ctbp - Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • ctbp  (Abnova)
    91
    Abnova ctbp
    Ctbp, supplied by Abnova, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ctbp/product/Abnova
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    ctbp - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    88
    Santa Cruz Biotechnology ctbp
    Association of <t>CtBP</t> with <t>HDGF</t> in vitro and in vivo
    Ctbp, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 88/100, based on 71 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ctbp/product/Santa Cruz Biotechnology
    Average 88 stars, based on 71 article reviews
    Price from $9.99 to $1999.99
    ctbp - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    85
    Santa Cruz Biotechnology ribbon protein ctbp
    Association of <t>CtBP</t> with <t>HDGF</t> in vitro and in vivo
    Ribbon Protein Ctbp, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ribbon protein ctbp/product/Santa Cruz Biotechnology
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    ribbon protein ctbp - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Thermo Fisher human ctbp
    Association of <t>CtBP</t> with <t>HDGF</t> in vitro and in vivo
    Human Ctbp, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human ctbp/product/Thermo Fisher
    Average 85 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    human ctbp - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    88
    Horizon Discovery ctbp
    <t>CtBP</t> inhibits <t>GATA3</t> expression by inhibiting the interaction of β-catenin and TCF. A and B , GATA3 expression was determined at the RNA and protein levels in 3T3-L3 preadipocytes without or with CtBP knockdown ( KD ) by RT-PCR ( A ) and Western blotting
    Ctbp, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ctbp/product/Horizon Discovery
    Average 88 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    ctbp - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    88
    Synaptic Systems ctbp
    <t>CtBP</t> inhibits <t>GATA3</t> expression by inhibiting the interaction of β-catenin and TCF. A and B , GATA3 expression was determined at the RNA and protein levels in 3T3-L3 preadipocytes without or with CtBP knockdown ( KD ) by RT-PCR ( A ) and Western blotting
    Ctbp, supplied by Synaptic Systems, used in various techniques. Bioz Stars score: 88/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ctbp/product/Synaptic Systems
    Average 88 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    ctbp - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    93
    Abcam anti ctbp 2
    <t>CtBP</t> inhibits <t>GATA3</t> expression by inhibiting the interaction of β-catenin and TCF. A and B , GATA3 expression was determined at the RNA and protein levels in 3T3-L3 preadipocytes without or with CtBP knockdown ( KD ) by RT-PCR ( A ) and Western blotting
    Anti Ctbp 2, supplied by Abcam, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti ctbp 2/product/Abcam
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    anti ctbp 2 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    93
    Polyplus Transfection ctbp sirnas
    <t>CtBP</t> inhibits <t>GATA3</t> expression by inhibiting the interaction of β-catenin and TCF. A and B , GATA3 expression was determined at the RNA and protein levels in 3T3-L3 preadipocytes without or with CtBP knockdown ( KD ) by RT-PCR ( A ) and Western blotting
    Ctbp Sirnas, supplied by Polyplus Transfection, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ctbp sirnas/product/Polyplus Transfection
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    ctbp sirnas - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    92
    Cell Signaling Technology Inc ctbp 1
    <t>CtBP</t> inhibits <t>GATA3</t> expression by inhibiting the interaction of β-catenin and TCF. A and B , GATA3 expression was determined at the RNA and protein levels in 3T3-L3 preadipocytes without or with CtBP knockdown ( KD ) by RT-PCR ( A ) and Western blotting
    Ctbp 1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 92/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ctbp 1/product/Cell Signaling Technology Inc
    Average 92 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    ctbp 1 - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    85
    Horizon Discovery ctbp small interfering rnas sirnas
    <t>CtBP</t> is required for the repressing abilities of BCL-3 and to prevent excessive BCL-3 degradation. (A) CtBP is required for BCL-3 stability. (Top) GFP (negative control)- or CtBP-depleted, BCL-3-expressing 293 (left) or Karpas (right) cells were either left untreated (lanes 1 and 6) or stimulated with cycloheximide (CHX) (50 μg/ml) (lanes 2 to 5 and 7 to 10), and cell extracts were subjected to Western blotting (WB) with antibodies against Hsp90, BCL-3, and CtBP, as indicated. (Bottom) Quantification of BCL-3 levels under control conditions or upon CtBP depletion in BCL-3-expressing 293 cells (left) or in Karpas cells (right). The signal intensity in unstimulated GFP siRNA cells is set to 100%. (B) The N-terminal PVDLR motif is required for the repressing abilities of BCL-3. HaCat cells were infected either with a control lentivirus (negative control) or with a lentivirus expressing WT BCL-3 or BCL-3 LAV. Western blots with antibodies against BCL-3 and Hsp90, performed on extracts from the corresponding experimental conditions in order to ensure comparable levels of WT and mutated BCL-3 products, are shown at the top. Total <t>RNAs</t> from the resulting cells were subjected to real-time PCR in order to assess the mRNA levels of PLAUR, RAB7L1, STAP2, and AP1S2, all genes repressed by WT BCL-3 in transformed keratinocytes (data not shown). The abundance of transcripts in cells infected with the control lentivirus was set to 1, and their levels in cells infected with the other lentivirus were relative to that after normalization with 18S rRNA. Data from three (PLAUR and RAB7L1), four (AP1S2), or five (STAP2) independent experiments (means ± standard deviations) are shown. (C) Chromatin immunoprecipitation assays with an anti-HA (negative control), anti-BCL-3 (left), or anti-CtBP (right) antibody (Ab) were performed using control, WT BCL-3-expressing, or BCL-3 LAV-expressing HaCat cells. Associated DNA was analyzed by real-time PCR using primers derived from the promoter of the PLAUR gene (data not shown). Data from two independent experiments (means ± standard deviations) are shown.
    Ctbp Small Interfering Rnas Sirnas, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ctbp small interfering rnas sirnas/product/Horizon Discovery
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ctbp small interfering rnas sirnas - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Stratagene ctbp cdnas
    <t>CtBP</t> is required for the repressing abilities of BCL-3 and to prevent excessive BCL-3 degradation. (A) CtBP is required for BCL-3 stability. (Top) GFP (negative control)- or CtBP-depleted, BCL-3-expressing 293 (left) or Karpas (right) cells were either left untreated (lanes 1 and 6) or stimulated with cycloheximide (CHX) (50 μg/ml) (lanes 2 to 5 and 7 to 10), and cell extracts were subjected to Western blotting (WB) with antibodies against Hsp90, BCL-3, and CtBP, as indicated. (Bottom) Quantification of BCL-3 levels under control conditions or upon CtBP depletion in BCL-3-expressing 293 cells (left) or in Karpas cells (right). The signal intensity in unstimulated GFP siRNA cells is set to 100%. (B) The N-terminal PVDLR motif is required for the repressing abilities of BCL-3. HaCat cells were infected either with a control lentivirus (negative control) or with a lentivirus expressing WT BCL-3 or BCL-3 LAV. Western blots with antibodies against BCL-3 and Hsp90, performed on extracts from the corresponding experimental conditions in order to ensure comparable levels of WT and mutated BCL-3 products, are shown at the top. Total <t>RNAs</t> from the resulting cells were subjected to real-time PCR in order to assess the mRNA levels of PLAUR, RAB7L1, STAP2, and AP1S2, all genes repressed by WT BCL-3 in transformed keratinocytes (data not shown). The abundance of transcripts in cells infected with the control lentivirus was set to 1, and their levels in cells infected with the other lentivirus were relative to that after normalization with 18S rRNA. Data from three (PLAUR and RAB7L1), four (AP1S2), or five (STAP2) independent experiments (means ± standard deviations) are shown. (C) Chromatin immunoprecipitation assays with an anti-HA (negative control), anti-BCL-3 (left), or anti-CtBP (right) antibody (Ab) were performed using control, WT BCL-3-expressing, or BCL-3 LAV-expressing HaCat cells. Associated DNA was analyzed by real-time PCR using primers derived from the promoter of the PLAUR gene (data not shown). Data from two independent experiments (means ± standard deviations) are shown.
    Ctbp Cdnas, supplied by Stratagene, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ctbp cdnas/product/Stratagene
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    ctbp cdnas - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Mimetics arf ctbp interaction
    p53-independent stress-induced apoptosis through an <t>ARF/CtBP/Bik</t> pathway in colon cancer cells. ( a ) Apoptosis assay: HCT 116: p53−/− cells were stably infected with control (shCon), shBik1, or shBik2 lentiviruses and transiently transfected
    Arf Ctbp Interaction, supplied by Mimetics, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/arf ctbp interaction/product/Mimetics
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    arf ctbp interaction - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    88
    Upstate Biotechnology Inc ctbp
    The MLL(R/MT) and RD1 domains interact with <t>CtBP</t> and HPC2. ( A ) <t>Gal4-CtBP</t> protein expressed in 293T cells was pulled down with equivalent amounts of bacterially expressed GST alone, GST-MLL(R/MT), GST-MLL(RD1), or GST-MLL(RD2). Anti-Gal4 antibody was used to detect bound CtBP. Input (5%) is indicated. ( B ) Anti-FLAG IP. Transfected FLAG-tagged MLL(RD1), MLL(1101–1238), and MLL (1–672) (as a negative control) or FLAG vector were immunoprecipitated from 293T extracts with anti-FLAG beads. Anti-CtBP antibody was used to detect endogenous bound CtBP. ( C ) HPC2 interacts with MLL(R/MT) and MLL(RD1). Bacterially expressed GST-HPC2 was used to pull down FLAG-MLL(RD1) and FLAG-MLL(RD2) expressed by transient transfection in 293T cells and detected with anti-FLAG antibody. FLAG-CtBP and 293T extract were positive and negative controls, respectively. Input proteins (20%) are indicated. ( D ) GST-MLL pull-down assay. IVTT-expressed 35 S-labeled full-length HPC2 (or HDAC1 as a positive control) was incubated with equivalent amounts of bacterially expressed GST alone, GST-MLL(RD1), or GST-MLL (R/MT). Bound proteins were detected by autoradiography. Input (2.5%) is indicated.
    Ctbp, supplied by Upstate Biotechnology Inc, used in various techniques. Bioz Stars score: 88/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ctbp/product/Upstate Biotechnology Inc
    Average 88 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    ctbp - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    91
    Santa Cruz Biotechnology goat polyclonal anti ctbp
    The MLL(R/MT) and RD1 domains interact with <t>CtBP</t> and HPC2. ( A ) <t>Gal4-CtBP</t> protein expressed in 293T cells was pulled down with equivalent amounts of bacterially expressed GST alone, GST-MLL(R/MT), GST-MLL(RD1), or GST-MLL(RD2). Anti-Gal4 antibody was used to detect bound CtBP. Input (5%) is indicated. ( B ) Anti-FLAG IP. Transfected FLAG-tagged MLL(RD1), MLL(1101–1238), and MLL (1–672) (as a negative control) or FLAG vector were immunoprecipitated from 293T extracts with anti-FLAG beads. Anti-CtBP antibody was used to detect endogenous bound CtBP. ( C ) HPC2 interacts with MLL(R/MT) and MLL(RD1). Bacterially expressed GST-HPC2 was used to pull down FLAG-MLL(RD1) and FLAG-MLL(RD2) expressed by transient transfection in 293T cells and detected with anti-FLAG antibody. FLAG-CtBP and 293T extract were positive and negative controls, respectively. Input proteins (20%) are indicated. ( D ) GST-MLL pull-down assay. IVTT-expressed 35 S-labeled full-length HPC2 (or HDAC1 as a positive control) was incubated with equivalent amounts of bacterially expressed GST alone, GST-MLL(RD1), or GST-MLL (R/MT). Bound proteins were detected by autoradiography. Input (2.5%) is indicated.
    Goat Polyclonal Anti Ctbp, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/goat polyclonal anti ctbp/product/Santa Cruz Biotechnology
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    goat polyclonal anti ctbp - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    85
    Promega ctbp 2nd fragment
    The MLL(R/MT) and RD1 domains interact with <t>CtBP</t> and HPC2. ( A ) <t>Gal4-CtBP</t> protein expressed in 293T cells was pulled down with equivalent amounts of bacterially expressed GST alone, GST-MLL(R/MT), GST-MLL(RD1), or GST-MLL(RD2). Anti-Gal4 antibody was used to detect bound CtBP. Input (5%) is indicated. ( B ) Anti-FLAG IP. Transfected FLAG-tagged MLL(RD1), MLL(1101–1238), and MLL (1–672) (as a negative control) or FLAG vector were immunoprecipitated from 293T extracts with anti-FLAG beads. Anti-CtBP antibody was used to detect endogenous bound CtBP. ( C ) HPC2 interacts with MLL(R/MT) and MLL(RD1). Bacterially expressed GST-HPC2 was used to pull down FLAG-MLL(RD1) and FLAG-MLL(RD2) expressed by transient transfection in 293T cells and detected with anti-FLAG antibody. FLAG-CtBP and 293T extract were positive and negative controls, respectively. Input proteins (20%) are indicated. ( D ) GST-MLL pull-down assay. IVTT-expressed 35 S-labeled full-length HPC2 (or HDAC1 as a positive control) was incubated with equivalent amounts of bacterially expressed GST alone, GST-MLL(RD1), or GST-MLL (R/MT). Bound proteins were detected by autoradiography. Input (2.5%) is indicated.
    Ctbp 2nd Fragment, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ctbp 2nd fragment/product/Promega
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    ctbp 2nd fragment - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Santa Cruz Biotechnology ctbp e 12
    The MLL(R/MT) and RD1 domains interact with <t>CtBP</t> and HPC2. ( A ) <t>Gal4-CtBP</t> protein expressed in 293T cells was pulled down with equivalent amounts of bacterially expressed GST alone, GST-MLL(R/MT), GST-MLL(RD1), or GST-MLL(RD2). Anti-Gal4 antibody was used to detect bound CtBP. Input (5%) is indicated. ( B ) Anti-FLAG IP. Transfected FLAG-tagged MLL(RD1), MLL(1101–1238), and MLL (1–672) (as a negative control) or FLAG vector were immunoprecipitated from 293T extracts with anti-FLAG beads. Anti-CtBP antibody was used to detect endogenous bound CtBP. ( C ) HPC2 interacts with MLL(R/MT) and MLL(RD1). Bacterially expressed GST-HPC2 was used to pull down FLAG-MLL(RD1) and FLAG-MLL(RD2) expressed by transient transfection in 293T cells and detected with anti-FLAG antibody. FLAG-CtBP and 293T extract were positive and negative controls, respectively. Input proteins (20%) are indicated. ( D ) GST-MLL pull-down assay. IVTT-expressed 35 S-labeled full-length HPC2 (or HDAC1 as a positive control) was incubated with equivalent amounts of bacterially expressed GST alone, GST-MLL(RD1), or GST-MLL (R/MT). Bound proteins were detected by autoradiography. Input (2.5%) is indicated.
    Ctbp E 12, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ctbp e 12/product/Santa Cruz Biotechnology
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ctbp e 12 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Santa Cruz Biotechnology mouse monoclonal ctbp antibody
    Treatment with the <t>ZEB1–CtBP</t> inhibitor NSC95397 causes translocation and reduction of Zeb1, proliferation, migration, and tube formation of mRMVECs. Compared to PBS control, ( a – b ) one-day 10 µM NSC95397 treatment translocated Zeb1 from the nucleus to the cytosol in mRMVECs while 10 mM MTOB had no such an effect. c This Zeb1 translocation was validated by WB on nuclear and cytosolic fractions of total protein samples isolated from the PBS control, NSC95397- or MTOB-treated mRMVECs using Ctbp and Actb antibodies as relevant nuclear and cytosolic controls though Actb also showed high expression in the nucleus as reported 43 . “C” for cytosolic fraction while “N” for nuclear fraction. d Both 10 mM MTOB and 10 µM NSC95397 significantly reduced Zeb1 mRNA in mRMVECs and e cell proliferation rates, but only 10 µM NSC95397 significantly reduced ( f ) cell migration, and g cell tube formation. * p ≤ 0.05; ** p ≤ 0.01. Scale bars represent 100 µm.
    Mouse Monoclonal Ctbp Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 85/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse monoclonal ctbp antibody/product/Santa Cruz Biotechnology
    Average 85 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    mouse monoclonal ctbp antibody - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    91
    Millipore c terminal binding protein ctbp
    Differential binding and accumulation of proteins associated with the β-catenin/TCF-4 transcriptional complex (A-B) Interaction of the associated proteins such as β-catenin, CBP, <t>TLE</t> and <t>CtBP</t> with the complex in HAK-1A (A) and Huh7 (B) cells. The β-catenin/TCF-4 transcriptional complex was prepared from nuclear extracts (Nuc) immunoprecipitated (IP) with anti-c-Myc antibody after transfection of empty vector (EV), TCF-4J, and TCF-4K with a β-catenin expression construct. The co-factor proteins in the complex was detected by Western blot analysis using antibodies against Myc-tag (arrow), TCF-4 (arrow), β-catenin, CBP, TLE and CtBP, and quantified after normalization to Myc-tag detection level. The bar charts show the ratio of the quantified amount of each co-factor protein in the complex to that found in TCF-4J expressing cells. The dotted line represents the level of each protein observed in TCF-4J expressing cells. The results are shown as the mean ± SD. *, p
    C Terminal Binding Protein Ctbp, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c terminal binding protein ctbp/product/Millipore
    Average 91 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    c terminal binding protein ctbp - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    85
    Santa Cruz Biotechnology anti c terminal binding protein ctbp
    Differential binding and accumulation of proteins associated with the β-catenin/TCF-4 transcriptional complex (A-B) Interaction of the associated proteins such as β-catenin, CBP, <t>TLE</t> and <t>CtBP</t> with the complex in HAK-1A (A) and Huh7 (B) cells. The β-catenin/TCF-4 transcriptional complex was prepared from nuclear extracts (Nuc) immunoprecipitated (IP) with anti-c-Myc antibody after transfection of empty vector (EV), TCF-4J, and TCF-4K with a β-catenin expression construct. The co-factor proteins in the complex was detected by Western blot analysis using antibodies against Myc-tag (arrow), TCF-4 (arrow), β-catenin, CBP, TLE and CtBP, and quantified after normalization to Myc-tag detection level. The bar charts show the ratio of the quantified amount of each co-factor protein in the complex to that found in TCF-4J expressing cells. The dotted line represents the level of each protein observed in TCF-4J expressing cells. The results are shown as the mean ± SD. *, p
    Anti C Terminal Binding Protein Ctbp, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti c terminal binding protein ctbp/product/Santa Cruz Biotechnology
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    anti c terminal binding protein ctbp - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Upstate Biotechnology Inc anti ctbp 1
    Differential binding and accumulation of proteins associated with the β-catenin/TCF-4 transcriptional complex (A-B) Interaction of the associated proteins such as β-catenin, CBP, <t>TLE</t> and <t>CtBP</t> with the complex in HAK-1A (A) and Huh7 (B) cells. The β-catenin/TCF-4 transcriptional complex was prepared from nuclear extracts (Nuc) immunoprecipitated (IP) with anti-c-Myc antibody after transfection of empty vector (EV), TCF-4J, and TCF-4K with a β-catenin expression construct. The co-factor proteins in the complex was detected by Western blot analysis using antibodies against Myc-tag (arrow), TCF-4 (arrow), β-catenin, CBP, TLE and CtBP, and quantified after normalization to Myc-tag detection level. The bar charts show the ratio of the quantified amount of each co-factor protein in the complex to that found in TCF-4J expressing cells. The dotted line represents the level of each protein observed in TCF-4J expressing cells. The results are shown as the mean ± SD. *, p
    Anti Ctbp 1, supplied by Upstate Biotechnology Inc, used in various techniques. Bioz Stars score: 85/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti ctbp 1/product/Upstate Biotechnology Inc
    Average 85 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    anti ctbp 1 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    91
    Abnova mouse monoclonal anti ctbp
    Knockdown of <t>CtBP</t> eliminates the effects of 2DG and glucose-free medium. a Representative western blot showing reduced expression of CtBP1/2 protein in RAW264.7 cells transfected with shRNA targeting CtBP1 and CtBP2 (CtBP KD). Full length immunoblots are shown in Supplementary Fig. 3 . b , c shRNA knockdown of CtBP1/2 negates the effect of both 2DG and glucose-free medium on LPS-induced <t>iNOS</t> expression and nitric oxide production. Results for wild-type (WT) cells were normalized to control (no LPS) WT cells, and results for CtBP knockdown cells (CtBP KD) were normalized to control CtBP KD cells. n = 4; * p
    Mouse Monoclonal Anti Ctbp, supplied by Abnova, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse monoclonal anti ctbp/product/Abnova
    Average 91 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    mouse monoclonal anti ctbp - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    Image Search Results


    Association of CtBP with HDGF in vitro and in vivo

    Journal: Journal of molecular biology

    Article Title: Hepatoma Derived Growth Factor represses SET and MYND domain containing 1 gene expression through interaction with C-terminal binding protein

    doi: 10.1016/j.jmb.2008.12.080

    Figure Lengend Snippet: Association of CtBP with HDGF in vitro and in vivo

    Article Snippet: Endogenous proteins were immunoprecipitated from MCF-7 cell lysates using monoclonal anti-HDGF or CtBP (Santa Cruz) antibodies coupled to protein A/G beads (Santa Cruz) and washed three times with cold PBS.

    Techniques: In Vitro, In Vivo

    CtBP mediated the trans-repressive activity of HDGF. A, Reporter gene construct G5-SV-LUC (0.5 ug) and pRL-CMV (50 ng) were cotransfected with (left panel) or without GBD-HDGF (right panel) and increasing amounts of CtBP expression construct (0.5, 1,

    Journal: Journal of molecular biology

    Article Title: Hepatoma Derived Growth Factor represses SET and MYND domain containing 1 gene expression through interaction with C-terminal binding protein

    doi: 10.1016/j.jmb.2008.12.080

    Figure Lengend Snippet: CtBP mediated the trans-repressive activity of HDGF. A, Reporter gene construct G5-SV-LUC (0.5 ug) and pRL-CMV (50 ng) were cotransfected with (left panel) or without GBD-HDGF (right panel) and increasing amounts of CtBP expression construct (0.5, 1,

    Article Snippet: Endogenous proteins were immunoprecipitated from MCF-7 cell lysates using monoclonal anti-HDGF or CtBP (Santa Cruz) antibodies coupled to protein A/G beads (Santa Cruz) and washed three times with cold PBS.

    Techniques: Activity Assay, Construct, Expressing

    HDGF interacted with CtBP. A, GST-HDGF fusion proteins (lane 1, wild type, lane 5, DL-AS mutant) were conjugated to glutathione-agarose beads and incubated with whole cell lysate of MCF-7 cells, as described under “Experimental Procedures.”

    Journal: Journal of molecular biology

    Article Title: Hepatoma Derived Growth Factor represses SET and MYND domain containing 1 gene expression through interaction with C-terminal binding protein

    doi: 10.1016/j.jmb.2008.12.080

    Figure Lengend Snippet: HDGF interacted with CtBP. A, GST-HDGF fusion proteins (lane 1, wild type, lane 5, DL-AS mutant) were conjugated to glutathione-agarose beads and incubated with whole cell lysate of MCF-7 cells, as described under “Experimental Procedures.”

    Article Snippet: Endogenous proteins were immunoprecipitated from MCF-7 cell lysates using monoclonal anti-HDGF or CtBP (Santa Cruz) antibodies coupled to protein A/G beads (Santa Cruz) and washed three times with cold PBS.

    Techniques: Mutagenesis, Incubation

    HDGF induced the nuclear accumulation of CtBP. MCF-7 cells grown on cover slips were transfected with 0.5 ug of CFP-CtBP and GFP-HDGF (top panel) or GFP (2 nd panel) for 48 hours, cells were fixed in 1% paraformaldehyde and the cover slips were mounted

    Journal: Journal of molecular biology

    Article Title: Hepatoma Derived Growth Factor represses SET and MYND domain containing 1 gene expression through interaction with C-terminal binding protein

    doi: 10.1016/j.jmb.2008.12.080

    Figure Lengend Snippet: HDGF induced the nuclear accumulation of CtBP. MCF-7 cells grown on cover slips were transfected with 0.5 ug of CFP-CtBP and GFP-HDGF (top panel) or GFP (2 nd panel) for 48 hours, cells were fixed in 1% paraformaldehyde and the cover slips were mounted

    Article Snippet: Endogenous proteins were immunoprecipitated from MCF-7 cell lysates using monoclonal anti-HDGF or CtBP (Santa Cruz) antibodies coupled to protein A/G beads (Santa Cruz) and washed three times with cold PBS.

    Techniques: Transfection

    C/EBPα interacts with CtBP1/2 in 3T3-L1 adipocytes. Nuclear extracts isolated from 3T3-L1 adipocytes treated or not with troglitazone (Trog) were subjected to immunoprecipitation for purification of specific complexes using antibody against C/EBPα, PPARγ, or IgG as outlined in Materials and Methods. The immunoprecipitated proteins in each complex were then subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and CtBP1/2 was detected by Western blotting using a pan-CtBP antibody.

    Journal: Molecular and Cellular Biology

    Article Title: C/EBPα and the Corepressors CtBP1 and CtBP2 Regulate Repression of Select Visceral White Adipose Genes during Induction of the Brown Phenotype in White Adipocytes by Peroxisome Proliferator-Activated Receptor γ Agonists

    doi: 10.1128/MCB.01899-08

    Figure Lengend Snippet: C/EBPα interacts with CtBP1/2 in 3T3-L1 adipocytes. Nuclear extracts isolated from 3T3-L1 adipocytes treated or not with troglitazone (Trog) were subjected to immunoprecipitation for purification of specific complexes using antibody against C/EBPα, PPARγ, or IgG as outlined in Materials and Methods. The immunoprecipitated proteins in each complex were then subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and CtBP1/2 was detected by Western blotting using a pan-CtBP antibody.

    Article Snippet: The chromatin fractions were incubated in each case with 2 μg of one of the following antibodies: anti-PPARγ (Santa Cruz), anti-C/EBPγ (Santa Cruz), anti-CtBP (Santa Cruz), anti-acetylated histone H3 (provided by the Millipore kit), and mouse and rabbit IgG (Millipore) at 4°C overnight with magnetic protein G beads.

    Techniques: Isolation, Immunoprecipitation, Purification, Polyacrylamide Gel Electrophoresis, Western Blot

    CtBP inhibits GATA3 expression by inhibiting the interaction of β-catenin and TCF. A and B , GATA3 expression was determined at the RNA and protein levels in 3T3-L3 preadipocytes without or with CtBP knockdown ( KD ) by RT-PCR ( A ) and Western blotting

    Journal: The Journal of Biological Chemistry

    Article Title: Wnt/β-Catenin Mediates AICAR Effect to Increase GATA3 Expression and Inhibit Adipogenesis *

    doi: 10.1074/jbc.M115.641332

    Figure Lengend Snippet: CtBP inhibits GATA3 expression by inhibiting the interaction of β-catenin and TCF. A and B , GATA3 expression was determined at the RNA and protein levels in 3T3-L3 preadipocytes without or with CtBP knockdown ( KD ) by RT-PCR ( A ) and Western blotting

    Article Snippet: For the knockdown experiments, siRNAs specific for GATA3 (SMARTpool of several siRNAs selected by Dharmacon), CtBP (SMARTpool of several siRNAs selected by Dharmacon), AMPK (SMARTpool of several siRNAs selected by Dharmacon), β-catenin (AAACATAATGAGGACCTACAC), and the negative control siRNA (5′-AAUUCUCCGAACGUGUCACGU-3′) (Thermo Scientific Dharmacon) were transfected into the 3T3-L1 adipocytes via a DharmaFECT transfection reagent.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot

    CtBP is required for the repressing abilities of BCL-3 and to prevent excessive BCL-3 degradation. (A) CtBP is required for BCL-3 stability. (Top) GFP (negative control)- or CtBP-depleted, BCL-3-expressing 293 (left) or Karpas (right) cells were either left untreated (lanes 1 and 6) or stimulated with cycloheximide (CHX) (50 μg/ml) (lanes 2 to 5 and 7 to 10), and cell extracts were subjected to Western blotting (WB) with antibodies against Hsp90, BCL-3, and CtBP, as indicated. (Bottom) Quantification of BCL-3 levels under control conditions or upon CtBP depletion in BCL-3-expressing 293 cells (left) or in Karpas cells (right). The signal intensity in unstimulated GFP siRNA cells is set to 100%. (B) The N-terminal PVDLR motif is required for the repressing abilities of BCL-3. HaCat cells were infected either with a control lentivirus (negative control) or with a lentivirus expressing WT BCL-3 or BCL-3 LAV. Western blots with antibodies against BCL-3 and Hsp90, performed on extracts from the corresponding experimental conditions in order to ensure comparable levels of WT and mutated BCL-3 products, are shown at the top. Total RNAs from the resulting cells were subjected to real-time PCR in order to assess the mRNA levels of PLAUR, RAB7L1, STAP2, and AP1S2, all genes repressed by WT BCL-3 in transformed keratinocytes (data not shown). The abundance of transcripts in cells infected with the control lentivirus was set to 1, and their levels in cells infected with the other lentivirus were relative to that after normalization with 18S rRNA. Data from three (PLAUR and RAB7L1), four (AP1S2), or five (STAP2) independent experiments (means ± standard deviations) are shown. (C) Chromatin immunoprecipitation assays with an anti-HA (negative control), anti-BCL-3 (left), or anti-CtBP (right) antibody (Ab) were performed using control, WT BCL-3-expressing, or BCL-3 LAV-expressing HaCat cells. Associated DNA was analyzed by real-time PCR using primers derived from the promoter of the PLAUR gene (data not shown). Data from two independent experiments (means ± standard deviations) are shown.

    Journal: Molecular and Cellular Biology

    Article Title: The Repressing Function of the Oncoprotein BCL-3 Requires CtBP, while Its Polyubiquitination and Degradation Involve the E3 Ligase TBLR1 ▿

    doi: 10.1128/MCB.01600-09

    Figure Lengend Snippet: CtBP is required for the repressing abilities of BCL-3 and to prevent excessive BCL-3 degradation. (A) CtBP is required for BCL-3 stability. (Top) GFP (negative control)- or CtBP-depleted, BCL-3-expressing 293 (left) or Karpas (right) cells were either left untreated (lanes 1 and 6) or stimulated with cycloheximide (CHX) (50 μg/ml) (lanes 2 to 5 and 7 to 10), and cell extracts were subjected to Western blotting (WB) with antibodies against Hsp90, BCL-3, and CtBP, as indicated. (Bottom) Quantification of BCL-3 levels under control conditions or upon CtBP depletion in BCL-3-expressing 293 cells (left) or in Karpas cells (right). The signal intensity in unstimulated GFP siRNA cells is set to 100%. (B) The N-terminal PVDLR motif is required for the repressing abilities of BCL-3. HaCat cells were infected either with a control lentivirus (negative control) or with a lentivirus expressing WT BCL-3 or BCL-3 LAV. Western blots with antibodies against BCL-3 and Hsp90, performed on extracts from the corresponding experimental conditions in order to ensure comparable levels of WT and mutated BCL-3 products, are shown at the top. Total RNAs from the resulting cells were subjected to real-time PCR in order to assess the mRNA levels of PLAUR, RAB7L1, STAP2, and AP1S2, all genes repressed by WT BCL-3 in transformed keratinocytes (data not shown). The abundance of transcripts in cells infected with the control lentivirus was set to 1, and their levels in cells infected with the other lentivirus were relative to that after normalization with 18S rRNA. Data from three (PLAUR and RAB7L1), four (AP1S2), or five (STAP2) independent experiments (means ± standard deviations) are shown. (C) Chromatin immunoprecipitation assays with an anti-HA (negative control), anti-BCL-3 (left), or anti-CtBP (right) antibody (Ab) were performed using control, WT BCL-3-expressing, or BCL-3 LAV-expressing HaCat cells. Associated DNA was analyzed by real-time PCR using primers derived from the promoter of the PLAUR gene (data not shown). Data from two independent experiments (means ± standard deviations) are shown.

    Article Snippet: GFP, TBLR1, and CtBP small interfering RNAs (siRNAs) were purchased from Dharmacon (Lafayette, CO), whereas LSD1 siRNAs were from Eurogentec (Liege, Belgium).

    Techniques: Negative Control, Expressing, Western Blot, Infection, Real-time Polymerase Chain Reaction, Transformation Assay, Chromatin Immunoprecipitation, Derivative Assay

    p53-independent stress-induced apoptosis through an ARF/CtBP/Bik pathway in colon cancer cells. ( a ) Apoptosis assay: HCT 116: p53−/− cells were stably infected with control (shCon), shBik1, or shBik2 lentiviruses and transiently transfected

    Journal: Cell death and differentiation

    Article Title: An ARF/CtBP2 complex regulates BH3-only gene expression and p53-independent apoptosis

    doi: 10.1038/cdd.2009.140

    Figure Lengend Snippet: p53-independent stress-induced apoptosis through an ARF/CtBP/Bik pathway in colon cancer cells. ( a ) Apoptosis assay: HCT 116: p53−/− cells were stably infected with control (shCon), shBik1, or shBik2 lentiviruses and transiently transfected

    Article Snippet: With a further understanding of the cellular consequences of ARF/CtBP interaction, there is the distinct possibility of manipulating this pathway either through ARF-mimetics or CtBP inhibitors for therapeutic benefit in the substantial fraction of tumors that lack p53 and/or ARF function.

    Techniques: Apoptosis Assay, Stable Transfection, Infection, Transfection

    Regulation of BH3-only genes by ARF and CtBP. RNA isolated after CtBP2 or control siRNA treatment of HCT116 p53−/− (a) , or U2OS (b) cells was subjected to RQ-PCR using GAPDH, β -actin and Bik, Bim, Bmf, Puma, and Noxa primers. Cell

    Journal: Cell death and differentiation

    Article Title: An ARF/CtBP2 complex regulates BH3-only gene expression and p53-independent apoptosis

    doi: 10.1038/cdd.2009.140

    Figure Lengend Snippet: Regulation of BH3-only genes by ARF and CtBP. RNA isolated after CtBP2 or control siRNA treatment of HCT116 p53−/− (a) , or U2OS (b) cells was subjected to RQ-PCR using GAPDH, β -actin and Bik, Bim, Bmf, Puma, and Noxa primers. Cell

    Article Snippet: With a further understanding of the cellular consequences of ARF/CtBP interaction, there is the distinct possibility of manipulating this pathway either through ARF-mimetics or CtBP inhibitors for therapeutic benefit in the substantial fraction of tumors that lack p53 and/or ARF function.

    Techniques: Isolation, Polymerase Chain Reaction

    Bik is upregulated upon ARF overexpression or CtBP depletion in p53-null human colon cancer cells. ( a ) Total RNA isolated from HCT116 p53−/− cells after either ARF overexpression or CtBP knockdown was subjected to an apoptotic gene array

    Journal: Cell death and differentiation

    Article Title: An ARF/CtBP2 complex regulates BH3-only gene expression and p53-independent apoptosis

    doi: 10.1038/cdd.2009.140

    Figure Lengend Snippet: Bik is upregulated upon ARF overexpression or CtBP depletion in p53-null human colon cancer cells. ( a ) Total RNA isolated from HCT116 p53−/− cells after either ARF overexpression or CtBP knockdown was subjected to an apoptotic gene array

    Article Snippet: With a further understanding of the cellular consequences of ARF/CtBP interaction, there is the distinct possibility of manipulating this pathway either through ARF-mimetics or CtBP inhibitors for therapeutic benefit in the substantial fraction of tumors that lack p53 and/or ARF function.

    Techniques: Over Expression, Isolation

    ARF/CtBP regulates the Bik promoter through BKLF recognition elements. (a) BH3-only genes contain BKLF recognition elements. (Left) Diagram of BKLF recognition elements (BK) in the Bik promoter and (right) alignment and BKLF element localization in the

    Journal: Cell death and differentiation

    Article Title: An ARF/CtBP2 complex regulates BH3-only gene expression and p53-independent apoptosis

    doi: 10.1038/cdd.2009.140

    Figure Lengend Snippet: ARF/CtBP regulates the Bik promoter through BKLF recognition elements. (a) BH3-only genes contain BKLF recognition elements. (Left) Diagram of BKLF recognition elements (BK) in the Bik promoter and (right) alignment and BKLF element localization in the

    Article Snippet: With a further understanding of the cellular consequences of ARF/CtBP interaction, there is the distinct possibility of manipulating this pathway either through ARF-mimetics or CtBP inhibitors for therapeutic benefit in the substantial fraction of tumors that lack p53 and/or ARF function.

    Techniques:

    The MLL(R/MT) and RD1 domains interact with CtBP and HPC2. ( A ) Gal4-CtBP protein expressed in 293T cells was pulled down with equivalent amounts of bacterially expressed GST alone, GST-MLL(R/MT), GST-MLL(RD1), or GST-MLL(RD2). Anti-Gal4 antibody was used to detect bound CtBP. Input (5%) is indicated. ( B ) Anti-FLAG IP. Transfected FLAG-tagged MLL(RD1), MLL(1101–1238), and MLL (1–672) (as a negative control) or FLAG vector were immunoprecipitated from 293T extracts with anti-FLAG beads. Anti-CtBP antibody was used to detect endogenous bound CtBP. ( C ) HPC2 interacts with MLL(R/MT) and MLL(RD1). Bacterially expressed GST-HPC2 was used to pull down FLAG-MLL(RD1) and FLAG-MLL(RD2) expressed by transient transfection in 293T cells and detected with anti-FLAG antibody. FLAG-CtBP and 293T extract were positive and negative controls, respectively. Input proteins (20%) are indicated. ( D ) GST-MLL pull-down assay. IVTT-expressed 35 S-labeled full-length HPC2 (or HDAC1 as a positive control) was incubated with equivalent amounts of bacterially expressed GST alone, GST-MLL(RD1), or GST-MLL (R/MT). Bound proteins were detected by autoradiography. Input (2.5%) is indicated.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: MLL repression domain interacts with histone deacetylases, the polycomb group proteins HPC2 and BMI-1, and the corepressor C-terminal-binding protein

    doi: 10.1073/pnas.1436338100

    Figure Lengend Snippet: The MLL(R/MT) and RD1 domains interact with CtBP and HPC2. ( A ) Gal4-CtBP protein expressed in 293T cells was pulled down with equivalent amounts of bacterially expressed GST alone, GST-MLL(R/MT), GST-MLL(RD1), or GST-MLL(RD2). Anti-Gal4 antibody was used to detect bound CtBP. Input (5%) is indicated. ( B ) Anti-FLAG IP. Transfected FLAG-tagged MLL(RD1), MLL(1101–1238), and MLL (1–672) (as a negative control) or FLAG vector were immunoprecipitated from 293T extracts with anti-FLAG beads. Anti-CtBP antibody was used to detect endogenous bound CtBP. ( C ) HPC2 interacts with MLL(R/MT) and MLL(RD1). Bacterially expressed GST-HPC2 was used to pull down FLAG-MLL(RD1) and FLAG-MLL(RD2) expressed by transient transfection in 293T cells and detected with anti-FLAG antibody. FLAG-CtBP and 293T extract were positive and negative controls, respectively. Input proteins (20%) are indicated. ( D ) GST-MLL pull-down assay. IVTT-expressed 35 S-labeled full-length HPC2 (or HDAC1 as a positive control) was incubated with equivalent amounts of bacterially expressed GST alone, GST-MLL(RD1), or GST-MLL (R/MT). Bound proteins were detected by autoradiography. Input (2.5%) is indicated.

    Article Snippet: Antibodies used were: anti-GAL4 (Santa Cruz Biotechnology), anti-FLAG-M2 (Sigma), anti-T7 monoclonal (Novagen), anti-HDAC1 and -CtBP (Upstate Biotechnology), anti-HA (Sigma), anti-HDAC3 (P. Marks and R. Rifkind, Memorial Sloan–Kettering Cancer Center, New York), and anti-BMI-1 (Santa Cruz Biotechnology).

    Techniques: Transfection, Negative Control, Plasmid Preparation, Immunoprecipitation, Pull Down Assay, Labeling, Positive Control, Incubation, Autoradiography

    Model of repressor complexes associated with wild-type MLL vs. with an MLL fusion protein. The corepressor protein CtBP, the PcG proteins HPC2 and BMI-1, and HDAC1 (or HDAC2) bind to the MLL repression domain. Binding of HDAC1 is increased in the presence of the cyclophilin Cyp33. The coactivator CBP, which has acetyltransferase activity, can bind to the MLL activation domain. The MLL-SET domain has intrinsic histone H3, lysine 4 methyltransferase activity (HMTase H3K4). Corepressors and coactivators may both bind to wild-type MLL; the equilibrium of binding may be influenced by other factors that ultimately determine the function of MLL at a particular target gene locus. For leukemogenic MLL fusion proteins, the equilibrium of binding may be altered, resulting in the aberrant regulation of MLL target genes. Breakpoint cluster region (BCR) and MLL proteolytic cleavage site (arrow) are indicated. Numbering refers to MLL amino acids. The figure is not drawn to scale.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: MLL repression domain interacts with histone deacetylases, the polycomb group proteins HPC2 and BMI-1, and the corepressor C-terminal-binding protein

    doi: 10.1073/pnas.1436338100

    Figure Lengend Snippet: Model of repressor complexes associated with wild-type MLL vs. with an MLL fusion protein. The corepressor protein CtBP, the PcG proteins HPC2 and BMI-1, and HDAC1 (or HDAC2) bind to the MLL repression domain. Binding of HDAC1 is increased in the presence of the cyclophilin Cyp33. The coactivator CBP, which has acetyltransferase activity, can bind to the MLL activation domain. The MLL-SET domain has intrinsic histone H3, lysine 4 methyltransferase activity (HMTase H3K4). Corepressors and coactivators may both bind to wild-type MLL; the equilibrium of binding may be influenced by other factors that ultimately determine the function of MLL at a particular target gene locus. For leukemogenic MLL fusion proteins, the equilibrium of binding may be altered, resulting in the aberrant regulation of MLL target genes. Breakpoint cluster region (BCR) and MLL proteolytic cleavage site (arrow) are indicated. Numbering refers to MLL amino acids. The figure is not drawn to scale.

    Article Snippet: Antibodies used were: anti-GAL4 (Santa Cruz Biotechnology), anti-FLAG-M2 (Sigma), anti-T7 monoclonal (Novagen), anti-HDAC1 and -CtBP (Upstate Biotechnology), anti-HA (Sigma), anti-HDAC3 (P. Marks and R. Rifkind, Memorial Sloan–Kettering Cancer Center, New York), and anti-BMI-1 (Santa Cruz Biotechnology).

    Techniques: Binding Assay, Activity Assay, Activation Assay

    Treatment with the ZEB1–CtBP inhibitor NSC95397 causes translocation and reduction of Zeb1, proliferation, migration, and tube formation of mRMVECs. Compared to PBS control, ( a – b ) one-day 10 µM NSC95397 treatment translocated Zeb1 from the nucleus to the cytosol in mRMVECs while 10 mM MTOB had no such an effect. c This Zeb1 translocation was validated by WB on nuclear and cytosolic fractions of total protein samples isolated from the PBS control, NSC95397- or MTOB-treated mRMVECs using Ctbp and Actb antibodies as relevant nuclear and cytosolic controls though Actb also showed high expression in the nucleus as reported 43 . “C” for cytosolic fraction while “N” for nuclear fraction. d Both 10 mM MTOB and 10 µM NSC95397 significantly reduced Zeb1 mRNA in mRMVECs and e cell proliferation rates, but only 10 µM NSC95397 significantly reduced ( f ) cell migration, and g cell tube formation. * p ≤ 0.05; ** p ≤ 0.01. Scale bars represent 100 µm.

    Journal: Communications Biology

    Article Title: Zeb1 promotes corneal neovascularization by regulation of vascular endothelial cell proliferation

    doi: 10.1038/s42003-020-1069-z

    Figure Lengend Snippet: Treatment with the ZEB1–CtBP inhibitor NSC95397 causes translocation and reduction of Zeb1, proliferation, migration, and tube formation of mRMVECs. Compared to PBS control, ( a – b ) one-day 10 µM NSC95397 treatment translocated Zeb1 from the nucleus to the cytosol in mRMVECs while 10 mM MTOB had no such an effect. c This Zeb1 translocation was validated by WB on nuclear and cytosolic fractions of total protein samples isolated from the PBS control, NSC95397- or MTOB-treated mRMVECs using Ctbp and Actb antibodies as relevant nuclear and cytosolic controls though Actb also showed high expression in the nucleus as reported 43 . “C” for cytosolic fraction while “N” for nuclear fraction. d Both 10 mM MTOB and 10 µM NSC95397 significantly reduced Zeb1 mRNA in mRMVECs and e cell proliferation rates, but only 10 µM NSC95397 significantly reduced ( f ) cell migration, and g cell tube formation. * p ≤ 0.05; ** p ≤ 0.01. Scale bars represent 100 µm.

    Article Snippet: Rabbit polyclonal Zeb1 antiserum (1:500, a gift from Dr. Douglas Darling) and mouse monoclonal CtBP antibody (1:200, Santa Cruz cat. #: sc-17759) were used as primary antibodies together with the secondary antibody Alexa Fluor 488 goat anti-mouse-IgG (1:500, ThermoFisher cat. #: A32723) or Alexa Fluor 594 goat anti-rabbit-IgG (1:500, ThermoFisher cat. # A32740).

    Techniques: Translocation Assay, Migration, Western Blot, Isolation, Expressing

    The ZEB1–CtBP inhibitor NSC95397 evicts Ctbp from Zeb1 complex and thereby upregulates the miR-200 family to downregulate Zeb1 expression in mRMEVCs. Downregulation of Ctbp by lentiviral shRNA in mRMEVCs did not affect a expression and ( b – c ) relocation of Zeb1, and thereby ( d ) cell proliferation. e Co-immunoprecipitation of Zeb1 using a CtBP antibody against both CtBP1 and 2 (CtBP-IP) from total protein (Input) isolated from mRMVECs treated with either 10 µM NSC95397 or 10 mM MTOB and WB for Zeb1 and Ctbp. f Expression of the miR-200 family genes detected by qPCR in mRMVECs treated with 10 mM MTOB or 10 µM NSC95397. It appears that only 10 µM NSC95397 significantly reduced the alkali-induced corneal NV evaluated by criteria of ( g ) opacity, ( h ) NV score, and i vessel size. * p ≤ 0.05; ** p ≤ 0.01. Scale bars represent 100 µm.

    Journal: Communications Biology

    Article Title: Zeb1 promotes corneal neovascularization by regulation of vascular endothelial cell proliferation

    doi: 10.1038/s42003-020-1069-z

    Figure Lengend Snippet: The ZEB1–CtBP inhibitor NSC95397 evicts Ctbp from Zeb1 complex and thereby upregulates the miR-200 family to downregulate Zeb1 expression in mRMEVCs. Downregulation of Ctbp by lentiviral shRNA in mRMEVCs did not affect a expression and ( b – c ) relocation of Zeb1, and thereby ( d ) cell proliferation. e Co-immunoprecipitation of Zeb1 using a CtBP antibody against both CtBP1 and 2 (CtBP-IP) from total protein (Input) isolated from mRMVECs treated with either 10 µM NSC95397 or 10 mM MTOB and WB for Zeb1 and Ctbp. f Expression of the miR-200 family genes detected by qPCR in mRMVECs treated with 10 mM MTOB or 10 µM NSC95397. It appears that only 10 µM NSC95397 significantly reduced the alkali-induced corneal NV evaluated by criteria of ( g ) opacity, ( h ) NV score, and i vessel size. * p ≤ 0.05; ** p ≤ 0.01. Scale bars represent 100 µm.

    Article Snippet: Rabbit polyclonal Zeb1 antiserum (1:500, a gift from Dr. Douglas Darling) and mouse monoclonal CtBP antibody (1:200, Santa Cruz cat. #: sc-17759) were used as primary antibodies together with the secondary antibody Alexa Fluor 488 goat anti-mouse-IgG (1:500, ThermoFisher cat. #: A32723) or Alexa Fluor 594 goat anti-rabbit-IgG (1:500, ThermoFisher cat. # A32740).

    Techniques: Expressing, shRNA, Immunoprecipitation, Isolation, Western Blot, Real-time Polymerase Chain Reaction

    Schematic diagram of Zeb1-regulation of corneal neovascularization (NV). The repressive complex of Zeb1–Ctbp sits on the promoters of target genes, including the miR-200 family and cyclin-dependent kinase inhibitors ( Cdki ) and represses their expression. The ZEB1–CtBP inhibitors such as NSC95397 evict Ctbp from the complex and let new interacting partners like P300 fit in to form a promotive complex to induce expression of both the miR-200 family and Cdki . The miR-200 family in turn repress Zeb1 expression while Cdki block vascular EC proliferation and thereby angiogenesis, leading to reduction of the alkali-induced corneal NV.

    Journal: Communications Biology

    Article Title: Zeb1 promotes corneal neovascularization by regulation of vascular endothelial cell proliferation

    doi: 10.1038/s42003-020-1069-z

    Figure Lengend Snippet: Schematic diagram of Zeb1-regulation of corneal neovascularization (NV). The repressive complex of Zeb1–Ctbp sits on the promoters of target genes, including the miR-200 family and cyclin-dependent kinase inhibitors ( Cdki ) and represses their expression. The ZEB1–CtBP inhibitors such as NSC95397 evict Ctbp from the complex and let new interacting partners like P300 fit in to form a promotive complex to induce expression of both the miR-200 family and Cdki . The miR-200 family in turn repress Zeb1 expression while Cdki block vascular EC proliferation and thereby angiogenesis, leading to reduction of the alkali-induced corneal NV.

    Article Snippet: Rabbit polyclonal Zeb1 antiserum (1:500, a gift from Dr. Douglas Darling) and mouse monoclonal CtBP antibody (1:200, Santa Cruz cat. #: sc-17759) were used as primary antibodies together with the secondary antibody Alexa Fluor 488 goat anti-mouse-IgG (1:500, ThermoFisher cat. #: A32723) or Alexa Fluor 594 goat anti-rabbit-IgG (1:500, ThermoFisher cat. # A32740).

    Techniques: Expressing, Blocking Assay

    Differential binding and accumulation of proteins associated with the β-catenin/TCF-4 transcriptional complex (A-B) Interaction of the associated proteins such as β-catenin, CBP, TLE and CtBP with the complex in HAK-1A (A) and Huh7 (B) cells. The β-catenin/TCF-4 transcriptional complex was prepared from nuclear extracts (Nuc) immunoprecipitated (IP) with anti-c-Myc antibody after transfection of empty vector (EV), TCF-4J, and TCF-4K with a β-catenin expression construct. The co-factor proteins in the complex was detected by Western blot analysis using antibodies against Myc-tag (arrow), TCF-4 (arrow), β-catenin, CBP, TLE and CtBP, and quantified after normalization to Myc-tag detection level. The bar charts show the ratio of the quantified amount of each co-factor protein in the complex to that found in TCF-4J expressing cells. The dotted line represents the level of each protein observed in TCF-4J expressing cells. The results are shown as the mean ± SD. *, p

    Journal: Cancer letters

    Article Title: The SxxSS motif of T-cell factor-4 isoforms modulates Wnt/β-catenin signal activation in hepatocellular carcinoma cells

    doi: 10.1016/j.canlet.2013.03.031

    Figure Lengend Snippet: Differential binding and accumulation of proteins associated with the β-catenin/TCF-4 transcriptional complex (A-B) Interaction of the associated proteins such as β-catenin, CBP, TLE and CtBP with the complex in HAK-1A (A) and Huh7 (B) cells. The β-catenin/TCF-4 transcriptional complex was prepared from nuclear extracts (Nuc) immunoprecipitated (IP) with anti-c-Myc antibody after transfection of empty vector (EV), TCF-4J, and TCF-4K with a β-catenin expression construct. The co-factor proteins in the complex was detected by Western blot analysis using antibodies against Myc-tag (arrow), TCF-4 (arrow), β-catenin, CBP, TLE and CtBP, and quantified after normalization to Myc-tag detection level. The bar charts show the ratio of the quantified amount of each co-factor protein in the complex to that found in TCF-4J expressing cells. The dotted line represents the level of each protein observed in TCF-4J expressing cells. The results are shown as the mean ± SD. *, p

    Article Snippet: Western blot analysis was carried out as previously described [ ] using primary antibodies generated against Myc-tag, TCF-4, β-catenin, CREB-binding protein (CBP), transducin-like enhancer of split (TLE), GFP, HIPK2 (Cell Signaling Technology, Beverly, MA), C-terminal-binding protein (CtBP) (Millipore, Bedford, MA), lamin A/C, and actin (Santa Cruz Biotechnology, Inc., Santa Cruz, CA).

    Techniques: Binding Assay, Immunoprecipitation, Transfection, Plasmid Preparation, Expressing, Construct, Western Blot

    The interactions of co-factor proteins and HIPK2 expression in TCF-4K mutant expressing cells (A-B) Interaction of the associated proteins with the transcriptional complex and endogenous HIPK2 expression level in Huh7 cells (A) and their densitometric analyses of the associated proteins (B) . The β-catenin/TCF-4 transcriptional complex was prepared from nuclear extracts (Nuc) immunoprecipitated (IP) with anti-c-Myc antibody after transfection of empty vector (EV), TCF-4J, TCF-4K, and TCF-4K mutants (269A, 272A, and 273A) with β-catenin. The co-factor proteins in the complex was detected by Western blot analysis using antibodies against Myc-tag (arrow), TCF-4 (arrow), β-catenin, CBP, TLE and CtBP, and quantified after normalization by Myc-tag detection level. HIPK2 was detected by Western blot analysis using anti-HIPK2 antibody. The bar charts show ratio of the quantified amount of each co-factor protein in the complex to that in TCF-4J expressing cells. The dotted line represents the level of each protein in TCF-4J. The results are expressed as the mean ± SD. *, p

    Journal: Cancer letters

    Article Title: The SxxSS motif of T-cell factor-4 isoforms modulates Wnt/β-catenin signal activation in hepatocellular carcinoma cells

    doi: 10.1016/j.canlet.2013.03.031

    Figure Lengend Snippet: The interactions of co-factor proteins and HIPK2 expression in TCF-4K mutant expressing cells (A-B) Interaction of the associated proteins with the transcriptional complex and endogenous HIPK2 expression level in Huh7 cells (A) and their densitometric analyses of the associated proteins (B) . The β-catenin/TCF-4 transcriptional complex was prepared from nuclear extracts (Nuc) immunoprecipitated (IP) with anti-c-Myc antibody after transfection of empty vector (EV), TCF-4J, TCF-4K, and TCF-4K mutants (269A, 272A, and 273A) with β-catenin. The co-factor proteins in the complex was detected by Western blot analysis using antibodies against Myc-tag (arrow), TCF-4 (arrow), β-catenin, CBP, TLE and CtBP, and quantified after normalization by Myc-tag detection level. HIPK2 was detected by Western blot analysis using anti-HIPK2 antibody. The bar charts show ratio of the quantified amount of each co-factor protein in the complex to that in TCF-4J expressing cells. The dotted line represents the level of each protein in TCF-4J. The results are expressed as the mean ± SD. *, p

    Article Snippet: Western blot analysis was carried out as previously described [ ] using primary antibodies generated against Myc-tag, TCF-4, β-catenin, CREB-binding protein (CBP), transducin-like enhancer of split (TLE), GFP, HIPK2 (Cell Signaling Technology, Beverly, MA), C-terminal-binding protein (CtBP) (Millipore, Bedford, MA), lamin A/C, and actin (Santa Cruz Biotechnology, Inc., Santa Cruz, CA).

    Techniques: Expressing, Mutagenesis, Immunoprecipitation, Transfection, Plasmid Preparation, Western Blot

    Knockdown of CtBP eliminates the effects of 2DG and glucose-free medium. a Representative western blot showing reduced expression of CtBP1/2 protein in RAW264.7 cells transfected with shRNA targeting CtBP1 and CtBP2 (CtBP KD). Full length immunoblots are shown in Supplementary Fig. 3 . b , c shRNA knockdown of CtBP1/2 negates the effect of both 2DG and glucose-free medium on LPS-induced iNOS expression and nitric oxide production. Results for wild-type (WT) cells were normalized to control (no LPS) WT cells, and results for CtBP knockdown cells (CtBP KD) were normalized to control CtBP KD cells. n = 4; * p

    Journal: Nature Communications

    Article Title: Bioenergetic state regulates innate inflammatory responses through the transcriptional co-repressor CtBP

    doi: 10.1038/s41467-017-00707-0

    Figure Lengend Snippet: Knockdown of CtBP eliminates the effects of 2DG and glucose-free medium. a Representative western blot showing reduced expression of CtBP1/2 protein in RAW264.7 cells transfected with shRNA targeting CtBP1 and CtBP2 (CtBP KD). Full length immunoblots are shown in Supplementary Fig. 3 . b , c shRNA knockdown of CtBP1/2 negates the effect of both 2DG and glucose-free medium on LPS-induced iNOS expression and nitric oxide production. Results for wild-type (WT) cells were normalized to control (no LPS) WT cells, and results for CtBP knockdown cells (CtBP KD) were normalized to control CtBP KD cells. n = 4; * p

    Article Snippet: The blots were probed with mouse polyclonal anti iNOS (Upstate, #06-573; 1:1000), rabbit polyclonal anti ß-actin (Sigma-Aldrich, #A2066; 1:1000), and mouse monoclonal anti-CtBP (AbNova, # H1487-MO1, 1:1000).

    Techniques: Western Blot, Expressing, Transfection, shRNA

    The NAD(H) binding site on CtBP is required for its effect on inflammatory responses. a Transfection with CtBP1, CtBP2, and G1892 CtBP2 produced comparable expression levels in CtBP1 −/− /CtBP2 −/− MEF cells. Full length immunoblots are shown in Supplementary Fig. 3 . b − d MEF cells were transfected with WT CtBP1, CtBP2 and G189A CtBP2, and additionally transfected with p65 to induce NF-κB activation. All 3 CtBP constructs suppress iNOS and NF-κB reporter gene transcriptional activity, and have no effect on a scrambled-sequence driven luciferase reporter gene. n = 3; * p

    Journal: Nature Communications

    Article Title: Bioenergetic state regulates innate inflammatory responses through the transcriptional co-repressor CtBP

    doi: 10.1038/s41467-017-00707-0

    Figure Lengend Snippet: The NAD(H) binding site on CtBP is required for its effect on inflammatory responses. a Transfection with CtBP1, CtBP2, and G1892 CtBP2 produced comparable expression levels in CtBP1 −/− /CtBP2 −/− MEF cells. Full length immunoblots are shown in Supplementary Fig. 3 . b − d MEF cells were transfected with WT CtBP1, CtBP2 and G189A CtBP2, and additionally transfected with p65 to induce NF-κB activation. All 3 CtBP constructs suppress iNOS and NF-κB reporter gene transcriptional activity, and have no effect on a scrambled-sequence driven luciferase reporter gene. n = 3; * p

    Article Snippet: The blots were probed with mouse polyclonal anti iNOS (Upstate, #06-573; 1:1000), rabbit polyclonal anti ß-actin (Sigma-Aldrich, #A2066; 1:1000), and mouse monoclonal anti-CtBP (AbNova, # H1487-MO1, 1:1000).

    Techniques: Binding Assay, Transfection, Produced, Expressing, Western Blot, Activation Assay, Construct, Activity Assay, Sequencing, Luciferase