyte recruitment via CXCR1/2 inhibition stops the progression of PAH in mice with genetic ablation of endothelial BMPR-II

    doi: 10.1182/blood-2011-05-347393

    Figure Lengend Snippet: RVSP pressure, Fulton index, and cardiac output in L1Cre(−)BMPR2 f/f and L1Cre(+)Bmpr2 f/f mice treated with vehicle or SCH527123. L1Cre(−)Bmpr2 f/f mice or L1Cre(+)Bmpr2 f/f mice were treated with vehicle or the CXCR1/2 antagonist SCH527123

    Article Snippet: Blots were probed with murine anti-CXCR2 antibody (Abcam) overnight at 4°C and then incubated with an HRP-conjugated goat anti–mouse secondary antibody (Zymed) for 2 hours at room temperature.

    Techniques: Mouse Assay

    Inhibition of CXCR1/2 reduces muscularization and leukocyte infiltration into lungs of L1Cre(+)Bmpr2 f/f mice. The left lung from L1Cre(−)Bmpr2 f/f (Ai) and L1Cre(+)Bmpr2 f/f mice (Aii) treated with vehicle or SCH527123 was inflated with 1% (volume/volume)

    Journal: Blood

    Article Title: Attenuation of leukocyte recruitment via CXCR1/2 inhibition stops the progression of PAH in mice with genetic ablation of endothelial BMPR-II

    doi: 10.1182/blood-2011-05-347393

    Figure Lengend Snippet: Inhibition of CXCR1/2 reduces muscularization and leukocyte infiltration into lungs of L1Cre(+)Bmpr2 f/f mice. The left lung from L1Cre(−)Bmpr2 f/f (Ai) and L1Cre(+)Bmpr2 f/f mice (Aii) treated with vehicle or SCH527123 was inflated with 1% (volume/volume)

    Article Snippet: Blots were probed with murine anti-CXCR2 antibody (Abcam) overnight at 4°C and then incubated with an HRP-conjugated goat anti–mouse secondary antibody (Zymed) for 2 hours at room temperature.

    Techniques: Inhibition, Mouse Assay

    Effect of reduced BMPR-II expression on the expression of CXCR2 in vitro and in vivo. RNA was harvested from the lungs of L1Cre(−)Bmpr2 f/f and L1Cre(+)Bmpr2 f/f mice (A) or HPAECs transduced with shRNA targeting Bmpr -II, NTC shRNA, or an EV (B).

    Journal: Blood

    Article Title: Attenuation of leukocyte recruitment via CXCR1/2 inhibition stops the progression of PAH in mice with genetic ablation of endothelial BMPR-II

    doi: 10.1182/blood-2011-05-347393

    Figure Lengend Snippet: Effect of reduced BMPR-II expression on the expression of CXCR2 in vitro and in vivo. RNA was harvested from the lungs of L1Cre(−)Bmpr2 f/f and L1Cre(+)Bmpr2 f/f mice (A) or HPAECs transduced with shRNA targeting Bmpr -II, NTC shRNA, or an EV (B).

    Article Snippet: Blots were probed with murine anti-CXCR2 antibody (Abcam) overnight at 4°C and then incubated with an HRP-conjugated goat anti–mouse secondary antibody (Zymed) for 2 hours at room temperature.

    Techniques: Expressing, In Vitro, In Vivo, Mouse Assay, Transduction, shRNA

    Immunofluorescent localization of CXCR2 in the mouse prostate stroma. Representative photomicrographs are shown ( n = 5) of fixed, frozen cross-sections of the mouse prostate immunostained with rabbit polyclonal antibodies to CXCR2 ( green ) with DAPI ( blue ) counterstaining. The control section incubated without CXCR2 antibodies being present shows an absence of specific staining ( A ). In contrast, positive CXCR2 immunostaining can be seen specifically in the stroma, as indicated by white arrows ( B ). Panels C and D (40× objective) are higher magnification of panels A and B (20× objective), respectively. Scale bars , 50 μm.

    Journal: The Journal of Biological Chemistry

    Article Title: Identification and Profiling of Novel ?1A-Adrenoceptor-CXC Chemokine Receptor 2 Heteromer *

    doi: 10.1074/jbc.M111.322834

    Figure Lengend Snippet: Immunofluorescent localization of CXCR2 in the mouse prostate stroma. Representative photomicrographs are shown ( n = 5) of fixed, frozen cross-sections of the mouse prostate immunostained with rabbit polyclonal antibodies to CXCR2 ( green ) with DAPI ( blue ) counterstaining. The control section incubated without CXCR2 antibodies being present shows an absence of specific staining ( A ). In contrast, positive CXCR2 immunostaining can be seen specifically in the stroma, as indicated by white arrows ( B ). Panels C and D (40× objective) are higher magnification of panels A and B (20× objective), respectively. Scale bars , 50 μm.

    Article Snippet: For negative control sections, rabbit polyclonal anti-CXCR2 antibodies were omitted.

    Techniques: Incubation, Staining, Immunostaining

    SNL induces CXCR2 upregulation in spinal cord neurons. CXCR2 is expressed in the spinal cord of naïve animals (A) and increased at 3 d after SNL (B). Scale bar, 100 μm. B. Western blot shows the expression of CXCR2 in the spinal cord in

    Journal: Pain

    Article Title: Chemokine contribution to neuropathic pain: respective induction of CXCL1 and CXCR2 in spinal cord astrocytes and neurons

    doi: 10.1016/j.pain.2013.07.002

    Figure Lengend Snippet: SNL induces CXCR2 upregulation in spinal cord neurons. CXCR2 is expressed in the spinal cord of naïve animals (A) and increased at 3 d after SNL (B). Scale bar, 100 μm. B. Western blot shows the expression of CXCR2 in the spinal cord in

    Article Snippet: The spinal cord sections were incubated with a mixture of CXCL1 or CXCR2 primary antibody and the corresponding blocking peptide for CXCL1 (25 μg/ml; Boster) or CXCR2 (25 μg/ml; Boster) overnight, followed by secondary antibody incubation.

    Techniques: Western Blot, Expressing

    Schematic shows how CXCL1 and CXCR2 in the spinal cord regulate neuropathic pain. SNL rapidly increases TNF-α expression, which acts on astrocytes to induce JNK activation, leading to the production of CXCL1. Upon release from astrocytes, CXCL1

    Journal: Pain

    Article Title: Chemokine contribution to neuropathic pain: respective induction of CXCL1 and CXCR2 in spinal cord astrocytes and neurons

    doi: 10.1016/j.pain.2013.07.002

    Figure Lengend Snippet: Schematic shows how CXCL1 and CXCR2 in the spinal cord regulate neuropathic pain. SNL rapidly increases TNF-α expression, which acts on astrocytes to induce JNK activation, leading to the production of CXCL1. Upon release from astrocytes, CXCL1

    Article Snippet: The spinal cord sections were incubated with a mixture of CXCL1 or CXCR2 primary antibody and the corresponding blocking peptide for CXCL1 (25 μg/ml; Boster) or CXCR2 (25 μg/ml; Boster) overnight, followed by secondary antibody incubation.

    Techniques: Expressing, Activation Assay

    Spinal injection of CXCL1 induces heat hyperalgesia via CXCR2. (A) Intrathecal injection of CXCL1 (10 or 100 ng) induces a dose-dependent heat hyperalgesia. * P

    Journal: Pain

    Article Title: Chemokine contribution to neuropathic pain: respective induction of CXCL1 and CXCR2 in spinal cord astrocytes and neurons

    doi: 10.1016/j.pain.2013.07.002

    Figure Lengend Snippet: Spinal injection of CXCL1 induces heat hyperalgesia via CXCR2. (A) Intrathecal injection of CXCL1 (10 or 100 ng) induces a dose-dependent heat hyperalgesia. * P

    Article Snippet: The spinal cord sections were incubated with a mixture of CXCL1 or CXCR2 primary antibody and the corresponding blocking peptide for CXCL1 (25 μg/ml; Boster) or CXCR2 (25 μg/ml; Boster) overnight, followed by secondary antibody incubation.

    Techniques: Injection

    Immunostaining of candidate genes. ( A , B ) Presentative IHC images of CXCR1 and ARID3B with different ( A ) 100X; ( B ) 400X. ( C ) Statistical analysis of the immunohistochemistry results for CXCR1 and ARID3B. Student t-test, *p

    Journal: Scientific Reports

    Article Title: A response prediction model for taxane, cisplatin, and 5-fluorouracil chemotherapy in hypopharyngeal carcinoma

    doi: 10.1038/s41598-018-31027-y

    Figure Lengend Snippet: Immunostaining of candidate genes. ( A , B ) Presentative IHC images of CXCR1 and ARID3B with different ( A ) 100X; ( B ) 400X. ( C ) Statistical analysis of the immunohistochemistry results for CXCR1 and ARID3B. Student t-test, *p

    Article Snippet: After incubation with blocking solution, sections were incubated with anti-CXCR1 antibody (Abcam) or ARID3B antibody (Abcam) for 1 h, biotinylated secondary antibody for 30 min, and then streptavidin horseradish peroxidase for another 10 min.

    Techniques: Immunostaining, Immunohistochemistry

    CXCR1/2 antagonism by G31P inhibits NSCLC cell proliferation A. cells were treated with G31P (at concentrations of 0, 1, 10, 50, and 100 ng/ml) for 48 h. Cell proliferation was measured by CCK8 assay at 450 nm. G31P at 100 ng/ml showed significant inhibition of growth, (*, p

    Journal: Oncotarget

    Article Title: CXCR1/2 antagonism with CXCL8/Interleukin-8 analogue CXCL8(3–72)K11R/G31P restricts lung cancer growth by inhibiting tumor cell proliferation and suppressing angiogenesis

    doi:

    Figure Lengend Snippet: CXCR1/2 antagonism by G31P inhibits NSCLC cell proliferation A. cells were treated with G31P (at concentrations of 0, 1, 10, 50, and 100 ng/ml) for 48 h. Cell proliferation was measured by CCK8 assay at 450 nm. G31P at 100 ng/ml showed significant inhibition of growth, (*, p

    Article Snippet: Antibodies and other reagents The following antibodies were used: rabbit anti-CXCR2 (Abcam, USA), mouse anti-Ki67 (BD Biosciences, USA), rabbit anti-Akt, rabbit anti-phospho-Akt (Ser473), rabbit anti-ERK1/2, mouse anti-phospho-ERK1/2 and PARP (Cell Signaling Technologies, USA), mouse anti-GAPDH, rabbit anti-Caspase-8, rabbit anti-Bax and Bcl-2 (ProteinTech, USA), and rabbit anti-VEGF and NFкB (Santa Cruz), mouse anti-α-tubulin (Sigma Aldrich).

    Techniques: CCK-8 Assay, Inhibition

    G31P restricts migratory and chemokinetic capacities of H460 and A549 cells A. migration of H460 and A549 cells was assessed by wound healing assay and migration rate (%) was calculated and demonstrated in B. The data depicted represent the relative migration rate of H460 and A549 as quantified by measuring the distance covered by cells during 24 h. C and D. impact of G31P on chemotaxis of H460 and A549 cells, as determined using modified Boyden chamber microchemotaxis assays. CXCR1/2 and mock siRNA transfected cells were loaded into upper chamber and CXCL8/IL-8 (20 ng/ml) and G31P (100 ng/ml) were filled into lower chambers. Representative images were shown in C. Histograms in D show that G31P and siCXCR1/2 treatment inhibit lung cancer cell migration. Graph represents mean ± SEM from three independent experiments. Scale bar = 100 μm, and (*, p

    Journal: Oncotarget

    Article Title: CXCR1/2 antagonism with CXCL8/Interleukin-8 analogue CXCL8(3–72)K11R/G31P restricts lung cancer growth by inhibiting tumor cell proliferation and suppressing angiogenesis

    doi:

    Figure Lengend Snippet: G31P restricts migratory and chemokinetic capacities of H460 and A549 cells A. migration of H460 and A549 cells was assessed by wound healing assay and migration rate (%) was calculated and demonstrated in B. The data depicted represent the relative migration rate of H460 and A549 as quantified by measuring the distance covered by cells during 24 h. C and D. impact of G31P on chemotaxis of H460 and A549 cells, as determined using modified Boyden chamber microchemotaxis assays. CXCR1/2 and mock siRNA transfected cells were loaded into upper chamber and CXCL8/IL-8 (20 ng/ml) and G31P (100 ng/ml) were filled into lower chambers. Representative images were shown in C. Histograms in D show that G31P and siCXCR1/2 treatment inhibit lung cancer cell migration. Graph represents mean ± SEM from three independent experiments. Scale bar = 100 μm, and (*, p

    Article Snippet: Antibodies and other reagents The following antibodies were used: rabbit anti-CXCR2 (Abcam, USA), mouse anti-Ki67 (BD Biosciences, USA), rabbit anti-Akt, rabbit anti-phospho-Akt (Ser473), rabbit anti-ERK1/2, mouse anti-phospho-ERK1/2 and PARP (Cell Signaling Technologies, USA), mouse anti-GAPDH, rabbit anti-Caspase-8, rabbit anti-Bax and Bcl-2 (ProteinTech, USA), and rabbit anti-VEGF and NFкB (Santa Cruz), mouse anti-α-tubulin (Sigma Aldrich).

    Techniques: Migration, Wound Healing Assay, Chemotaxis Assay, Modification, Transfection

    CXCR1 and CXCR2 antagonism induces apoptosis in NSCLC cells A. H460 and A549 cells were treated with the indicated concentrations of G31P and assessed for uptake of dye Hoechst 33342. B. quantification data from A show percentages of apoptotic cells. Data were summarized from 3 independent experiments and error bars represent SEM. C. flow cytometric analysis of H460 cells treated with indicated concentrations of G31P by staining with Hoechst 33342. Results show a peak of intact cells on the left of each track and a second peak of apoptotic cells. D. impact of G31P on expression of the indicated apoptosis-associated proteins in H460 cells. G31P treatment augmented expression of cleaved PARP and Caspase-8, as well as Bax, but modestly reduced expression of the anti-apoptotic protein Bcl-2, α-Tubulin was used as loading control.

    Journal: Oncotarget

    Article Title: CXCR1/2 antagonism with CXCL8/Interleukin-8 analogue CXCL8(3–72)K11R/G31P restricts lung cancer growth by inhibiting tumor cell proliferation and suppressing angiogenesis

    doi:

    Figure Lengend Snippet: CXCR1 and CXCR2 antagonism induces apoptosis in NSCLC cells A. H460 and A549 cells were treated with the indicated concentrations of G31P and assessed for uptake of dye Hoechst 33342. B. quantification data from A show percentages of apoptotic cells. Data were summarized from 3 independent experiments and error bars represent SEM. C. flow cytometric analysis of H460 cells treated with indicated concentrations of G31P by staining with Hoechst 33342. Results show a peak of intact cells on the left of each track and a second peak of apoptotic cells. D. impact of G31P on expression of the indicated apoptosis-associated proteins in H460 cells. G31P treatment augmented expression of cleaved PARP and Caspase-8, as well as Bax, but modestly reduced expression of the anti-apoptotic protein Bcl-2, α-Tubulin was used as loading control.

    Article Snippet: Antibodies and other reagents The following antibodies were used: rabbit anti-CXCR2 (Abcam, USA), mouse anti-Ki67 (BD Biosciences, USA), rabbit anti-Akt, rabbit anti-phospho-Akt (Ser473), rabbit anti-ERK1/2, mouse anti-phospho-ERK1/2 and PARP (Cell Signaling Technologies, USA), mouse anti-GAPDH, rabbit anti-Caspase-8, rabbit anti-Bax and Bcl-2 (ProteinTech, USA), and rabbit anti-VEGF and NFкB (Santa Cruz), mouse anti-α-tubulin (Sigma Aldrich).

    Techniques: Flow Cytometry, Staining, Expressing

    Expression of CXCR1 and CXCR2 receptors in human lung cancer tissue and cell lines A. CXCR1 and CXCR2 mRNA was detected in a panel of non-small cell lung cancer cell lines as indicated. All five cell lines show CXCR1 and CXCR2 mRNA expression. B. CXCL1, 6, and 8 chemokines were detected from conditioned media of H460, A549, and H358 through ELISA. Data are summarized from 3 independent experiments; error bars represent SEM (standard error of the mean). C. CXCR1 and CXCR2 mRNA expression was quantified through PCR in human lung cancer tissue comparing to adjacent non-cancerous tissue from same patients ( n = 8). CXCR1 and CXCR2 mRNA was expressed more in cancer tissue than non-cancerous counterpart. Results represent mean ± SEM (*, p

    Journal: Oncotarget

    Article Title: CXCR1/2 antagonism with CXCL8/Interleukin-8 analogue CXCL8(3–72)K11R/G31P restricts lung cancer growth by inhibiting tumor cell proliferation and suppressing angiogenesis

    doi:

    Figure Lengend Snippet: Expression of CXCR1 and CXCR2 receptors in human lung cancer tissue and cell lines A. CXCR1 and CXCR2 mRNA was detected in a panel of non-small cell lung cancer cell lines as indicated. All five cell lines show CXCR1 and CXCR2 mRNA expression. B. CXCL1, 6, and 8 chemokines were detected from conditioned media of H460, A549, and H358 through ELISA. Data are summarized from 3 independent experiments; error bars represent SEM (standard error of the mean). C. CXCR1 and CXCR2 mRNA expression was quantified through PCR in human lung cancer tissue comparing to adjacent non-cancerous tissue from same patients ( n = 8). CXCR1 and CXCR2 mRNA was expressed more in cancer tissue than non-cancerous counterpart. Results represent mean ± SEM (*, p

    Article Snippet: Antibodies and other reagents The following antibodies were used: rabbit anti-CXCR2 (Abcam, USA), mouse anti-Ki67 (BD Biosciences, USA), rabbit anti-Akt, rabbit anti-phospho-Akt (Ser473), rabbit anti-ERK1/2, mouse anti-phospho-ERK1/2 and PARP (Cell Signaling Technologies, USA), mouse anti-GAPDH, rabbit anti-Caspase-8, rabbit anti-Bax and Bcl-2 (ProteinTech, USA), and rabbit anti-VEGF and NFкB (Santa Cruz), mouse anti-α-tubulin (Sigma Aldrich).

    Techniques: Expressing, Enzyme-linked Immunosorbent Assay, Polymerase Chain Reaction

    Upregulation of CXCR2 expression in podocytes cultured with conditioned medium of mesangial cells exposed to cIgA1 from IgAN patients (IgAN-HMCM) and rhTGF-β1. The mRNA (A) and protein (B) expression of CXCR2 were significantly increased in podocytes cultured with conditioned medium of mesangial cells exposed to cIgA1 from IgAN patients (IgAN-HMCM) than from healthy controls (HC-HMCM). Similar findings were observed in podocytes cultured with 2 ng/ml TGF-β1 (C), but not under rhCXCL1.

    Journal: PLoS ONE

    Article Title: Synergistic Effect of Mesangial Cell-Induced CXCL1 and TGF-?1 in Promoting Podocyte Loss in IgA Nephropathy

    doi: 10.1371/journal.pone.0073425

    Figure Lengend Snippet: Upregulation of CXCR2 expression in podocytes cultured with conditioned medium of mesangial cells exposed to cIgA1 from IgAN patients (IgAN-HMCM) and rhTGF-β1. The mRNA (A) and protein (B) expression of CXCR2 were significantly increased in podocytes cultured with conditioned medium of mesangial cells exposed to cIgA1 from IgAN patients (IgAN-HMCM) than from healthy controls (HC-HMCM). Similar findings were observed in podocytes cultured with 2 ng/ml TGF-β1 (C), but not under rhCXCL1.

    Article Snippet: After washing with 0.01 M PBS, the slides were co-incubated with mouse anti-podocylxin antibody (Abcam) and rabbit anti-CXCR2 antibody (Abcam), followed by incubation with TRITC-conjugate goat anti-mouse IgG and FITC-conjugate goat anti-rabbit IgG.

    Techniques: Expressing, Cell Culture

    Effect of CXCR2 downregulation and inhibition In vitro (A-B) properties of shRNA clones (clone-1 and -3) compared to scrambled control: (A) mRNA expression by reverse-transcription PCR relative to standard, (B) invasion assay using co-cultures with cancer-associated fibroblasts (CAF) and mitomycin C to block tumor cell proliferation. In vitro CXCR2 inhibition with CXCR2-antagonist (C, D): invasion assay using co-cultures of 344P (C) and 344SQ (D) cell lines treated with increasing concentrations of SB225002. In vivo properties of shRNA clones (clone-1 and -3) compared to scrambled control (E, F): number of left lung tumor nodules, (E) number of distant metastases (F). Median and inter-quartile range are shown in the dot plots (E, F). Wilcoxon rank sum test (A, B, E, and F) between scrambled control and shRNA single clones (clone-1 and clone-3) or between different concentrations of SB225002and the control (C, D).

    Journal: Cancer research

    Article Title: CXCR2 expression in tumor cells is a poor prognostic factor and promotes invasion and metastasis in lung adenocarcinoma

    doi: 10.1158/0008-5472.CAN-12-0263

    Figure Lengend Snippet: Effect of CXCR2 downregulation and inhibition In vitro (A-B) properties of shRNA clones (clone-1 and -3) compared to scrambled control: (A) mRNA expression by reverse-transcription PCR relative to standard, (B) invasion assay using co-cultures with cancer-associated fibroblasts (CAF) and mitomycin C to block tumor cell proliferation. In vitro CXCR2 inhibition with CXCR2-antagonist (C, D): invasion assay using co-cultures of 344P (C) and 344SQ (D) cell lines treated with increasing concentrations of SB225002. In vivo properties of shRNA clones (clone-1 and -3) compared to scrambled control (E, F): number of left lung tumor nodules, (E) number of distant metastases (F). Median and inter-quartile range are shown in the dot plots (E, F). Wilcoxon rank sum test (A, B, E, and F) between scrambled control and shRNA single clones (clone-1 and clone-3) or between different concentrations of SB225002and the control (C, D).

    Article Snippet: A small molecule antagonist of CXCR2 (SB225002) (Calbiochem) was used to inhibit CXCR2 invasive properties of 344P cells in Boyden chamber assays and included 344SQ cells as positive controls ( , ).

    Techniques: Inhibition, In Vitro, shRNA, Clone Assay, Expressing, Polymerase Chain Reaction, Invasion Assay, Blocking Assay, In Vivo

    CXCR loss is not inhibited by a CXCR2 antagonist. Neutrophils were highly purified by negative magnetic selection, and pretreated with buffer or the CXCR2 antagonist, SB225002, prior to stimulation with pLPS or CXCL8. Following 1 hr of stimulation with

    Journal:

    Article Title: Regulation of human neutrophil chemokine receptor expression and function by activation of Toll-like receptors 2 and 4

    doi: 10.1111/j.1365-2567.2005.02133.x

    Figure Lengend Snippet: CXCR loss is not inhibited by a CXCR2 antagonist. Neutrophils were highly purified by negative magnetic selection, and pretreated with buffer or the CXCR2 antagonist, SB225002, prior to stimulation with pLPS or CXCL8. Following 1 hr of stimulation with

    Article Snippet: The CXCR2 antagonist SB225002 was purchased from Calbiochem (Merck Biosciences Ltd, Nottingham, UK), and was dissolved in dimethylsulphoxide.

    Techniques: Purification, Selection

    Systemic inhibition of CXCR2 results in functional improvement in MOG 35-55 peptide induced EAE animals (A) Injection of MOG 35-55 peptide induces a robust functional deficit after 7-10 days that plateaus in the 2 nd week (circles). Systemic daily delivery of CXCR2 inhibitor (20ng/kg) results in a slowing of disease progression and functional recovery that is maintained with continuous treatment (squares). Data represent mean clinical scores for 12 animals from 3 separate studies. Luxol fast blue staining on transverse spinal cord sections showed areas of demyelination in control EAE animals (B) that were significantly reduced in animals treated with CXCR2 antagonists (C). Control EAE animals showed significant cellular infiltrates in areas of demyelination (D) that were reduced in animals treated with CXCR2 antagonists (E). Quantitation of the relative lesion load in the spinal cord of control EAE animals and CXCR2 antagonist treated animals at day 28 after immunization (F). Data represents the mean +/− standard deviation taken from 20 Luxol stained sections from each of 4 animals in each group. p= 0.0001. Bar = 100μm in B and C and 50μm in D and E.

    Journal: Experimental neurology

    Article Title: Inhibition of CXCR2 signaling promotes recovery in models of Multiple Sclerosis

    doi: 10.1016/j.expneurol.2009.07.010

    Figure Lengend Snippet: Systemic inhibition of CXCR2 results in functional improvement in MOG 35-55 peptide induced EAE animals (A) Injection of MOG 35-55 peptide induces a robust functional deficit after 7-10 days that plateaus in the 2 nd week (circles). Systemic daily delivery of CXCR2 inhibitor (20ng/kg) results in a slowing of disease progression and functional recovery that is maintained with continuous treatment (squares). Data represent mean clinical scores for 12 animals from 3 separate studies. Luxol fast blue staining on transverse spinal cord sections showed areas of demyelination in control EAE animals (B) that were significantly reduced in animals treated with CXCR2 antagonists (C). Control EAE animals showed significant cellular infiltrates in areas of demyelination (D) that were reduced in animals treated with CXCR2 antagonists (E). Quantitation of the relative lesion load in the spinal cord of control EAE animals and CXCR2 antagonist treated animals at day 28 after immunization (F). Data represents the mean +/− standard deviation taken from 20 Luxol stained sections from each of 4 animals in each group. p= 0.0001. Bar = 100μm in B and C and 50μm in D and E.

    Article Snippet: To determine whether CXCR2 inhibition in the LPC lesions was primarily local or systemic, the CXCR2 antagonist was delivered IP directly after lysolecithin lesions ( ).

    Techniques: Inhibition, Functional Assay, Injection, Staining, Quantitation Assay, Standard Deviation

    Long-term but not short-term treatment with CXCR2 antagonist results in sustained remyelination EAE animals treated with CXCR2 antagonist systemically for a period of 2 weeks and then removed from treatment demonstrated persistent remyelination 1 week later (A). By contrast, ., EAE animals removed from CXCR2 antagonist treatment after 1 week of treatment demonstrated a lack of remyelination, although there was an apparent reduction in inflammatory cell infiltration (B). . Bar = 50μm.

    Journal: Experimental neurology

    Article Title: Inhibition of CXCR2 signaling promotes recovery in models of Multiple Sclerosis

    doi: 10.1016/j.expneurol.2009.07.010

    Figure Lengend Snippet: Long-term but not short-term treatment with CXCR2 antagonist results in sustained remyelination EAE animals treated with CXCR2 antagonist systemically for a period of 2 weeks and then removed from treatment demonstrated persistent remyelination 1 week later (A). By contrast, ., EAE animals removed from CXCR2 antagonist treatment after 1 week of treatment demonstrated a lack of remyelination, although there was an apparent reduction in inflammatory cell infiltration (B). . Bar = 50μm.

    Article Snippet: To determine whether CXCR2 inhibition in the LPC lesions was primarily local or systemic, the CXCR2 antagonist was delivered IP directly after lysolecithin lesions ( ).

    Techniques:

    Systemic treatment with CXCR2 antagonists result in increased MBP and decreased Iba1 expression in EAE animals Control EAE animals demonstrated reduced MBP labeling (A and C) and high levels of Iba1+ cells in lesion areas (arrowheads) (E and G. By contrast, animals treated with CXCR2 antagonist demonstrated higher levels of MBP expression (B and D) and fewer Iba1+ cells (F and H)in lesion areas (arrowheads). The number of Iba1+ cells in CXCR2 antagonist treated EAE animals was decreased by 50 +/− 5% in grey and white matter regions compared to vehicle treated animals (G and H). . Bar = 500μm in A, B, E and F and 200μm in C, D, G and H. .

    Journal: Experimental neurology

    Article Title: Inhibition of CXCR2 signaling promotes recovery in models of Multiple Sclerosis

    doi: 10.1016/j.expneurol.2009.07.010

    Figure Lengend Snippet: Systemic treatment with CXCR2 antagonists result in increased MBP and decreased Iba1 expression in EAE animals Control EAE animals demonstrated reduced MBP labeling (A and C) and high levels of Iba1+ cells in lesion areas (arrowheads) (E and G. By contrast, animals treated with CXCR2 antagonist demonstrated higher levels of MBP expression (B and D) and fewer Iba1+ cells (F and H)in lesion areas (arrowheads). The number of Iba1+ cells in CXCR2 antagonist treated EAE animals was decreased by 50 +/− 5% in grey and white matter regions compared to vehicle treated animals (G and H). . Bar = 500μm in A, B, E and F and 200μm in C, D, G and H. .

    Article Snippet: To determine whether CXCR2 inhibition in the LPC lesions was primarily local or systemic, the CXCR2 antagonist was delivered IP directly after lysolecithin lesions ( ).

    Techniques: Expressing, Labeling

    Local delivery of CXCR2 antagonists enhances remyelination in LPC lesions Labeling of 1 μm sections through the middle LPC lesion area with Toluidine blue (A and B) demonstrates an increase in the number of myelinated axonal profiles in animals that received a single injection of a CXCR2 antagonist 2 days after LPC injection. Ultrastructural analyses confirmed the presence of unmyelinated (asterisks) and thinly myelinated (arrows) axons in experimental animals (D). Lesions from control animals contain largely unmyelinated (asterisks) axons and a higher number of cell bodies (C). Quantification of the proportion of remyelinated versus demyelinated axons in lesions from vehicle and small molecule antagonist treated animals demonstrated a 20-fold increase (p=0.002) in remyelinated axons versus control with direct delivery into LPC lesions and a 9-fold increase in remyelinated axons (p=0.004) with systemic delivery (E). Bar = 20μm in A and B and 2μm in C and D.

    Journal: Experimental neurology

    Article Title: Inhibition of CXCR2 signaling promotes recovery in models of Multiple Sclerosis

    doi: 10.1016/j.expneurol.2009.07.010

    Figure Lengend Snippet: Local delivery of CXCR2 antagonists enhances remyelination in LPC lesions Labeling of 1 μm sections through the middle LPC lesion area with Toluidine blue (A and B) demonstrates an increase in the number of myelinated axonal profiles in animals that received a single injection of a CXCR2 antagonist 2 days after LPC injection. Ultrastructural analyses confirmed the presence of unmyelinated (asterisks) and thinly myelinated (arrows) axons in experimental animals (D). Lesions from control animals contain largely unmyelinated (asterisks) axons and a higher number of cell bodies (C). Quantification of the proportion of remyelinated versus demyelinated axons in lesions from vehicle and small molecule antagonist treated animals demonstrated a 20-fold increase (p=0.002) in remyelinated axons versus control with direct delivery into LPC lesions and a 9-fold increase in remyelinated axons (p=0.004) with systemic delivery (E). Bar = 20μm in A and B and 2μm in C and D.

    Article Snippet: To determine whether CXCR2 inhibition in the LPC lesions was primarily local or systemic, the CXCR2 antagonist was delivered IP directly after lysolecithin lesions ( ).

    Techniques: Labeling, Injection

    Systemic delivery of CXCR2 antagonists has limited effect on repair of LPC lesions Labeling of 1 μm sections with toluidine blue (A and B) demonstrated no significant change in overall lesion size in animals treated daily with IP injections of CXCR2 antagonist, although experimental animals demonstrated an apparent reduction in the cellularity of lesions (B and D). Electron microscopy confirmed the limited effect of systemic inhibition of CXCR2 in promoting LPC lesion repair (C and D). Occasional thinly myelinated axons (arrows) were present scattered throughout the lesion in CXCR2 antagonist treated animals (D) that were absent in controls (C) which had a higher number of unmyelinated axons (asterisks). The myelin surrounding remyelinating axons was frequently uneven, possibly reflecting active remyelination. Bar in A and B = 20 μm and C and D = 2μm.

    Journal: Experimental neurology

    Article Title: Inhibition of CXCR2 signaling promotes recovery in models of Multiple Sclerosis

    doi: 10.1016/j.expneurol.2009.07.010

    Figure Lengend Snippet: Systemic delivery of CXCR2 antagonists has limited effect on repair of LPC lesions Labeling of 1 μm sections with toluidine blue (A and B) demonstrated no significant change in overall lesion size in animals treated daily with IP injections of CXCR2 antagonist, although experimental animals demonstrated an apparent reduction in the cellularity of lesions (B and D). Electron microscopy confirmed the limited effect of systemic inhibition of CXCR2 in promoting LPC lesion repair (C and D). Occasional thinly myelinated axons (arrows) were present scattered throughout the lesion in CXCR2 antagonist treated animals (D) that were absent in controls (C) which had a higher number of unmyelinated axons (asterisks). The myelin surrounding remyelinating axons was frequently uneven, possibly reflecting active remyelination. Bar in A and B = 20 μm and C and D = 2μm.

    Article Snippet: To determine whether CXCR2 inhibition in the LPC lesions was primarily local or systemic, the CXCR2 antagonist was delivered IP directly after lysolecithin lesions ( ).

    Techniques: Labeling, Electron Microscopy, Inhibition

    Inhibition of CXCR2 promotes the differentiation of spinal cord OPCs in vitro Spinal cord mixed cell cultures (P3) grown for 5 days in vitro contain 35% A2B5+ cells (A) and approx 19% O1+ (D) and 17% MBP+ cells (G). Exposure to 0.05ng/ml CXCL1 for 24hrs results in an increase in A2B5+ cells (46%) (B) but a decrease in O1+ (12%) (E) and MBP+ (12%) cells (H). By contrast, exposure to CXCR2 antagonist (40ng/ml) for 24hrs results in a decrease in A2B5+ cells (26%) (C) but an increase in O1+ (31%) (p=0.05) (F) and MBP+ cells (50%) (p=0.007) (I) to the proportion of immunopostive cells compared to DAPI+ cell numbers (J). Data represents mean +/− standard deviation taken from 2 coverslips from at least 3 separate experiments. Bar = 20 μm in A-F and Bar = 40μm in G-I.

    Journal: Experimental neurology

    Article Title: Inhibition of CXCR2 signaling promotes recovery in models of Multiple Sclerosis

    doi: 10.1016/j.expneurol.2009.07.010

    Figure Lengend Snippet: Inhibition of CXCR2 promotes the differentiation of spinal cord OPCs in vitro Spinal cord mixed cell cultures (P3) grown for 5 days in vitro contain 35% A2B5+ cells (A) and approx 19% O1+ (D) and 17% MBP+ cells (G). Exposure to 0.05ng/ml CXCL1 for 24hrs results in an increase in A2B5+ cells (46%) (B) but a decrease in O1+ (12%) (E) and MBP+ (12%) cells (H). By contrast, exposure to CXCR2 antagonist (40ng/ml) for 24hrs results in a decrease in A2B5+ cells (26%) (C) but an increase in O1+ (31%) (p=0.05) (F) and MBP+ cells (50%) (p=0.007) (I) to the proportion of immunopostive cells compared to DAPI+ cell numbers (J). Data represents mean +/− standard deviation taken from 2 coverslips from at least 3 separate experiments. Bar = 20 μm in A-F and Bar = 40μm in G-I.

    Article Snippet: To determine whether CXCR2 inhibition in the LPC lesions was primarily local or systemic, the CXCR2 antagonist was delivered IP directly after lysolecithin lesions ( ).

    Techniques: Inhibition, In Vitro, Standard Deviation

    Systemic inhibition of CXCR2 results in decreased cell infiltration and increased remyelination in MOG 35-55 induced EAE In control EAE animals, 28 days after disease induction, lesion areas in the spinal cord were characterized by demyelination and cellular infiltrates (A). By contrast, in EAE animals treated daily with CXCR2 antagonists the extent of demyelination and cellular infiltration is substantially reduced (B). Ultrastructural studies confirmed the presence of extensive demyelinated axons (asterisks) in lesion areas associated with substantial cell infiltration (C). In animals treated with CXCR2 antagonist (D) the number of demyelinated axons was reduced and the number of thinly myelinated (arrows) axons increased consistent with widespread remyelination. Quantification of the relative numbers of demyelinated (asterisks), remyelinated (arrows), and unaffected axons in lesion areas of control CXCR2 antagonist treated EAE animals (E). The number and proportion of demyelinated axons is significantly decreased in CXCR2 antagonist treated animals compared to controls (90% vs 25%) while the number and proportion of remyelinated axons was significantly increased (10% vs 65%) (p= 0.000002) (E). The total number of axons was not significantly different in treated and untreated animals and the proportion of unaffected axons was below 10% in both groups (E). Remyelinated axons were characterized as having thinner myelin sheaths and quantification of 20 axons per lesion from 5 lesion areas in each of 3 animals demonstrated a significant reduction (p= 0.02) in myelin thickness/axon diameter ratio in treated animals (F). Control EAE animals had a ratio close to 1 suggesting little remyelination while CXCR2 antagonist treated animals had a mean ratio around 3, indicative of substantially thinner myelin sheaths (F). Bar = 75μm in A and B and 2 μm in C and D.

    Journal: Experimental neurology

    Article Title: Inhibition of CXCR2 signaling promotes recovery in models of Multiple Sclerosis

    doi: 10.1016/j.expneurol.2009.07.010

    Figure Lengend Snippet: Systemic inhibition of CXCR2 results in decreased cell infiltration and increased remyelination in MOG 35-55 induced EAE In control EAE animals, 28 days after disease induction, lesion areas in the spinal cord were characterized by demyelination and cellular infiltrates (A). By contrast, in EAE animals treated daily with CXCR2 antagonists the extent of demyelination and cellular infiltration is substantially reduced (B). Ultrastructural studies confirmed the presence of extensive demyelinated axons (asterisks) in lesion areas associated with substantial cell infiltration (C). In animals treated with CXCR2 antagonist (D) the number of demyelinated axons was reduced and the number of thinly myelinated (arrows) axons increased consistent with widespread remyelination. Quantification of the relative numbers of demyelinated (asterisks), remyelinated (arrows), and unaffected axons in lesion areas of control CXCR2 antagonist treated EAE animals (E). The number and proportion of demyelinated axons is significantly decreased in CXCR2 antagonist treated animals compared to controls (90% vs 25%) while the number and proportion of remyelinated axons was significantly increased (10% vs 65%) (p= 0.000002) (E). The total number of axons was not significantly different in treated and untreated animals and the proportion of unaffected axons was below 10% in both groups (E). Remyelinated axons were characterized as having thinner myelin sheaths and quantification of 20 axons per lesion from 5 lesion areas in each of 3 animals demonstrated a significant reduction (p= 0.02) in myelin thickness/axon diameter ratio in treated animals (F). Control EAE animals had a ratio close to 1 suggesting little remyelination while CXCR2 antagonist treated animals had a mean ratio around 3, indicative of substantially thinner myelin sheaths (F). Bar = 75μm in A and B and 2 μm in C and D.

    Article Snippet: To determine whether CXCR2 inhibition in the LPC lesions was primarily local or systemic, the CXCR2 antagonist was delivered IP directly after lysolecithin lesions ( ).

    Techniques: Inhibition

    Local delivery of anti-CXCR2 antibodies reduces the size of LPC induced demyelinated lesions Vibratome sections labeled with Luxol fast blue (A-D) of LPC lesions 10 days after induction treated with isotype control IgG (A and C) or neutralizing antibodies against CXCR2 (R D Systems; 100μg/ml) (B and D) 2 days after lesion induction. Longitudinal sections (A and B) and cross sections (C and D) from mid-lesion areas demonstrate a reduction in lesion volume in anti-CXCR2 treated animals (B and D) compared to isotype controls (A and C). Three dimension reconstruction of LPC lesions (yellow) from isotype controls (E) and anti- CXCR2 treated animals (F). Comparison of the average LPC lesion volume in IgG control and anti-CXCR2 treated animals. n = 8 p= 0.005. Bar = 100μm in A-D (G). In E and F, blue = central canal, yellow = lesion, and red = outline of the spinal cord.

    Journal: Experimental neurology

    Article Title: Inhibition of CXCR2 signaling promotes recovery in models of Multiple Sclerosis

    doi: 10.1016/j.expneurol.2009.07.010

    Figure Lengend Snippet: Local delivery of anti-CXCR2 antibodies reduces the size of LPC induced demyelinated lesions Vibratome sections labeled with Luxol fast blue (A-D) of LPC lesions 10 days after induction treated with isotype control IgG (A and C) or neutralizing antibodies against CXCR2 (R D Systems; 100μg/ml) (B and D) 2 days after lesion induction. Longitudinal sections (A and B) and cross sections (C and D) from mid-lesion areas demonstrate a reduction in lesion volume in anti-CXCR2 treated animals (B and D) compared to isotype controls (A and C). Three dimension reconstruction of LPC lesions (yellow) from isotype controls (E) and anti- CXCR2 treated animals (F). Comparison of the average LPC lesion volume in IgG control and anti-CXCR2 treated animals. n = 8 p= 0.005. Bar = 100μm in A-D (G). In E and F, blue = central canal, yellow = lesion, and red = outline of the spinal cord.

    Article Snippet: To determine whether CXCR2 inhibition in the LPC lesions was primarily local or systemic, the CXCR2 antagonist was delivered IP directly after lysolecithin lesions ( ).

    Techniques: Labeling

    CXCR2 antagonism blocks SCI-induced BM neutrophil mobilization and granulocytosis in C3ar1 –/– mice. ( A ) Representative flow cytometry plots showing the Ly6G + SSC hi cell population in the blood of WT and C3ar1 –/– mice at 2 hours after SCI, and following treatment with either vehicle (top) or CXCR2 antagonist (CXCR2-A; bottom). ( B ) Quantification of Ly6G + SSC hi cell numbers in the circulating blood. Note that CXCR2-A treatment rescues the SCI-induced granulocytosis phenotype of C3ar1 –/– mice. ( C ) CXCR2 antagonism retains neutrophils in the bone marrow of C3ar1 –/– mice with SCI. Bar graphs are mean ± SEM, with data points representing individual mice within each cohort ( n = 4 per group). * P

    Journal: JCI Insight

    Article Title: Complement receptor C3aR1 controls neutrophil mobilization following spinal cord injury through physiological antagonism of CXCR2

    doi: 10.1172/jci.insight.98254

    Figure Lengend Snippet: CXCR2 antagonism blocks SCI-induced BM neutrophil mobilization and granulocytosis in C3ar1 –/– mice. ( A ) Representative flow cytometry plots showing the Ly6G + SSC hi cell population in the blood of WT and C3ar1 –/– mice at 2 hours after SCI, and following treatment with either vehicle (top) or CXCR2 antagonist (CXCR2-A; bottom). ( B ) Quantification of Ly6G + SSC hi cell numbers in the circulating blood. Note that CXCR2-A treatment rescues the SCI-induced granulocytosis phenotype of C3ar1 –/– mice. ( C ) CXCR2 antagonism retains neutrophils in the bone marrow of C3ar1 –/– mice with SCI. Bar graphs are mean ± SEM, with data points representing individual mice within each cohort ( n = 4 per group). * P

    Article Snippet: Chemokines acting via CXCR2 and CXCR4 control the release of neutrophils from the bone marrow and their return following senescence.

    Techniques: Mouse Assay, Flow Cytometry, Cytometry

    C3aR1 controls the responsiveness of BM neutrophils to chemotactic signals. ( A ) Chemotaxis assays of Ly6G-enriched BM neutrophils toward CXCL1. Note that CXCL1-induced cell migration is selectively abolished in WT mice with C3aR1 coactivation (E7 treatment) and/or CXCR2 antagonism (CXCR2-A). Error bars are SEM ( n = 5–7 per group). ** P

    Journal: JCI Insight

    Article Title: Complement receptor C3aR1 controls neutrophil mobilization following spinal cord injury through physiological antagonism of CXCR2

    doi: 10.1172/jci.insight.98254

    Figure Lengend Snippet: C3aR1 controls the responsiveness of BM neutrophils to chemotactic signals. ( A ) Chemotaxis assays of Ly6G-enriched BM neutrophils toward CXCL1. Note that CXCL1-induced cell migration is selectively abolished in WT mice with C3aR1 coactivation (E7 treatment) and/or CXCR2 antagonism (CXCR2-A). Error bars are SEM ( n = 5–7 per group). ** P

    Article Snippet: Chemokines acting via CXCR2 and CXCR4 control the release of neutrophils from the bone marrow and their return following senescence.

    Techniques: Chemotaxis Assay, Migration, Mouse Assay

    A novel mechanism underlying the contribution of primary tumor to pre-metastatic niche formation and liver metastasis Primary malignant cell-secreted VEGF-A stimulates primary tumor-associated macrophages to produce CXCL1 that recruits CXCR2-positive MDSCs from circulatory system into pre-metastatic liver. MDSCs in pre-metastatic liver promote liver metastases via induction of cancer cell survival in a mouse orthotopic model of CRC.

    Journal: Cancer research

    Article Title: CXCL1 is critical for pre-metastatic niche formation and metastasis in colorectal cancer

    doi: 10.1158/0008-5472.CAN-16-3199

    Figure Lengend Snippet: A novel mechanism underlying the contribution of primary tumor to pre-metastatic niche formation and liver metastasis Primary malignant cell-secreted VEGF-A stimulates primary tumor-associated macrophages to produce CXCL1 that recruits CXCR2-positive MDSCs from circulatory system into pre-metastatic liver. MDSCs in pre-metastatic liver promote liver metastases via induction of cancer cell survival in a mouse orthotopic model of CRC.

    Article Snippet: For CXCR2 antagonist (SB225002, Sigma-Aldrich) treatment, male NSG mice injected with HCT-116 cells were treated with SB225002 at 400 μg/100 μL PBS per mouse or vehicle by daily intraperitoneal injection for 4 or 7 weeks after injection.

    Techniques:

    Lack of effect of deletion of CXCR2 receptors on changes in lymphatics and blood vessels induced by IL-1β overexpression. Tracheal whole mounts from CCSP/IL-1β bi-transgenic mice ( A ) and CCSP/IL-1β/CXCR2 −/− triple-transgenic

    Journal: The American Journal of Pathology

    Article Title: Transgenic Overexpression of Interleukin-1? Induces Persistent Lymphangiogenesis But Not Angiogenesis in Mouse Airways

    doi: 10.1016/j.ajpath.2012.12.003

    Figure Lengend Snippet: Lack of effect of deletion of CXCR2 receptors on changes in lymphatics and blood vessels induced by IL-1β overexpression. Tracheal whole mounts from CCSP/IL-1β bi-transgenic mice ( A ) and CCSP/IL-1β/CXCR2 −/− triple-transgenic

    Article Snippet: In mice, CXCR2 receptors (also known as IL8R1) are the dominant receptors responsible for chemotaxis of neutrophils to sites of inflammation.

    Techniques: Over Expression, Transgenic Assay, Mouse Assay

    A CXCR2 antagonist SB625610 significantly abrogates mammary cancer cell line migration. (A) Representative photomicrographs of PyMT-Luc cell migration to MSC-CM in the presence or absence of SB625610 (1μM). (B) Analysis of PyMT-Luc migration in

    Journal: Cancer Letters

    Article Title: Mesenchymal Stem Cells promote mammary cancer cell migration in vitro via the CXCR2 receptor

    doi: 10.1016/j.canlet.2011.04.018

    Figure Lengend Snippet: A CXCR2 antagonist SB625610 significantly abrogates mammary cancer cell line migration. (A) Representative photomicrographs of PyMT-Luc cell migration to MSC-CM in the presence or absence of SB625610 (1μM). (B) Analysis of PyMT-Luc migration in

    Article Snippet: Antibodies to phosphorylated CXCR2 (ab61100, Abcam) or IgG controls diluted 1:500 in blocking solution were then added to cells for 1 hour at room temperature with shaking.

    Techniques: Migration

    The CXCR2 cognate ligands, CXCL1 and CXCL5 are expressed by MSCs. (A) Cytokine array analysis of factors present in the MSC conditioned media. Controls and antibodies to chemokines are immobilized to the array in duplicate. Numbers highlight areas of

    Journal: Cancer Letters

    Article Title: Mesenchymal Stem Cells promote mammary cancer cell migration in vitro via the CXCR2 receptor

    doi: 10.1016/j.canlet.2011.04.018

    Figure Lengend Snippet: The CXCR2 cognate ligands, CXCL1 and CXCL5 are expressed by MSCs. (A) Cytokine array analysis of factors present in the MSC conditioned media. Controls and antibodies to chemokines are immobilized to the array in duplicate. Numbers highlight areas of

    Article Snippet: Antibodies to phosphorylated CXCR2 (ab61100, Abcam) or IgG controls diluted 1:500 in blocking solution were then added to cells for 1 hour at room temperature with shaking.

    Techniques:

    Mammary cancer cell lines express CXCR2. (A) RT-PCR analysis of CXCR2 mRNA expression. Total RNA isolated from a CXCR2 null mouse (CXCR2 −/− ) was used as a negative control while LLC was used as a positive control. (B) Immunoblot analysis

    Journal: Cancer Letters

    Article Title: Mesenchymal Stem Cells promote mammary cancer cell migration in vitro via the CXCR2 receptor

    doi: 10.1016/j.canlet.2011.04.018

    Figure Lengend Snippet: Mammary cancer cell lines express CXCR2. (A) RT-PCR analysis of CXCR2 mRNA expression. Total RNA isolated from a CXCR2 null mouse (CXCR2 −/− ) was used as a negative control while LLC was used as a positive control. (B) Immunoblot analysis

    Article Snippet: Antibodies to phosphorylated CXCR2 (ab61100, Abcam) or IgG controls diluted 1:500 in blocking solution were then added to cells for 1 hour at room temperature with shaking.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Isolation, Negative Control, Positive Control

    CXCR2 mediates the migration of mammary cancer cell lines. (A, B) Representative photomicrographs of PyMT-Luc (A) and 17L3C-Luc (B) cell migration to MSC-CM in the presence or absence of a CXCR-2 neutralizing antibody (50μg/ml). (C, D) Analysis

    Journal: Cancer Letters

    Article Title: Mesenchymal Stem Cells promote mammary cancer cell migration in vitro via the CXCR2 receptor

    doi: 10.1016/j.canlet.2011.04.018

    Figure Lengend Snippet: CXCR2 mediates the migration of mammary cancer cell lines. (A, B) Representative photomicrographs of PyMT-Luc (A) and 17L3C-Luc (B) cell migration to MSC-CM in the presence or absence of a CXCR-2 neutralizing antibody (50μg/ml). (C, D) Analysis

    Article Snippet: Antibodies to phosphorylated CXCR2 (ab61100, Abcam) or IgG controls diluted 1:500 in blocking solution were then added to cells for 1 hour at room temperature with shaking.

    Techniques: Migration

    Resting CXCR2 KO mice show limited differences in neutrophil, mast cell, macrophage, eosinophil or blood vessel numbers in subcutaneous fat . Skin was dissected from adult female mice before processing and staining (scale bars: 50 μm) to detect (A) neutrophils, (B) mast cells, (C) macrophages, and (D) von Willebrand factor positive vessels from wild‐type and CXCR2 KO mice. (E) The numbers of mast cells (i), macrophages (ii), and blood vessels (iii) were quantified and plotted as the mean number per field of view. (F) (i) Mast cell and (ii) macrophage numbers were also expressed as ratio of cell number to adipocyte number. (G and H) Flow cytometry was used to analyze leukocyte content of skin, inguinal WAT, and perigonadal WAT. (G) CXCR2 positive staining in CD45+CD11b+Ly6G+ cells from skin samples. (H) Quantification of neutrophil (CD45+CD11b+Ly6g+), macrophage (CD45+CD11b+SiglecF‐F4/80+), eosinophil (CD45+CD11b+F480+SiglecF+) and mast cell (CD45+CD117+) content of skin, inguinal WAT, and perigonadal WAT. Data are plotted as mean (± sem ), where each symbol represents data from an individual mouse and analyzed using an unpaired t test, representative of two separate experiments (A‐F), ns = not significant

    Journal: Journal of Leukocyte Biology

    Article Title: The chemokine receptor CXCR2 contributes to murine adipocyte development. The chemokine receptor CXCR2 contributes to murine adipocyte development

    doi: 10.1002/JLB.1A0618-216RR

    Figure Lengend Snippet: Resting CXCR2 KO mice show limited differences in neutrophil, mast cell, macrophage, eosinophil or blood vessel numbers in subcutaneous fat . Skin was dissected from adult female mice before processing and staining (scale bars: 50 μm) to detect (A) neutrophils, (B) mast cells, (C) macrophages, and (D) von Willebrand factor positive vessels from wild‐type and CXCR2 KO mice. (E) The numbers of mast cells (i), macrophages (ii), and blood vessels (iii) were quantified and plotted as the mean number per field of view. (F) (i) Mast cell and (ii) macrophage numbers were also expressed as ratio of cell number to adipocyte number. (G and H) Flow cytometry was used to analyze leukocyte content of skin, inguinal WAT, and perigonadal WAT. (G) CXCR2 positive staining in CD45+CD11b+Ly6G+ cells from skin samples. (H) Quantification of neutrophil (CD45+CD11b+Ly6g+), macrophage (CD45+CD11b+SiglecF‐F4/80+), eosinophil (CD45+CD11b+F480+SiglecF+) and mast cell (CD45+CD117+) content of skin, inguinal WAT, and perigonadal WAT. Data are plotted as mean (± sem ), where each symbol represents data from an individual mouse and analyzed using an unpaired t test, representative of two separate experiments (A‐F), ns = not significant

    Article Snippet: This suggests that at around 6 wk of age adipocytes in the inguinal fat depot increase in size during transition to adulthood, a time period key to inguinal mammary gland maturation, and it is at this stage that CXCR2 may play a role in inguinal adipogenesis.

    Techniques: Mouse Assay, Staining, Flow Cytometry, Cytometry

    CXCR2 KO male mice have no significant change in adipocyte size compared to wild‐types . (A) Skin and adipose depots were dissected from adult male mice ( > 8 wk) before processing and H E staining of sections from wild‐type and CXCR2 KO mice. Brightfield microscopy was used to take images of the skin, inguinal adipose, or perigonadal adipose tissue (scale bars: 50 μm). (B) Adipose thickness and (C) individual adipocyte area for (i) inguinal and (ii) perigonadal sites were measured. (D) Quantitative real‐time PCR was used to analyze CXCR2 expression in skin or adipose tissues from male and female mice, relative to the house‐keeping gene, GAPDH. Data are plotted as mean (± sem ), where each symbol represents data from an individual mouse and analyzed using an unpaired t test or Welch's t test (D), ns = not significant

    Journal: Journal of Leukocyte Biology

    Article Title: The chemokine receptor CXCR2 contributes to murine adipocyte development. The chemokine receptor CXCR2 contributes to murine adipocyte development

    doi: 10.1002/JLB.1A0618-216RR

    Figure Lengend Snippet: CXCR2 KO male mice have no significant change in adipocyte size compared to wild‐types . (A) Skin and adipose depots were dissected from adult male mice ( > 8 wk) before processing and H E staining of sections from wild‐type and CXCR2 KO mice. Brightfield microscopy was used to take images of the skin, inguinal adipose, or perigonadal adipose tissue (scale bars: 50 μm). (B) Adipose thickness and (C) individual adipocyte area for (i) inguinal and (ii) perigonadal sites were measured. (D) Quantitative real‐time PCR was used to analyze CXCR2 expression in skin or adipose tissues from male and female mice, relative to the house‐keeping gene, GAPDH. Data are plotted as mean (± sem ), where each symbol represents data from an individual mouse and analyzed using an unpaired t test or Welch's t test (D), ns = not significant

    Article Snippet: This suggests that at around 6 wk of age adipocytes in the inguinal fat depot increase in size during transition to adulthood, a time period key to inguinal mammary gland maturation, and it is at this stage that CXCR2 may play a role in inguinal adipogenesis.

    Techniques: Mouse Assay, Staining, Microscopy, Real-time Polymerase Chain Reaction, Expressing

    Female CXCR2 KO mice have a thinner subcutaneous adipose layer due to fewer and smaller adipocytes . Skin was dissected from adult female mice before processing and H E staining of sections from wild‐type and CXCR2 KO mice. (A) (i) Brightfield microscopy was used to take images of the skin (scale bars: 50 μm) and (ii) thickness of the adipocyte layer was systematically measured. (B) (i) the subcutaneous adipose depot was further imaged at high magnification (scale bars: 20 μm) and (ii) the size of individual adipocytes measured and expressed as μm 2 . (C) In addition, the number of individual adipocytes contained in the adipocyte layer (per field of view; FOV) was quantified. Data are plotted as mean (± sem ) (Aii and Bii) or (±SD) (C) from one experiment containing at least 5 mice in each group, representative of at least 2 separate experiments. Each symbol represents an individual mouse. Data were analyzed with an unpaired t test with Welch's correction (i), unpaired t test (ii) and a Mann‐Whitney test (iii)

    Journal: Journal of Leukocyte Biology

    Article Title: The chemokine receptor CXCR2 contributes to murine adipocyte development. The chemokine receptor CXCR2 contributes to murine adipocyte development

    doi: 10.1002/JLB.1A0618-216RR

    Figure Lengend Snippet: Female CXCR2 KO mice have a thinner subcutaneous adipose layer due to fewer and smaller adipocytes . Skin was dissected from adult female mice before processing and H E staining of sections from wild‐type and CXCR2 KO mice. (A) (i) Brightfield microscopy was used to take images of the skin (scale bars: 50 μm) and (ii) thickness of the adipocyte layer was systematically measured. (B) (i) the subcutaneous adipose depot was further imaged at high magnification (scale bars: 20 μm) and (ii) the size of individual adipocytes measured and expressed as μm 2 . (C) In addition, the number of individual adipocytes contained in the adipocyte layer (per field of view; FOV) was quantified. Data are plotted as mean (± sem ) (Aii and Bii) or (±SD) (C) from one experiment containing at least 5 mice in each group, representative of at least 2 separate experiments. Each symbol represents an individual mouse. Data were analyzed with an unpaired t test with Welch's correction (i), unpaired t test (ii) and a Mann‐Whitney test (iii)

    Article Snippet: This suggests that at around 6 wk of age adipocytes in the inguinal fat depot increase in size during transition to adulthood, a time period key to inguinal mammary gland maturation, and it is at this stage that CXCR2 may play a role in inguinal adipogenesis.

    Techniques: Mouse Assay, Staining, Microscopy, MANN-WHITNEY

    Adipocytes from multiple sources are smaller in CXCR2 KO female mice, compared to wild‐types . (A) Mice were dissected to allow visualization of white adipose tissue (WAT) depots at the indicated sites. (B) WAT was dissected, fixed, and processed from each of these 3 areas and sections were stained with H E (scale bars: 50 μm) from wild‐type, CXCR2 heterozygous (het), and CXCR2 knockout (KO) mice. (C) The area occupied by individual adipocytes was calculated and averaged for each individual mouse, data from each mouse was plotted for (i) tricep; (ii) perigonadal, and (iii) inguinal sites, where each symbol represents an individual mouse. (D) Skin and adipose depots were dissected from WT and CXCR2 KO mice and analyzed for CXCR2 expression by nonquantitative PCR as demonstrated by an expected product of 169 base pairs from the CXCR2 specific primer set. Data from two experiments are pooled and plotted as mean (± sem ). Data were analyzed using an ordinary one‐way ANOVA with Tukey's post hoc test (Cii and iii) or with a Kruskal‐Wallis test (Ci)

    Journal: Journal of Leukocyte Biology

    Article Title: The chemokine receptor CXCR2 contributes to murine adipocyte development. The chemokine receptor CXCR2 contributes to murine adipocyte development

    doi: 10.1002/JLB.1A0618-216RR

    Figure Lengend Snippet: Adipocytes from multiple sources are smaller in CXCR2 KO female mice, compared to wild‐types . (A) Mice were dissected to allow visualization of white adipose tissue (WAT) depots at the indicated sites. (B) WAT was dissected, fixed, and processed from each of these 3 areas and sections were stained with H E (scale bars: 50 μm) from wild‐type, CXCR2 heterozygous (het), and CXCR2 knockout (KO) mice. (C) The area occupied by individual adipocytes was calculated and averaged for each individual mouse, data from each mouse was plotted for (i) tricep; (ii) perigonadal, and (iii) inguinal sites, where each symbol represents an individual mouse. (D) Skin and adipose depots were dissected from WT and CXCR2 KO mice and analyzed for CXCR2 expression by nonquantitative PCR as demonstrated by an expected product of 169 base pairs from the CXCR2 specific primer set. Data from two experiments are pooled and plotted as mean (± sem ). Data were analyzed using an ordinary one‐way ANOVA with Tukey's post hoc test (Cii and iii) or with a Kruskal‐Wallis test (Ci)

    Article Snippet: This suggests that at around 6 wk of age adipocytes in the inguinal fat depot increase in size during transition to adulthood, a time period key to inguinal mammary gland maturation, and it is at this stage that CXCR2 may play a role in inguinal adipogenesis.

    Techniques: Mouse Assay, Staining, Knock-Out, Expressing, Polymerase Chain Reaction

    Differentiated adipocytes and fat depots express CXCR2 . (A) 3T3‐L1 cells were differentiated into adipocytes and cells stained with oil red‐O (scale bars: 50 μm). (B) mRNA was extracted before and after differentiation, reverse transcribed to cDNA and analyzed for CXCR2 expression relative to the house‐keeping gene 18s. (C) Oil red‐O staining was quantified in undifferentiated and differentiated adipocytes in the absence or presence of two different CXCR2 inhibitors (expressed relative to differentiated cells). (D) Adipocytes differentiated in the absence and presence of a CXCR2 inhibitor 1 were analyzed for PPARγ protein expression relative to GAPDH levels (left panel) and quantified relative to GAPDH using densitometry. Data are plotted as mean (± sem ), where each symbol represents an experimental replicate. Analyzed using an unpaired t test with Welch's correction (B and D) or one‐way ANOVA with TUKEY's multiple comparison test (C). Data are representative of two separate experiments

    Journal: Journal of Leukocyte Biology

    Article Title: The chemokine receptor CXCR2 contributes to murine adipocyte development. The chemokine receptor CXCR2 contributes to murine adipocyte development

    doi: 10.1002/JLB.1A0618-216RR

    Figure Lengend Snippet: Differentiated adipocytes and fat depots express CXCR2 . (A) 3T3‐L1 cells were differentiated into adipocytes and cells stained with oil red‐O (scale bars: 50 μm). (B) mRNA was extracted before and after differentiation, reverse transcribed to cDNA and analyzed for CXCR2 expression relative to the house‐keeping gene 18s. (C) Oil red‐O staining was quantified in undifferentiated and differentiated adipocytes in the absence or presence of two different CXCR2 inhibitors (expressed relative to differentiated cells). (D) Adipocytes differentiated in the absence and presence of a CXCR2 inhibitor 1 were analyzed for PPARγ protein expression relative to GAPDH levels (left panel) and quantified relative to GAPDH using densitometry. Data are plotted as mean (± sem ), where each symbol represents an experimental replicate. Analyzed using an unpaired t test with Welch's correction (B and D) or one‐way ANOVA with TUKEY's multiple comparison test (C). Data are representative of two separate experiments

    Article Snippet: This suggests that at around 6 wk of age adipocytes in the inguinal fat depot increase in size during transition to adulthood, a time period key to inguinal mammary gland maturation, and it is at this stage that CXCR2 may play a role in inguinal adipogenesis.

    Techniques: Staining, Expressing

    Adipogenesis related genes are down‐regulated in the skin and inguinal adipose tissue of juvenile CXCR2 KO mice . mRNA was extracted from inguinal adipose tissue and the skin of (A) adult and (B) juvenile female wild‐type and CXCR2 KO mice and analyzed for expression of PPARγ and FABP4 relative to the house‐keeping gene GAPDH. (C) Inguinal adipose tissue from juvenile mice was dissected, fixed, processed, and sections stained with H E. The area occupied by individual adipocytes was calculated and plotted. Data are plotted as mean (± sem ) where each symbol represents data from an individual mouse and analyzed using an unpaired t test. Data are representative of two separate experiments

    Journal: Journal of Leukocyte Biology

    Article Title: The chemokine receptor CXCR2 contributes to murine adipocyte development. The chemokine receptor CXCR2 contributes to murine adipocyte development

    doi: 10.1002/JLB.1A0618-216RR

    Figure Lengend Snippet: Adipogenesis related genes are down‐regulated in the skin and inguinal adipose tissue of juvenile CXCR2 KO mice . mRNA was extracted from inguinal adipose tissue and the skin of (A) adult and (B) juvenile female wild‐type and CXCR2 KO mice and analyzed for expression of PPARγ and FABP4 relative to the house‐keeping gene GAPDH. (C) Inguinal adipose tissue from juvenile mice was dissected, fixed, processed, and sections stained with H E. The area occupied by individual adipocytes was calculated and plotted. Data are plotted as mean (± sem ) where each symbol represents data from an individual mouse and analyzed using an unpaired t test. Data are representative of two separate experiments

    Article Snippet: This suggests that at around 6 wk of age adipocytes in the inguinal fat depot increase in size during transition to adulthood, a time period key to inguinal mammary gland maturation, and it is at this stage that CXCR2 may play a role in inguinal adipogenesis.

    Techniques: Mouse Assay, Expressing, Staining

    Mouse lung staining for CXCR1 (A,C,E,G) and CXCR2 (B,D,F,H). Both receptors were clearly expressed in alveolar epithelium, bronchial epithelium, and alveolar macrophages. Levels of both receptors in Saline (A,B) appeared reduced in G31P treated animals

    Journal: Pulmonary pharmacology & therapeutics

    Article Title: CXCR1/CXCR2 antagonist CXCL8(3-74)K11R/G31P blocks lung inflammation in swine barn dust-instilled mice

    doi: 10.1016/j.pupt.2015.02.002

    Figure Lengend Snippet: Mouse lung staining for CXCR1 (A,C,E,G) and CXCR2 (B,D,F,H). Both receptors were clearly expressed in alveolar epithelium, bronchial epithelium, and alveolar macrophages. Levels of both receptors in Saline (A,B) appeared reduced in G31P treated animals

    Article Snippet: These patterns of expression appeared to be similar but with much higher overall expression of CXCR1 and CXCR2 in SBE exposed animals.

    Techniques: Staining

    Recombinant human milk fat globule-epidermal growth factor-factor 8 (rhMFG-E8) regulates CXCR2 and G protein-coupled receptor kinase 2 (GRK2) expression through the p38 and ERK pathways. (A) Differentiated HL-60 (dHL-60) cells were placed into 1.5 ml microfuge tubes at a density of 1.5×10 6 cells/ml of Opti-MEM. The cells were then pre-treated with the p38 inhibitor, SB203580, of the ERK inhibitor, PD98059, at a concentration of 10 µ M of each for 1 h at 37°C. Following incubation, the cells were then stimulated with rhMFG-E8 (500 ng/ml) or PBS for 2 h followed by the assessment of CXCR2 by flow cytometry. Mean fluorescence intensities (MFI) obtained from 3 independent experiments are plotted into the bar diagram. * P

    Journal: International Journal of Molecular Medicine

    Article Title: MFG-E8 inhibits neutrophil migration through αvβ3-integrin-dependent MAP kinase activation

    doi: 10.3892/ijmm.2015.2196

    Figure Lengend Snippet: Recombinant human milk fat globule-epidermal growth factor-factor 8 (rhMFG-E8) regulates CXCR2 and G protein-coupled receptor kinase 2 (GRK2) expression through the p38 and ERK pathways. (A) Differentiated HL-60 (dHL-60) cells were placed into 1.5 ml microfuge tubes at a density of 1.5×10 6 cells/ml of Opti-MEM. The cells were then pre-treated with the p38 inhibitor, SB203580, of the ERK inhibitor, PD98059, at a concentration of 10 µ M of each for 1 h at 37°C. Following incubation, the cells were then stimulated with rhMFG-E8 (500 ng/ml) or PBS for 2 h followed by the assessment of CXCR2 by flow cytometry. Mean fluorescence intensities (MFI) obtained from 3 independent experiments are plotted into the bar diagram. * P

    Article Snippet: Flow cytometric analysis To examine the surface CXCR2 and intracellular GRK2 expression levels, the dHL-60 cells (1.5×106 cells) treated with rhMFG-E8 (500 ng/ml) for 2 h were first surface-stained with PE-CXCR2 (BioLegend, San Diego, CA, USA), and subsequently, to determine intracellular GRK2 expression, the cells were fixed and permeabilized with IntraPrep (Beckman Coulter, Fullerton, CA, USA), followed by staining with FITC-GRK2 antibodies (Abcam, Cambridge, MA, USA).

    Techniques: Recombinant, Expressing, Concentration Assay, Incubation, Flow Cytometry, Cytometry, Fluorescence

    Expression of CXCR2 and G protein-coupled receptor kinase 2 (GRK2) in recombinant human milk fat globule-epidermal growth factor-factor 8 (rhMFG-E8)-treated neutrophils. (A) Differentiated HL-60 (dHL-60) cells (1.5×10 6 cells) treated with rhMFG-E8 (500 ng/ml) for 2 h were surface-stained with PE-CXCR2 and then subjected to flow cytometric analysis. Data were analyzed by Flowjo software with 15,000 events per sample. Isotype controls and Fc receptor blocker were used for all the samples. The representative histograms for PBS and rhMFG-E8-treated dHL-60 cells obtained from 3 independent experiments are shown. (B) Bar diagram representing the mean fluorescence intensities (MFI) of the PBS- and rhMFG-E8-treated samples are shown. Data are expressed as the means ± SE (n=3 samples/group), obtained from 3 independent experiments. * P

    Journal: International Journal of Molecular Medicine

    Article Title: MFG-E8 inhibits neutrophil migration through αvβ3-integrin-dependent MAP kinase activation

    doi: 10.3892/ijmm.2015.2196

    Figure Lengend Snippet: Expression of CXCR2 and G protein-coupled receptor kinase 2 (GRK2) in recombinant human milk fat globule-epidermal growth factor-factor 8 (rhMFG-E8)-treated neutrophils. (A) Differentiated HL-60 (dHL-60) cells (1.5×10 6 cells) treated with rhMFG-E8 (500 ng/ml) for 2 h were surface-stained with PE-CXCR2 and then subjected to flow cytometric analysis. Data were analyzed by Flowjo software with 15,000 events per sample. Isotype controls and Fc receptor blocker were used for all the samples. The representative histograms for PBS and rhMFG-E8-treated dHL-60 cells obtained from 3 independent experiments are shown. (B) Bar diagram representing the mean fluorescence intensities (MFI) of the PBS- and rhMFG-E8-treated samples are shown. Data are expressed as the means ± SE (n=3 samples/group), obtained from 3 independent experiments. * P

    Article Snippet: Flow cytometric analysis To examine the surface CXCR2 and intracellular GRK2 expression levels, the dHL-60 cells (1.5×106 cells) treated with rhMFG-E8 (500 ng/ml) for 2 h were first surface-stained with PE-CXCR2 (BioLegend, San Diego, CA, USA), and subsequently, to determine intracellular GRK2 expression, the cells were fixed and permeabilized with IntraPrep (Beckman Coulter, Fullerton, CA, USA), followed by staining with FITC-GRK2 antibodies (Abcam, Cambridge, MA, USA).

    Techniques: Expressing, Recombinant, Staining, Flow Cytometry, Software, Fluorescence

    Recombinant human milk fat globule-epidermal growth factor-factor 8 (rhMFG-E8) regulates CXCR2 and G protein-coupled receptor kinase 2 (GRK2) expression through α v β 3 -integrin. (A) Differentiated HL-60 (dHL-60) cells (1.5×10 6 ) were placed into 1.5 ml microfuge tubes containing 1 ml of Opti-MEM. The cells were pre-treated with 1 µ g/ml of each of the IgG isotype control or anti-α v -integrin neutralizing antibody for 1 h at 37°C. The cells were then stimulated with rhMFG-E8 (500 ng/ml) or PBS for 2 h and then subjected to flow cytometry using PE-labeled anti-CXCR2 antibody. The mean fluorescence intensities (MFI) of the isotype- and anti-α v -integrin-treated samples are shown. Data are expressed as the means ± SE (n=3 samples/group), obtained from 3 independent experiments. * P

    Journal: International Journal of Molecular Medicine

    Article Title: MFG-E8 inhibits neutrophil migration through αvβ3-integrin-dependent MAP kinase activation

    doi: 10.3892/ijmm.2015.2196

    Figure Lengend Snippet: Recombinant human milk fat globule-epidermal growth factor-factor 8 (rhMFG-E8) regulates CXCR2 and G protein-coupled receptor kinase 2 (GRK2) expression through α v β 3 -integrin. (A) Differentiated HL-60 (dHL-60) cells (1.5×10 6 ) were placed into 1.5 ml microfuge tubes containing 1 ml of Opti-MEM. The cells were pre-treated with 1 µ g/ml of each of the IgG isotype control or anti-α v -integrin neutralizing antibody for 1 h at 37°C. The cells were then stimulated with rhMFG-E8 (500 ng/ml) or PBS for 2 h and then subjected to flow cytometry using PE-labeled anti-CXCR2 antibody. The mean fluorescence intensities (MFI) of the isotype- and anti-α v -integrin-treated samples are shown. Data are expressed as the means ± SE (n=3 samples/group), obtained from 3 independent experiments. * P

    Article Snippet: Flow cytometric analysis To examine the surface CXCR2 and intracellular GRK2 expression levels, the dHL-60 cells (1.5×106 cells) treated with rhMFG-E8 (500 ng/ml) for 2 h were first surface-stained with PE-CXCR2 (BioLegend, San Diego, CA, USA), and subsequently, to determine intracellular GRK2 expression, the cells were fixed and permeabilized with IntraPrep (Beckman Coulter, Fullerton, CA, USA), followed by staining with FITC-GRK2 antibodies (Abcam, Cambridge, MA, USA).

    Techniques: Recombinant, Expressing, Flow Cytometry, Cytometry, Labeling, Fluorescence

    vMIP-II does not block the IL-8-mediated migration. (A) Freshly isolated naïve NK cells were double stained with IL-8-Ig and with anti-CD56. The percentages of the various populations are indicated in the figure. (B) CXCR1 expression on the transfectant 293T-CXCR1 cells (black open histogram) or on the 293T parental cells (filled grey histogram). (C) Binding of IL-8-Ig (left histogram) or vMIP-II-Ig (right histogram) to 293T-CXCR1 transfectant (black open histogram) or to the 293T parental cells (filled grey histogram). (D) 293T-CXCR1 cells were incubated with (black empty histogram) and without (dark gray empty histogram) rvMIP-II for 1 hour in 4°C and then stained with IL-8-Ig. The light gray filled histogram is the staining of IL-8-Ig on the 293T parental cells. (E) Freshly isolated naïve NK cells were incubated at 4°C for 1 hour with and without the proteins indicated in the x axis. RhIL-8 was placed in the bottom chamber and the numbers of migrated cells was determined by FACS following 3 hours incubation at 37°C. The migration of the NK cells without the appropriate chemokine was set as 1 and the results are presented as fold increase (FI). *P

    Journal: PLoS Pathogens

    Article Title: The Viral KSHV Chemokine vMIP-II Inhibits the Migration of Naive and Activated Human NK Cells by Antagonizing Two Distinct Chemokine Receptors

    doi: 10.1371/journal.ppat.1003568

    Figure Lengend Snippet: vMIP-II does not block the IL-8-mediated migration. (A) Freshly isolated naïve NK cells were double stained with IL-8-Ig and with anti-CD56. The percentages of the various populations are indicated in the figure. (B) CXCR1 expression on the transfectant 293T-CXCR1 cells (black open histogram) or on the 293T parental cells (filled grey histogram). (C) Binding of IL-8-Ig (left histogram) or vMIP-II-Ig (right histogram) to 293T-CXCR1 transfectant (black open histogram) or to the 293T parental cells (filled grey histogram). (D) 293T-CXCR1 cells were incubated with (black empty histogram) and without (dark gray empty histogram) rvMIP-II for 1 hour in 4°C and then stained with IL-8-Ig. The light gray filled histogram is the staining of IL-8-Ig on the 293T parental cells. (E) Freshly isolated naïve NK cells were incubated at 4°C for 1 hour with and without the proteins indicated in the x axis. RhIL-8 was placed in the bottom chamber and the numbers of migrated cells was determined by FACS following 3 hours incubation at 37°C. The migration of the NK cells without the appropriate chemokine was set as 1 and the results are presented as fold increase (FI). *P

    Article Snippet: Staining for the chemokine receptors was performed with conjugated antibodies anti CCR1, anti CCR2, anti CCR3, anti CCR5, anti CXCR4, anti CX3CR1, and anti CXCR1 (all from Biolegend).

    Techniques: Blocking Assay, Migration, Isolation, Staining, Expressing, Transfection, Binding Assay, Incubation, FACS

    vMIP-II-Ig mainly recognizes the naïve CD56 Dim CD16 Pos NK cell population which express the CX3CR1 and CXCR1 chemokine receptors. (A) Freshly isolated naïve NK cells were double stained with anti-CD56 mAb together with control-Ig or with vMIP-II-Ig. The CD56 Dim CD16 Pos and CD56 Bright CD16 Neg NK cell populations are indicated by an arrow. The percentages of the various populations are indicated. (B) Expression of various chemokine receptors on freshly isolated naïve NK cells. Staining was performed with anti-CD56 mAb together with specific antibodies against CCR1, CCR2, CCR3, CCR5 and CXCR4. The percentages of the various populations are indicated. (C) CCR5 expression varies between different individuals. Staining of various donors (indicated on top of the dot plots) was performed with anti-CD56 mAb together with specific antibodies against CCR5. (D and E) Chemokine receptors expressed primarily by the CD56 Dim CD16 Pos population. Freshly isolated naïve NK cells were double stained with anti-CD56 mAb together with anti-CXCR1 (D) or anti-CX3CR1 (E). The percentages of the various populations are indicated. Figure shows one representative experiment out of three performed.

    Journal: PLoS Pathogens

    Article Title: The Viral KSHV Chemokine vMIP-II Inhibits the Migration of Naive and Activated Human NK Cells by Antagonizing Two Distinct Chemokine Receptors

    doi: 10.1371/journal.ppat.1003568

    Figure Lengend Snippet: vMIP-II-Ig mainly recognizes the naïve CD56 Dim CD16 Pos NK cell population which express the CX3CR1 and CXCR1 chemokine receptors. (A) Freshly isolated naïve NK cells were double stained with anti-CD56 mAb together with control-Ig or with vMIP-II-Ig. The CD56 Dim CD16 Pos and CD56 Bright CD16 Neg NK cell populations are indicated by an arrow. The percentages of the various populations are indicated. (B) Expression of various chemokine receptors on freshly isolated naïve NK cells. Staining was performed with anti-CD56 mAb together with specific antibodies against CCR1, CCR2, CCR3, CCR5 and CXCR4. The percentages of the various populations are indicated. (C) CCR5 expression varies between different individuals. Staining of various donors (indicated on top of the dot plots) was performed with anti-CD56 mAb together with specific antibodies against CCR5. (D and E) Chemokine receptors expressed primarily by the CD56 Dim CD16 Pos population. Freshly isolated naïve NK cells were double stained with anti-CD56 mAb together with anti-CXCR1 (D) or anti-CX3CR1 (E). The percentages of the various populations are indicated. Figure shows one representative experiment out of three performed.

    Article Snippet: Staining for the chemokine receptors was performed with conjugated antibodies anti CCR1, anti CCR2, anti CCR3, anti CCR5, anti CXCR4, anti CX3CR1, and anti CXCR1 (all from Biolegend).

    Techniques: Isolation, Staining, Expressing

    vMIP-II binds activated NK cells that express CCR5. (A) vMIP-II-Ig binding to activated NK cells (Act-NK) (black open histogram). The filled grey histogram is the secondary antibody staining. (B) Activated NK cells were double stained with anti-CD56 together with anti-CX3CR1 (left dot plot) or with anti CXCR1 (right dot plot). Numbers represent percentages. (C) Activated NK cells were double stained with anti-CD56 mAb and antibodies against CCR1, CCR2, CCR3, CCR5 and CXCR4 (indicated in the X axis). Numbers represent percentages. (D and E) rhRANTES (D) or rvMIP-II (E) were placed in the bottom chamber of transwell plates and the migration of activated NK was quantified by FACS following a 3 hours incubation period at 37°C. The migration of the NK cells without the appropriate chemokine was set as 1 and the results are presented as fold increase (FI). ***P

    Journal: PLoS Pathogens

    Article Title: The Viral KSHV Chemokine vMIP-II Inhibits the Migration of Naive and Activated Human NK Cells by Antagonizing Two Distinct Chemokine Receptors

    doi: 10.1371/journal.ppat.1003568

    Figure Lengend Snippet: vMIP-II binds activated NK cells that express CCR5. (A) vMIP-II-Ig binding to activated NK cells (Act-NK) (black open histogram). The filled grey histogram is the secondary antibody staining. (B) Activated NK cells were double stained with anti-CD56 together with anti-CX3CR1 (left dot plot) or with anti CXCR1 (right dot plot). Numbers represent percentages. (C) Activated NK cells were double stained with anti-CD56 mAb and antibodies against CCR1, CCR2, CCR3, CCR5 and CXCR4 (indicated in the X axis). Numbers represent percentages. (D and E) rhRANTES (D) or rvMIP-II (E) were placed in the bottom chamber of transwell plates and the migration of activated NK was quantified by FACS following a 3 hours incubation period at 37°C. The migration of the NK cells without the appropriate chemokine was set as 1 and the results are presented as fold increase (FI). ***P

    Article Snippet: Staining for the chemokine receptors was performed with conjugated antibodies anti CCR1, anti CCR2, anti CCR3, anti CCR5, anti CXCR4, anti CX3CR1, and anti CXCR1 (all from Biolegend).

    Techniques: Binding Assay, Activated Clotting Time Assay, Staining, Migration, FACS, Incubation

    Angiotensin II promotes myeloid-derived CXCR2-positive cells. A , Flow cytometry analysis of CD45 + CXCR2 + cells in aortic samples before and after angiotensin II infusion at day 1, 3, 7, and 14 ( top ). The percentage of CD45 + CXCR2 + cells was shown as the histogram ( bottom ). B , Aortic mRNA level of CXCR2 was measured by quantitative real-time polymerase chain reaction (qPCR) after saline and angiotensin II infusion for 14 days. C , Immunohistochemical staining of the CXCR2-positive cells in aortic sections. Arrows indicate the CXCR2-positive cells. Scale bar, 50 μm. * P

    Journal: Circulation

    Article Title: Genetic and Pharmacologic Inhibition of the Chemokine Receptor CXCR2 Prevents Experimental Hypertension and Vascular Dysfunction

    doi: 10.1161/CIRCULATIONAHA.115.020754

    Figure Lengend Snippet: Angiotensin II promotes myeloid-derived CXCR2-positive cells. A , Flow cytometry analysis of CD45 + CXCR2 + cells in aortic samples before and after angiotensin II infusion at day 1, 3, 7, and 14 ( top ). The percentage of CD45 + CXCR2 + cells was shown as the histogram ( bottom ). B , Aortic mRNA level of CXCR2 was measured by quantitative real-time polymerase chain reaction (qPCR) after saline and angiotensin II infusion for 14 days. C , Immunohistochemical staining of the CXCR2-positive cells in aortic sections. Arrows indicate the CXCR2-positive cells. Scale bar, 50 μm. * P

    Article Snippet: Single-cell suspensions were treated with Fc block, washed, and stained with CD45 V500, CD3 PE-CF594, CD11b APC-Cy7, Ly6G PE-Cy7, Ly6C V450, F4/80 APC, and CXCR2 PE and their homologous isotype-matched negative controls (BD, Franklin Lakes, NJ).

    Techniques: Derivative Assay, Flow Cytometry, Cytometry, Real-time Polymerase Chain Reaction, Immunohistochemistry, Staining

    Inhibition or genetic ablation of CXCR2 improves vascular function and reduces oxidative stress in response to Angiotensin II. A and B , Concentration-response curves of endothelium-dependent (acetylcholine, left ) and nonendothelium-dependent (SNP, right ) relaxation. C and D , DHE staining of the aortic segments ( left ) and the DHE fluorescence intensity of each group were analyzed ( right ). Red fluorescence reflects the superoxide formation, whereas green fluorescence shows the laminae. Scale bar, 50 μm. E , Aortic NADPH oxidase activity was measured. F and G , qPCR analysis of NOX1, NOX2, NOX4, and p22 phox mRNA expression. * P

    Journal: Circulation

    Article Title: Genetic and Pharmacologic Inhibition of the Chemokine Receptor CXCR2 Prevents Experimental Hypertension and Vascular Dysfunction

    doi: 10.1161/CIRCULATIONAHA.115.020754

    Figure Lengend Snippet: Inhibition or genetic ablation of CXCR2 improves vascular function and reduces oxidative stress in response to Angiotensin II. A and B , Concentration-response curves of endothelium-dependent (acetylcholine, left ) and nonendothelium-dependent (SNP, right ) relaxation. C and D , DHE staining of the aortic segments ( left ) and the DHE fluorescence intensity of each group were analyzed ( right ). Red fluorescence reflects the superoxide formation, whereas green fluorescence shows the laminae. Scale bar, 50 μm. E , Aortic NADPH oxidase activity was measured. F and G , qPCR analysis of NOX1, NOX2, NOX4, and p22 phox mRNA expression. * P

    Article Snippet: Single-cell suspensions were treated with Fc block, washed, and stained with CD45 V500, CD3 PE-CF594, CD11b APC-Cy7, Ly6G PE-Cy7, Ly6C V450, F4/80 APC, and CXCR2 PE and their homologous isotype-matched negative controls (BD, Franklin Lakes, NJ).

    Techniques: Inhibition, Concentration Assay, Staining, Fluorescence, Activity Assay, Real-time Polymerase Chain Reaction, Expressing

    Depletion of CXCR2 attenuates DOCA-salt-induced hypertension. A , Systolic blood pressure was measured by the tail-cuff method of each group. B and C , H E and Masson staining of thoracic aorta ( left ), wall thickness, and percentage of fibrotic area of each group were analyzed ( right ). Scale bar, 50 μm. D , DHE staining of the aortic segments ( left ) and the DHE fluorescence intensity of each group were analyzed ( right ). Scale bar, 50 μm. E and F , IL-1β, IL-6, TNF-α, CD68, VCAM-1, NOX1, NOX2, NOX4, and p22 phox mRNA expression levels were measured by qPCR. * P

    Journal: Circulation

    Article Title: Genetic and Pharmacologic Inhibition of the Chemokine Receptor CXCR2 Prevents Experimental Hypertension and Vascular Dysfunction

    doi: 10.1161/CIRCULATIONAHA.115.020754

    Figure Lengend Snippet: Depletion of CXCR2 attenuates DOCA-salt-induced hypertension. A , Systolic blood pressure was measured by the tail-cuff method of each group. B and C , H E and Masson staining of thoracic aorta ( left ), wall thickness, and percentage of fibrotic area of each group were analyzed ( right ). Scale bar, 50 μm. D , DHE staining of the aortic segments ( left ) and the DHE fluorescence intensity of each group were analyzed ( right ). Scale bar, 50 μm. E and F , IL-1β, IL-6, TNF-α, CD68, VCAM-1, NOX1, NOX2, NOX4, and p22 phox mRNA expression levels were measured by qPCR. * P

    Article Snippet: Single-cell suspensions were treated with Fc block, washed, and stained with CD45 V500, CD3 PE-CF594, CD11b APC-Cy7, Ly6G PE-Cy7, Ly6C V450, F4/80 APC, and CXCR2 PE and their homologous isotype-matched negative controls (BD, Franklin Lakes, NJ).

    Techniques: Staining, Fluorescence, Expressing, Real-time Polymerase Chain Reaction

    The CXCR2 inhibitor SB265610 alleviates hypertension, vascular inflammation, and fibrosis after angiotensin II infusion. A , Systolic blood pressure was measured by the noninvasive tail-cuff method in vehicle or SB265610-treated mice before ( C ) and after angiotensin II treatment (T, 490ng/kg/min). B , H E staining of thoracic aorta ( left ) and the wall thickness of each group were analyzed ( right ). Scale bar, 50 μm. C , Masson staining of thoracic aorta ( left ) and the percentage of fibrotic area were analyzed ( right ). Scale bar, 50 μm. D , Flow cytometry analysis of CD45 + cells, CD45 + CD11b + F4/80 + macrophages, and CD45 + CD3 + T cells in aortic lysates ( left ). The histograms indicate the percentage of gated cells ( right ). E , qPCR analysis of IL-1β, IL-6, TNF-α, CD68, VCAM-1, and COX-2 mRNA expression levels in the aorta. F , qPCR analysis of α-SMA, collagen I, and collagen III mRNA expression levels in the aorta. * P

    Journal: Circulation

    Article Title: Genetic and Pharmacologic Inhibition of the Chemokine Receptor CXCR2 Prevents Experimental Hypertension and Vascular Dysfunction

    doi: 10.1161/CIRCULATIONAHA.115.020754

    Figure Lengend Snippet: The CXCR2 inhibitor SB265610 alleviates hypertension, vascular inflammation, and fibrosis after angiotensin II infusion. A , Systolic blood pressure was measured by the noninvasive tail-cuff method in vehicle or SB265610-treated mice before ( C ) and after angiotensin II treatment (T, 490ng/kg/min). B , H E staining of thoracic aorta ( left ) and the wall thickness of each group were analyzed ( right ). Scale bar, 50 μm. C , Masson staining of thoracic aorta ( left ) and the percentage of fibrotic area were analyzed ( right ). Scale bar, 50 μm. D , Flow cytometry analysis of CD45 + cells, CD45 + CD11b + F4/80 + macrophages, and CD45 + CD3 + T cells in aortic lysates ( left ). The histograms indicate the percentage of gated cells ( right ). E , qPCR analysis of IL-1β, IL-6, TNF-α, CD68, VCAM-1, and COX-2 mRNA expression levels in the aorta. F , qPCR analysis of α-SMA, collagen I, and collagen III mRNA expression levels in the aorta. * P

    Article Snippet: Single-cell suspensions were treated with Fc block, washed, and stained with CD45 V500, CD3 PE-CF594, CD11b APC-Cy7, Ly6G PE-Cy7, Ly6C V450, F4/80 APC, and CXCR2 PE and their homologous isotype-matched negative controls (BD, Franklin Lakes, NJ).

    Techniques: Mouse Assay, Staining, Flow Cytometry, Cytometry, Real-time Polymerase Chain Reaction, Expressing

    Depletion of CXCR2 prevents angiotensin II-induced hypertension, vascular inflammation, and fibrosis. A , Representative original systolic blood pressure recordings in WT and CXCR2 -/- mice 3 days before angiotensin II treatment (baseline) and during the last 3 days of angiotensin II infusion (Ang II) by telemetric blood pressure measurements. B , Average systolic ( top ) and diastolic ( bottom ) blood pressure of WT and CXCR2 -/- mice before and after angiotensin II treatment obtained by telemetry. ## P

    Journal: Circulation

    Article Title: Genetic and Pharmacologic Inhibition of the Chemokine Receptor CXCR2 Prevents Experimental Hypertension and Vascular Dysfunction

    doi: 10.1161/CIRCULATIONAHA.115.020754

    Figure Lengend Snippet: Depletion of CXCR2 prevents angiotensin II-induced hypertension, vascular inflammation, and fibrosis. A , Representative original systolic blood pressure recordings in WT and CXCR2 -/- mice 3 days before angiotensin II treatment (baseline) and during the last 3 days of angiotensin II infusion (Ang II) by telemetric blood pressure measurements. B , Average systolic ( top ) and diastolic ( bottom ) blood pressure of WT and CXCR2 -/- mice before and after angiotensin II treatment obtained by telemetry. ## P

    Article Snippet: Single-cell suspensions were treated with Fc block, washed, and stained with CD45 V500, CD3 PE-CF594, CD11b APC-Cy7, Ly6G PE-Cy7, Ly6C V450, F4/80 APC, and CXCR2 PE and their homologous isotype-matched negative controls (BD, Franklin Lakes, NJ).

    Techniques: Mouse Assay

    Blood CXCR2 + cells are increased in hypertensive patients. A–D , Flow cytometric analysis of circulating CD45 + CXCR2 + inflammatory cells ( A ), CD45 + CD13 + CXCR2 + monocytes ( B ), CD45 + CD13 + CD15 + CXCR2 + neutrophils ( C ), and CD45 + CD13 + CD64 + CXCR2 + macrophages ( D ) in both hypertensive patients (n=30) and normotensive individuals (n=20). *** P

    Journal: Circulation

    Article Title: Genetic and Pharmacologic Inhibition of the Chemokine Receptor CXCR2 Prevents Experimental Hypertension and Vascular Dysfunction

    doi: 10.1161/CIRCULATIONAHA.115.020754

    Figure Lengend Snippet: Blood CXCR2 + cells are increased in hypertensive patients. A–D , Flow cytometric analysis of circulating CD45 + CXCR2 + inflammatory cells ( A ), CD45 + CD13 + CXCR2 + monocytes ( B ), CD45 + CD13 + CD15 + CXCR2 + neutrophils ( C ), and CD45 + CD13 + CD64 + CXCR2 + macrophages ( D ) in both hypertensive patients (n=30) and normotensive individuals (n=20). *** P

    Article Snippet: Single-cell suspensions were treated with Fc block, washed, and stained with CD45 V500, CD3 PE-CF594, CD11b APC-Cy7, Ly6G PE-Cy7, Ly6C V450, F4/80 APC, and CXCR2 PE and their homologous isotype-matched negative controls (BD, Franklin Lakes, NJ).

    Techniques: Flow Cytometry

    CXCR2 deficiency in bone marrow-derived cells prevents angiotensin II-induced hypertension, vascular inflammation, fibrosis, dysfunction, and oxidative stress. A , Representative telemetric trace recording of systolic blood pressure of each group during the last 3 days of angiotensin II infusion. B , Average systolic blood pressure of each group before and after angiotensin II treatment obtained by telemetry. C and D , H E and Masson staining of thoracic aorta ( left ), wall thickness, and percentage of fibrotic area of each group were analyzed ( right ). Scale bar, 50 μm. E , Concentration-response curves of endothelium acetylcholine-dependent and nonendothelium (SNP)-dependent relaxation. F , DHE staining of the aortic segments ( left ) and the DHE fluorescence intensity of each group were analyzed ( right ). Scale bar, 50 μm. G , Aortic NADPH oxidase activity was measured. H , qPCR analysis of α-SMA, collagen I, and collagen III mRNA expression levels in the aorta. # P

    Journal: Circulation

    Article Title: Genetic and Pharmacologic Inhibition of the Chemokine Receptor CXCR2 Prevents Experimental Hypertension and Vascular Dysfunction

    doi: 10.1161/CIRCULATIONAHA.115.020754

    Figure Lengend Snippet: CXCR2 deficiency in bone marrow-derived cells prevents angiotensin II-induced hypertension, vascular inflammation, fibrosis, dysfunction, and oxidative stress. A , Representative telemetric trace recording of systolic blood pressure of each group during the last 3 days of angiotensin II infusion. B , Average systolic blood pressure of each group before and after angiotensin II treatment obtained by telemetry. C and D , H E and Masson staining of thoracic aorta ( left ), wall thickness, and percentage of fibrotic area of each group were analyzed ( right ). Scale bar, 50 μm. E , Concentration-response curves of endothelium acetylcholine-dependent and nonendothelium (SNP)-dependent relaxation. F , DHE staining of the aortic segments ( left ) and the DHE fluorescence intensity of each group were analyzed ( right ). Scale bar, 50 μm. G , Aortic NADPH oxidase activity was measured. H , qPCR analysis of α-SMA, collagen I, and collagen III mRNA expression levels in the aorta. # P

    Article Snippet: Single-cell suspensions were treated with Fc block, washed, and stained with CD45 V500, CD3 PE-CF594, CD11b APC-Cy7, Ly6G PE-Cy7, Ly6C V450, F4/80 APC, and CXCR2 PE and their homologous isotype-matched negative controls (BD, Franklin Lakes, NJ).

    Techniques: Derivative Assay, Staining, Concentration Assay, Fluorescence, Activity Assay, Real-time Polymerase Chain Reaction, Expressing

    CXCR2 is transcriptionally regulated by TMZ via Nrf2 in LPS-induced cardiac dysfunction. (A) Nrf2 ARE consensus binding site, potential Nrf2 binding site and the mutant Nrf2 binding site relative to potential Nrf2 binding site on mouse CXCR2. Blue indicates binding site, red indicates mutated base. (B) Luciferase activity of the constructs transfected into HEK293T cells. The first base before ATG represents−1. (C) Nrf2 chromatin immunoprecipitation. HEK293T cells were transfected with an empty plasmid or plasmid expressing Nrf2. PCR assays on input and IP fractions amplified the CXCR2 promoter containing the putative Nrf2 site (−919/−909, top panel) or a distal region of the Nrf2 promoter (−2727/−2717, bottom panel). (D) −1408/+254 CXCR2 promoter constructs and si-Nrf2 were transfected into HEK293T cells, and then subjected to TMZ (20 μM), LPS (5 μg/ml) or combination stimulations. Relative luciferase activity of−1408/+254 CXCR2 promoter construct after stimulations. (E) Schematic drawing of experimental schedule for the mice study. 8–10 week-old C57BL/6 male mice were first intraperitoneally injected with the CXCR2 inhibitor SB225002 (10 mg/kg) and LPS (15 mg/kg), then TMZ was administrated by gavage every 6 h for 3 times after LPS injection for 6 h. (F,G) Ejection fraction and fractional shortening was measured by two-dimensional echocardiography. (H) Representative images of left ventricular myocardium H E staining. Scale bars: 100 μm. Data is presented as mean ± SEM in vivo and mean ± SD in vitro of three independent experiments. * P

    Journal: Frontiers in Immunology

    Article Title: Trimetazidine Attenuates Cardiac Dysfunction in Endotoxemia and Sepsis by Promoting Neutrophil Migration

    doi: 10.3389/fimmu.2018.02015

    Figure Lengend Snippet: CXCR2 is transcriptionally regulated by TMZ via Nrf2 in LPS-induced cardiac dysfunction. (A) Nrf2 ARE consensus binding site, potential Nrf2 binding site and the mutant Nrf2 binding site relative to potential Nrf2 binding site on mouse CXCR2. Blue indicates binding site, red indicates mutated base. (B) Luciferase activity of the constructs transfected into HEK293T cells. The first base before ATG represents−1. (C) Nrf2 chromatin immunoprecipitation. HEK293T cells were transfected with an empty plasmid or plasmid expressing Nrf2. PCR assays on input and IP fractions amplified the CXCR2 promoter containing the putative Nrf2 site (−919/−909, top panel) or a distal region of the Nrf2 promoter (−2727/−2717, bottom panel). (D) −1408/+254 CXCR2 promoter constructs and si-Nrf2 were transfected into HEK293T cells, and then subjected to TMZ (20 μM), LPS (5 μg/ml) or combination stimulations. Relative luciferase activity of−1408/+254 CXCR2 promoter construct after stimulations. (E) Schematic drawing of experimental schedule for the mice study. 8–10 week-old C57BL/6 male mice were first intraperitoneally injected with the CXCR2 inhibitor SB225002 (10 mg/kg) and LPS (15 mg/kg), then TMZ was administrated by gavage every 6 h for 3 times after LPS injection for 6 h. (F,G) Ejection fraction and fractional shortening was measured by two-dimensional echocardiography. (H) Representative images of left ventricular myocardium H E staining. Scale bars: 100 μm. Data is presented as mean ± SEM in vivo and mean ± SD in vitro of three independent experiments. * P

    Article Snippet: PE-CXCR2 was from BD Biosciences (San Jose, CA).

    Techniques: Binding Assay, Mutagenesis, Luciferase, Activity Assay, Construct, Transfection, Chromatin Immunoprecipitation, Plasmid Preparation, Expressing, Polymerase Chain Reaction, Amplification, Mouse Assay, Injection, Staining, In Vivo, In Vitro

    TMZ enhanced neutrophil migration by regulating CXCR2 expression through AMPK pathway. (A) 8–10 week-old C57BL/6 male mice were first injected with LPS (15 mg/kg), then TMZ (20 mg/kg) was administrated by gavage every 6 h for 3 times after LPS injection for 6 h. Representative images of migrated BMDNs by transwell assay. (B) Relative quantitative assay of migrating BMDNs under optical microscopy. (C) Neutrophils isolated from non-simulated mice bone marrow, then BMDNs were subjected to LPS stimulation (5 μg/ml) for 1 h and subsequently treated with TMZ (20 μM) for 2 h. Representative images of migrated BMDNs by transwell assay. (D) Relative quantitative assay of migrating BMDNs under optical microscopy. (E) Representative images of BMDN immunofluorescent CXCR2 (green) staining. Nuclei were stained by DAPI (blue). (F) Quantitative of CXCR2 expression by measuring fluorescence intensity. (G) Phosphorylation of AMPK in BMDNs was examined by western blotting. (H) BMDNs were first treated with AMPK inhibitor CC (CC) (1 μM) for 1 h, then subjected to LPS stimulation (5 μg/ml) for 1 h, subsequently treated with TMZ (20 μM) for 2 h in vitro . Representative images of migrated BMDNs by transwell assay. (I) Relative quantitative assay of migrating BMDNs under optical microscopy. (J) Flow cytometry was performed to examine the expression of CXCR2 on the membrane of neutrophils. (K) Quantitative of CXCR2 expression by FACS. Data were presented as mean ± SEM in vivo and mean ± SD in vitro of three independent experiments. Scale bar: 50 μm. * P

    Journal: Frontiers in Immunology

    Article Title: Trimetazidine Attenuates Cardiac Dysfunction in Endotoxemia and Sepsis by Promoting Neutrophil Migration

    doi: 10.3389/fimmu.2018.02015

    Figure Lengend Snippet: TMZ enhanced neutrophil migration by regulating CXCR2 expression through AMPK pathway. (A) 8–10 week-old C57BL/6 male mice were first injected with LPS (15 mg/kg), then TMZ (20 mg/kg) was administrated by gavage every 6 h for 3 times after LPS injection for 6 h. Representative images of migrated BMDNs by transwell assay. (B) Relative quantitative assay of migrating BMDNs under optical microscopy. (C) Neutrophils isolated from non-simulated mice bone marrow, then BMDNs were subjected to LPS stimulation (5 μg/ml) for 1 h and subsequently treated with TMZ (20 μM) for 2 h. Representative images of migrated BMDNs by transwell assay. (D) Relative quantitative assay of migrating BMDNs under optical microscopy. (E) Representative images of BMDN immunofluorescent CXCR2 (green) staining. Nuclei were stained by DAPI (blue). (F) Quantitative of CXCR2 expression by measuring fluorescence intensity. (G) Phosphorylation of AMPK in BMDNs was examined by western blotting. (H) BMDNs were first treated with AMPK inhibitor CC (CC) (1 μM) for 1 h, then subjected to LPS stimulation (5 μg/ml) for 1 h, subsequently treated with TMZ (20 μM) for 2 h in vitro . Representative images of migrated BMDNs by transwell assay. (I) Relative quantitative assay of migrating BMDNs under optical microscopy. (J) Flow cytometry was performed to examine the expression of CXCR2 on the membrane of neutrophils. (K) Quantitative of CXCR2 expression by FACS. Data were presented as mean ± SEM in vivo and mean ± SD in vitro of three independent experiments. Scale bar: 50 μm. * P

    Article Snippet: PE-CXCR2 was from BD Biosciences (San Jose, CA).

    Techniques: Migration, Expressing, Mouse Assay, Injection, Transwell Assay, Microscopy, Isolation, Staining, Fluorescence, Western Blot, In Vitro, Flow Cytometry, Cytometry, FACS, In Vivo

    TMZ promoted neutrophil migration by decreasing GRK2 and increasing CXCR2 expression in an AMPK/Nrf2 dependent manner. (A) BMDNs were first treated with CC (1 μM) for 1 h, then subjected to LPS stimulation (5 μg/ml) for 1 h, subsequently treated with TMZ (20 μM) for 2 h. Western blotting analysis of nuclear Nrf2 and total GRK2 in response to different stimulations. Lamin B and GAPDH were used as loading controls, respectively. (B,C) Quantification of Nrf2/Lamin B and GRK2/GAPDH was performed from the western blotting and expressed as fold induction. (D) BMDNs were first transfected with si-Nrf2 for 24 h, then subjected to LPS stimulation (5 μg/ml) for 1 h, subsequently treated with TMZ (20 μM) for 2 h. Representative images of transwell assays for BMDNs under optical microscope. Scale bar: 50 μm. (E) Relative quantitative assay of migrating BMDNs under optical microscopy. (F) Flow cytometry was performed to examine the expression of CXCR2 on the membrane of BMDNs. (G) Quantitative assay of CXCR2 expression by FACS. (H) Western blotting analysis of nuclear Nrf2 and total GRK2 in response to different stimulations after transfection. Lamin B and GAPDH were used as loading controls, respectively. (I,J) Quantification of Nrf2/Lamin B and GRK2/GAPDH was performed from the western blotting and expressed as fold induction. Data is presented as mean ± SEM in vivo and mean ± SD in vitro of three independent experiments. * P

    Journal: Frontiers in Immunology

    Article Title: Trimetazidine Attenuates Cardiac Dysfunction in Endotoxemia and Sepsis by Promoting Neutrophil Migration

    doi: 10.3389/fimmu.2018.02015

    Figure Lengend Snippet: TMZ promoted neutrophil migration by decreasing GRK2 and increasing CXCR2 expression in an AMPK/Nrf2 dependent manner. (A) BMDNs were first treated with CC (1 μM) for 1 h, then subjected to LPS stimulation (5 μg/ml) for 1 h, subsequently treated with TMZ (20 μM) for 2 h. Western blotting analysis of nuclear Nrf2 and total GRK2 in response to different stimulations. Lamin B and GAPDH were used as loading controls, respectively. (B,C) Quantification of Nrf2/Lamin B and GRK2/GAPDH was performed from the western blotting and expressed as fold induction. (D) BMDNs were first transfected with si-Nrf2 for 24 h, then subjected to LPS stimulation (5 μg/ml) for 1 h, subsequently treated with TMZ (20 μM) for 2 h. Representative images of transwell assays for BMDNs under optical microscope. Scale bar: 50 μm. (E) Relative quantitative assay of migrating BMDNs under optical microscopy. (F) Flow cytometry was performed to examine the expression of CXCR2 on the membrane of BMDNs. (G) Quantitative assay of CXCR2 expression by FACS. (H) Western blotting analysis of nuclear Nrf2 and total GRK2 in response to different stimulations after transfection. Lamin B and GAPDH were used as loading controls, respectively. (I,J) Quantification of Nrf2/Lamin B and GRK2/GAPDH was performed from the western blotting and expressed as fold induction. Data is presented as mean ± SEM in vivo and mean ± SD in vitro of three independent experiments. * P

    Article Snippet: PE-CXCR2 was from BD Biosciences (San Jose, CA).

    Techniques: Migration, Expressing, Western Blot, Transfection, Microscopy, Flow Cytometry, Cytometry, FACS, In Vivo, In Vitro

    TMZ decreased LPS-induced cardiomyocyte pyroptosis by targeting neutrophils . (A) 8–10 week-old C57BL/6 male mice were first injected with the CXCR2 inhibitor SB225002 (10 mg/kg) and LPS (15 mg/kg), then TMZ was administrated by gavage every 6 h for 3 times after LPS injection for 6 h. Cleaved caspase-11 (marked by arrow) expression in heart tissue was measured by western blotting. (B) Quantification of cleaved Casp-11/ pro-Casp-11 was performed from the western blotting analysis and expressed as fold induction. (C) IL-1β levels in heart tissues were measured by ELISA. (D) LDH levels in heart tissue. (E) Representative images of left ventricular myocardium caspase-11 (red) fluorescent staining. Blue indicates DAPI staining. Scale bar: 50 μm. (F) Relative caspase-11 fluorescent intensity. (G) Representative images of left ventricular myocardium MPO staining. Scale bar: 50 μm. (H) Quantification of MPO-positive cells in 1 mm 2 . (I) BMDNs were first administrated with SB225002 (1 μM), then stimulated with LPS (5 μg/ml) for 1 h, and finally with TMZ (20 μM) treatment. Primary cardiomyocytes of adult mice were co-cultured with stimulated BMDNs by transwell. Cardiomyocytes were seeded in the bottom chamber and BMDNs into the upper chamber. Western blotting analysis of Casp-11 in cardiomyocyte and GAPDH used as loading control. (J) Quantification of cleaved Casp-11/ pro-Casp-11 was performed from the western blotting analysis and expressed as fold induction. (K) Relative expression of IL-1β mRNA in cardiomyocyte (normalized to GAPDH mRNA). (L) LDH levels in cardiomyocytes. (M) The proposed model for this study was summarized. Data is presented as mean ± SEM in vivo and mean ± SD in vitro of three independent experiments. * P

    Journal: Frontiers in Immunology

    Article Title: Trimetazidine Attenuates Cardiac Dysfunction in Endotoxemia and Sepsis by Promoting Neutrophil Migration

    doi: 10.3389/fimmu.2018.02015

    Figure Lengend Snippet: TMZ decreased LPS-induced cardiomyocyte pyroptosis by targeting neutrophils . (A) 8–10 week-old C57BL/6 male mice were first injected with the CXCR2 inhibitor SB225002 (10 mg/kg) and LPS (15 mg/kg), then TMZ was administrated by gavage every 6 h for 3 times after LPS injection for 6 h. Cleaved caspase-11 (marked by arrow) expression in heart tissue was measured by western blotting. (B) Quantification of cleaved Casp-11/ pro-Casp-11 was performed from the western blotting analysis and expressed as fold induction. (C) IL-1β levels in heart tissues were measured by ELISA. (D) LDH levels in heart tissue. (E) Representative images of left ventricular myocardium caspase-11 (red) fluorescent staining. Blue indicates DAPI staining. Scale bar: 50 μm. (F) Relative caspase-11 fluorescent intensity. (G) Representative images of left ventricular myocardium MPO staining. Scale bar: 50 μm. (H) Quantification of MPO-positive cells in 1 mm 2 . (I) BMDNs were first administrated with SB225002 (1 μM), then stimulated with LPS (5 μg/ml) for 1 h, and finally with TMZ (20 μM) treatment. Primary cardiomyocytes of adult mice were co-cultured with stimulated BMDNs by transwell. Cardiomyocytes were seeded in the bottom chamber and BMDNs into the upper chamber. Western blotting analysis of Casp-11 in cardiomyocyte and GAPDH used as loading control. (J) Quantification of cleaved Casp-11/ pro-Casp-11 was performed from the western blotting analysis and expressed as fold induction. (K) Relative expression of IL-1β mRNA in cardiomyocyte (normalized to GAPDH mRNA). (L) LDH levels in cardiomyocytes. (M) The proposed model for this study was summarized. Data is presented as mean ± SEM in vivo and mean ± SD in vitro of three independent experiments. * P

    Article Snippet: PE-CXCR2 was from BD Biosciences (San Jose, CA).

    Techniques: Mouse Assay, Injection, Expressing, Western Blot, Enzyme-linked Immunosorbent Assay, Staining, Cell Culture, In Vivo, In Vitro

    Age reduces expression of receptors and ligand required for proper neutrophil clearance. Neutrophils isolated from the blood of naïve young and aged mice were stained for neutrophil identification markers (CD45 + /CD11b + /Ly6C Int /Ly6G Hi ), surface chemokine receptors CXCR2 ( A ), CXCR4 ( B ) and the adhesion molecules L-selectin ( C ) and CD44 ( D ). Serum was taken from young (3 month) or aged (22 month) old animals 24 hours following sham or stroke surgery. n=7-12 animals/group. CXCL12 and CXCL2 were measured via multiplex ( E ). Two-way ANOVA was performed, followed by individual T-Tests with Sidak’s correction. ( F ) A schematic figure of the differential roles of CXCL12 and CXCL2 in circulating neutrophil homeostasis. *p≤0.05, **p=

    Journal: Aging (Albany NY)

    Article Title: Aging exacerbates neutrophil pathogenicity in ischemic stroke

    doi: 10.18632/aging.102632

    Figure Lengend Snippet: Age reduces expression of receptors and ligand required for proper neutrophil clearance. Neutrophils isolated from the blood of naïve young and aged mice were stained for neutrophil identification markers (CD45 + /CD11b + /Ly6C Int /Ly6G Hi ), surface chemokine receptors CXCR2 ( A ), CXCR4 ( B ) and the adhesion molecules L-selectin ( C ) and CD44 ( D ). Serum was taken from young (3 month) or aged (22 month) old animals 24 hours following sham or stroke surgery. n=7-12 animals/group. CXCL12 and CXCL2 were measured via multiplex ( E ). Two-way ANOVA was performed, followed by individual T-Tests with Sidak’s correction. ( F ) A schematic figure of the differential roles of CXCL12 and CXCL2 in circulating neutrophil homeostasis. *p≤0.05, **p=

    Article Snippet: In addition to neutrophil quantification markers described above and in , cells were also stained with an antibody cocktail containing four neutrophil surface markers: CD62L-FITC (Biolegend), CXCR4 PerCP-Cy5.5 (Biolegend), CXCR2 PE (Biolegend) and CD44 PE-Dazzle (Biolegend) and incubated for 30 minutes at RT.

    Techniques: Expressing, Isolation, Mouse Assay, Staining, Multiplex Assay

    Neutrophil changes in response to 10 weeks of high-intensity interval training (HIIT). Representative flow cytometric histograms showing ( a ) improved neutrophil phagocytosis of Escherichia coli , ( b ) phagocytic capacity, ( c ) representative diagram of the kinetic phorbol 12-myristate 13-acetate-stimulated ROS production, and ( d ) ROS generation (AUC) and neutrophil surface receptor expression pre- and post-HIIT training for ( e ) CXC chemokine receptor 2 (CXCR2), ( f ) cluster of differentiation 11b (CD11b)/CD18, ( g ) Toll-like receptor 4 (TLR4), and ( h ) CD16. All data are mean ± SEM ( n = 12). MFI Median fluorescence intensity

    Journal: Arthritis Research & Therapy

    Article Title: Ten weeks of high-intensity interval walk training is associated with reduced disease activity and improved innate immune function in older adults with rheumatoid arthritis: a pilot study

    doi: 10.1186/s13075-018-1624-x

    Figure Lengend Snippet: Neutrophil changes in response to 10 weeks of high-intensity interval training (HIIT). Representative flow cytometric histograms showing ( a ) improved neutrophil phagocytosis of Escherichia coli , ( b ) phagocytic capacity, ( c ) representative diagram of the kinetic phorbol 12-myristate 13-acetate-stimulated ROS production, and ( d ) ROS generation (AUC) and neutrophil surface receptor expression pre- and post-HIIT training for ( e ) CXC chemokine receptor 2 (CXCR2), ( f ) cluster of differentiation 11b (CD11b)/CD18, ( g ) Toll-like receptor 4 (TLR4), and ( h ) CD16. All data are mean ± SEM ( n = 12). MFI Median fluorescence intensity

    Article Snippet: Cells were stained with anti-CXCR2-phycoerythrin (anti-CXCR2-PE, clone 5E8-C7-F10; Thermo Fisher Scientific), anti-CD16-FITC (clone 3G8; BD Biosciences, San Jose, CA, USA), anti-CD11b-allophycocyanin (anti-CD11b-APC, clone ICRF44; BD Biosciences), anti-CD18-PE (clone 6.7; BD Biosciences), anti-Toll-like receptor 2 (TLR2)-Alexa Fluor 647 (clone 11G7; BD Biosciences), or anti-TLR4-APC (clone HTA-125; Thermo Fisher Scientific), or their relevant concentration-matched isotype controls for 60 minutes on ice in the dark.

    Techniques: Flow Cytometry, Expressing, Fluorescence

    Effects of CXCR2 or CXCL1 deficiency on the expression of P-selectin, E-selectin, and adhesion molecules in vivo and on BBB permeability. a The protein expression of P-selectin, E-selectin, VCAM-1, and ICAM-1 (4 h after i.c.v. saline injection) in the saline-treated control group of WT mice and LPS-treated (4 h after i.c.v. LPS injection) WT, CXCR2 −/− , and CXCL1 −/− mice was determined via Western blot analysis. Effects of CXCR2 or CXCL1 deficiency on P-selectin ( b ), VCAM-1 ( c ), and ICAM-1 ( d ) expression in the brain. e Western blotting analysis of the albumin levels in the brains of WT and CXCR2 −/− mice 4, 12, and 24 h after the intraventricular injection of LPS was performed. Optical densities were determined using a computer imaging analysis system. n = 5 mice per group. ** P

    Journal: Journal of Neuroinflammation

    Article Title: CXCR2 is essential for cerebral endothelial activation and leukocyte recruitment during neuroinflammation

    doi: 10.1186/s12974-015-0316-6

    Figure Lengend Snippet: Effects of CXCR2 or CXCL1 deficiency on the expression of P-selectin, E-selectin, and adhesion molecules in vivo and on BBB permeability. a The protein expression of P-selectin, E-selectin, VCAM-1, and ICAM-1 (4 h after i.c.v. saline injection) in the saline-treated control group of WT mice and LPS-treated (4 h after i.c.v. LPS injection) WT, CXCR2 −/− , and CXCL1 −/− mice was determined via Western blot analysis. Effects of CXCR2 or CXCL1 deficiency on P-selectin ( b ), VCAM-1 ( c ), and ICAM-1 ( d ) expression in the brain. e Western blotting analysis of the albumin levels in the brains of WT and CXCR2 −/− mice 4, 12, and 24 h after the intraventricular injection of LPS was performed. Optical densities were determined using a computer imaging analysis system. n = 5 mice per group. ** P

    Article Snippet: Therefore, both CXCL1 and CXCR2 play essential roles in LPS-induced neutrophil recruitment into the brain.

    Techniques: Expressing, In Vivo, Permeability, Injection, Mouse Assay, Western Blot, Imaging

    The effect of CXCR2 antagonist infusion on leukocyte rolling and adhesion in CNS vessels. WT mice received an intravenous injection of the CXCR2 antagonist SB225002 (1 mg/kg) 0.5 h prior to i.c.v. LPS injection. Four hours after i.c.v. LPS injection, the protein expression of P-selectin, VCAM-1, and E-selectin in the brain was determined by Western blot analysis ( A ). Intravital microscopy was performed on the mice. The results of leukocyte recruitment ( B ) are presented as the mean ± SEM. n = 4 mice for all groups. * P

    Journal: Journal of Neuroinflammation

    Article Title: CXCR2 is essential for cerebral endothelial activation and leukocyte recruitment during neuroinflammation

    doi: 10.1186/s12974-015-0316-6

    Figure Lengend Snippet: The effect of CXCR2 antagonist infusion on leukocyte rolling and adhesion in CNS vessels. WT mice received an intravenous injection of the CXCR2 antagonist SB225002 (1 mg/kg) 0.5 h prior to i.c.v. LPS injection. Four hours after i.c.v. LPS injection, the protein expression of P-selectin, VCAM-1, and E-selectin in the brain was determined by Western blot analysis ( A ). Intravital microscopy was performed on the mice. The results of leukocyte recruitment ( B ) are presented as the mean ± SEM. n = 4 mice for all groups. * P

    Article Snippet: Therefore, both CXCL1 and CXCR2 play essential roles in LPS-induced neutrophil recruitment into the brain.

    Techniques: Mouse Assay, Injection, Expressing, Western Blot, Intravital Microscopy

    Leukocyte recruitment and the expression of P-selectin and VCAM-1 in the WT, CXCR2 −/− , and chimeric mice. a Chimeric mice were generated by transferring bone marrow cells between WT and CXCR2 −/− mice. b Intravital microscopy was performed on WT, CXCR2 −/− , and chimeric mice, 4 h after i.c.v. LPS injection. The number of rolling and adherent leukocytes is presented as the mean ± SEM. c The expression of P-selectin and VCAM-1 in the WT, CXCR2 −/− , and chimeric mice was compared by Western blotting, n = 4 mice per group. Data are presented as the means ± SEM, * P

    Journal: Journal of Neuroinflammation

    Article Title: CXCR2 is essential for cerebral endothelial activation and leukocyte recruitment during neuroinflammation

    doi: 10.1186/s12974-015-0316-6

    Figure Lengend Snippet: Leukocyte recruitment and the expression of P-selectin and VCAM-1 in the WT, CXCR2 −/− , and chimeric mice. a Chimeric mice were generated by transferring bone marrow cells between WT and CXCR2 −/− mice. b Intravital microscopy was performed on WT, CXCR2 −/− , and chimeric mice, 4 h after i.c.v. LPS injection. The number of rolling and adherent leukocytes is presented as the mean ± SEM. c The expression of P-selectin and VCAM-1 in the WT, CXCR2 −/− , and chimeric mice was compared by Western blotting, n = 4 mice per group. Data are presented as the means ± SEM, * P

    Article Snippet: Therefore, both CXCL1 and CXCR2 play essential roles in LPS-induced neutrophil recruitment into the brain.

    Techniques: Expressing, Mouse Assay, Generated, Transferring, Intravital Microscopy, Injection, Western Blot

    Astrocyte-derived CXCL1 and endothelial CXCR2 are essential for cerebral endothelial activation. A i.c.v. LPS injection (4 h) induced significant CXCR2 mRNA expression in WT mice. B Levels of CXCR2 protein after i.c.v. LPS injection from 4 to 24 h gradually increased compared with the control group (4 h after i.c.v. saline injection). C The expression of CXCR2 mRNA in primary brain microvascular endothelial cells, microglia, and astrocytes stimulated with either vehicle or TNF-α (100 ng/ml) was measured via real-time PCR. The results are represented as the means ± SEM of three independent experiments; * P

    Journal: Journal of Neuroinflammation

    Article Title: CXCR2 is essential for cerebral endothelial activation and leukocyte recruitment during neuroinflammation

    doi: 10.1186/s12974-015-0316-6

    Figure Lengend Snippet: Astrocyte-derived CXCL1 and endothelial CXCR2 are essential for cerebral endothelial activation. A i.c.v. LPS injection (4 h) induced significant CXCR2 mRNA expression in WT mice. B Levels of CXCR2 protein after i.c.v. LPS injection from 4 to 24 h gradually increased compared with the control group (4 h after i.c.v. saline injection). C The expression of CXCR2 mRNA in primary brain microvascular endothelial cells, microglia, and astrocytes stimulated with either vehicle or TNF-α (100 ng/ml) was measured via real-time PCR. The results are represented as the means ± SEM of three independent experiments; * P

    Article Snippet: Therefore, both CXCL1 and CXCR2 play essential roles in LPS-induced neutrophil recruitment into the brain.

    Techniques: Derivative Assay, Activation Assay, Injection, Expressing, Mouse Assay, Real-time Polymerase Chain Reaction

    Generation of TALEN-mediated CXCL1 knockout mice. A DNA-binding sequences are presented in red or green, and the spacer region for CXCL1-TALEN where a double-strand break will occur is underlined. B T7 endonuclease I (T7EI) assays were conducted using genomic DNA from the founder mice. The arrow shows the size (300 bp) of T7EI-digested DNA fragments. #1, #2, and #3 are the mutant founder (F0) mice generated by injection with CXCL1-TALEN mRNA. C DNA sequences of the CXCL1 locus from live founder mice identified by T7E1 assays in B. “-” shows the deleted nucleotides. D Peripheral blood mononuclear cells and splenocytes were collected from wild-type or CXCL1 −/− mice. Numbers of CD45 + and Gr.1 + cells were quantified via flow cytometry. E Peripheral blood mononuclear cells were collected from wild-type or CXCL1 −/− mice, CXCR2 expression in neutrophils from WT and CXCR2 −/− mice were analyzed via flow cytometry. F mRNA expression levels of TLR4 and CXCR2 in the brain of WT or CXCL1 −/− mice were analyzed by RT-PCR. G Wild-type and CXCL1 −/− mice were treated with i.p. or i.c.v. LPS injection. Four hours later, levels of TNF-α and IL-6 in the brain tissue or plasma were determined by ELISA. Data are expressed as the mean ± SEM, n = 4 mice in all of the groups

    Journal: Journal of Neuroinflammation

    Article Title: CXCR2 is essential for cerebral endothelial activation and leukocyte recruitment during neuroinflammation

    doi: 10.1186/s12974-015-0316-6

    Figure Lengend Snippet: Generation of TALEN-mediated CXCL1 knockout mice. A DNA-binding sequences are presented in red or green, and the spacer region for CXCL1-TALEN where a double-strand break will occur is underlined. B T7 endonuclease I (T7EI) assays were conducted using genomic DNA from the founder mice. The arrow shows the size (300 bp) of T7EI-digested DNA fragments. #1, #2, and #3 are the mutant founder (F0) mice generated by injection with CXCL1-TALEN mRNA. C DNA sequences of the CXCL1 locus from live founder mice identified by T7E1 assays in B. “-” shows the deleted nucleotides. D Peripheral blood mononuclear cells and splenocytes were collected from wild-type or CXCL1 −/− mice. Numbers of CD45 + and Gr.1 + cells were quantified via flow cytometry. E Peripheral blood mononuclear cells were collected from wild-type or CXCL1 −/− mice, CXCR2 expression in neutrophils from WT and CXCR2 −/− mice were analyzed via flow cytometry. F mRNA expression levels of TLR4 and CXCR2 in the brain of WT or CXCL1 −/− mice were analyzed by RT-PCR. G Wild-type and CXCL1 −/− mice were treated with i.p. or i.c.v. LPS injection. Four hours later, levels of TNF-α and IL-6 in the brain tissue or plasma were determined by ELISA. Data are expressed as the mean ± SEM, n = 4 mice in all of the groups

    Article Snippet: Therefore, both CXCL1 and CXCR2 play essential roles in LPS-induced neutrophil recruitment into the brain.

    Techniques: Knock-Out, Mouse Assay, Binding Assay, Mutagenesis, Generated, Injection, Flow Cytometry, Cytometry, Expressing, Reverse Transcription Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay

    Chemokine levels and the effect of CXCR2 or CXCL1 deficiency on neutrophil recruitment to the brain parenchyma after i.c.v. LPS injection. Wild-type mice were i.c.v. injected with LPS. CXCL1 ( A ), CXCL2 ( B ), and CXCL5 ( C ) concentrations in the brains of WT (C57BL/6J) mice were determined via ELISA at various time points after i.c.v. LPS injection. WT mice i.c.v. injected with saline for 24 h served as negative controls. Infiltrating neutrophils in the cortex ( D ) and hippocampus ( E ) were quantified via esterase staining of the brain sections 4, 12, 24, or 48 h after i.c.v. LPS or saline injection. ( F ) The WT, CXCR2 −/− , and CXCL1 mice were i.c.v. injected with LPS 24 h before the quantification of infiltrating neutrophils. Representative photomicrographs of brain sections stained for esterase positive neutrophils (arrows) from wild-type, ( G–I ) CXCR2 −/− and CXCL1 mice. Scale bar: 100 μm; 10 μm (inset). CXCR2 and CXCL1 deficiency significantly reduced neutrophil recruitment in the cortex ( G ), hippocampus ( H ), and choroid plexus ( I ). The results are presented as the means ± SEM and represent a minimum of five mice per group. * P

    Journal: Journal of Neuroinflammation

    Article Title: CXCR2 is essential for cerebral endothelial activation and leukocyte recruitment during neuroinflammation

    doi: 10.1186/s12974-015-0316-6

    Figure Lengend Snippet: Chemokine levels and the effect of CXCR2 or CXCL1 deficiency on neutrophil recruitment to the brain parenchyma after i.c.v. LPS injection. Wild-type mice were i.c.v. injected with LPS. CXCL1 ( A ), CXCL2 ( B ), and CXCL5 ( C ) concentrations in the brains of WT (C57BL/6J) mice were determined via ELISA at various time points after i.c.v. LPS injection. WT mice i.c.v. injected with saline for 24 h served as negative controls. Infiltrating neutrophils in the cortex ( D ) and hippocampus ( E ) were quantified via esterase staining of the brain sections 4, 12, 24, or 48 h after i.c.v. LPS or saline injection. ( F ) The WT, CXCR2 −/− , and CXCL1 mice were i.c.v. injected with LPS 24 h before the quantification of infiltrating neutrophils. Representative photomicrographs of brain sections stained for esterase positive neutrophils (arrows) from wild-type, ( G–I ) CXCR2 −/− and CXCL1 mice. Scale bar: 100 μm; 10 μm (inset). CXCR2 and CXCL1 deficiency significantly reduced neutrophil recruitment in the cortex ( G ), hippocampus ( H ), and choroid plexus ( I ). The results are presented as the means ± SEM and represent a minimum of five mice per group. * P

    Article Snippet: Therefore, both CXCL1 and CXCR2 play essential roles in LPS-induced neutrophil recruitment into the brain.

    Techniques: Injection, Mouse Assay, Enzyme-linked Immunosorbent Assay, Staining

    The effect of CXCR2 or CXCL1 deficiency on the mRNA expression of adhesion molecules in vivo. The mRNA expression of P-selectin, E-selectin, VCAM-1, and ICAM-1 saline-treated (4 h after i.c.v. saline injection) control group of WT mice and LPS-treated (4 h after i.c.v. LPS injection) WT, CXCR2 −/− , and CXCL1 −/− mice was quantified via real-time PCR. Both CXCR2 and CXCL1 deficiency resulted in the down-regulation of P-selectin ( A ), E-selectin ( B ), VCAM-1 ( C ), and ICAM-1 ( D ) mRNA expression in the brain. n = 6–8 mice for all groups. * P

    Journal: Journal of Neuroinflammation

    Article Title: CXCR2 is essential for cerebral endothelial activation and leukocyte recruitment during neuroinflammation

    doi: 10.1186/s12974-015-0316-6

    Figure Lengend Snippet: The effect of CXCR2 or CXCL1 deficiency on the mRNA expression of adhesion molecules in vivo. The mRNA expression of P-selectin, E-selectin, VCAM-1, and ICAM-1 saline-treated (4 h after i.c.v. saline injection) control group of WT mice and LPS-treated (4 h after i.c.v. LPS injection) WT, CXCR2 −/− , and CXCL1 −/− mice was quantified via real-time PCR. Both CXCR2 and CXCL1 deficiency resulted in the down-regulation of P-selectin ( A ), E-selectin ( B ), VCAM-1 ( C ), and ICAM-1 ( D ) mRNA expression in the brain. n = 6–8 mice for all groups. * P

    Article Snippet: Therefore, both CXCL1 and CXCR2 play essential roles in LPS-induced neutrophil recruitment into the brain.

    Techniques: Expressing, In Vivo, Injection, Mouse Assay, Real-time Polymerase Chain Reaction

    CXCR2 deficiency causes decreased leukocyte rolling and adhesion in brain vessels after i.c.v. LPS injection. Intravital microscopy was performed on wild-type ( A ), CXCR2 −/− ( B ), and CXCL1 −/− mice ( C ) 4 h after LPS i.c.v. injection. The results of rolling flux ( D ) and leukocyte adhesion ( E ) are presented as the means ± SEM. n = 4–6 mice per group. ** P

    Journal: Journal of Neuroinflammation

    Article Title: CXCR2 is essential for cerebral endothelial activation and leukocyte recruitment during neuroinflammation

    doi: 10.1186/s12974-015-0316-6

    Figure Lengend Snippet: CXCR2 deficiency causes decreased leukocyte rolling and adhesion in brain vessels after i.c.v. LPS injection. Intravital microscopy was performed on wild-type ( A ), CXCR2 −/− ( B ), and CXCL1 −/− mice ( C ) 4 h after LPS i.c.v. injection. The results of rolling flux ( D ) and leukocyte adhesion ( E ) are presented as the means ± SEM. n = 4–6 mice per group. ** P

    Article Snippet: Therefore, both CXCL1 and CXCR2 play essential roles in LPS-induced neutrophil recruitment into the brain.

    Techniques: Injection, Intravital Microscopy, Mouse Assay