col7a1 exon 65 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Thermo Fisher gene exp col7a1 hs00164310 m1
    <t>COL7A1</t> Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. GAPDH expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.
    Gene Exp Col7a1 Hs00164310 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp col7a1 hs00164310 m1/product/Thermo Fisher
    Average 95 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    gene exp col7a1 hs00164310 m1 - by Bioz Stars, 2020-08
    95/100 stars
      Buy from Supplier

    85
    Roche long range dntpack
    <t>COL7A1</t> Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. GAPDH expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.
    Long Range Dntpack, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range dntpack/product/Roche
    Average 85 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    long range dntpack - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    99
    Promega gotaq qpcr master mix
    <t>COL7A1</t> Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. GAPDH expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.
    Gotaq Qpcr Master Mix, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 11162 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gotaq qpcr master mix/product/Promega
    Average 99 stars, based on 11162 article reviews
    Price from $9.99 to $1999.99
    gotaq qpcr master mix - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    86
    Thermo Fisher gene exp col7a1 hs01574801 g1
    <t>COL7A1</t> Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. GAPDH expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.
    Gene Exp Col7a1 Hs01574801 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp col7a1 hs01574801 g1/product/Thermo Fisher
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    gene exp col7a1 hs01574801 g1 - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    94
    Roche primer
    <t>COL7A1</t> Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. GAPDH expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.
    Primer, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 3682 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer/product/Roche
    Average 94 stars, based on 3682 article reviews
    Price from $9.99 to $1999.99
    primer - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    92
    Roche reverse primer
    <t>COL7A1</t> Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. GAPDH expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.
    Reverse Primer, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 746 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse primer/product/Roche
    Average 92 stars, based on 746 article reviews
    Price from $9.99 to $1999.99
    reverse primer - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    93
    Roche pcr analysis
    <t>LV-RTM-S6m</t> transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) <t>PCR</t> analysis on genomic DNA of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.
    Pcr Analysis, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 1200 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr analysis/product/Roche
    Average 93 stars, based on 1200 article reviews
    Price from $9.99 to $1999.99
    pcr analysis - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher gene exp gapdh hs02758991 g1
    COL7A1 Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. <t>GAPDH</t> expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.
    Gene Exp Gapdh Hs02758991 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 4697 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp gapdh hs02758991 g1/product/Thermo Fisher
    Average 99 stars, based on 4697 article reviews
    Price from $9.99 to $1999.99
    gene exp gapdh hs02758991 g1 - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher t4 dna ligase
    COL7A1 Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. <t>GAPDH</t> expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.
    T4 Dna Ligase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 25057 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/Thermo Fisher
    Average 99 stars, based on 25057 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad bio rad cfx system
    COL7A1 Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. <t>GAPDH</t> expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.
    Bio Rad Cfx System, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 331 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bio rad cfx system/product/Bio-Rad
    Average 99 stars, based on 331 article reviews
    Price from $9.99 to $1999.99
    bio rad cfx system - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Qiagen dna genomic dna
    LV-RTM-S6m transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) <t>PCR</t> analysis on genomic <t>DNA</t> of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.
    Dna Genomic Dna, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 329 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna genomic dna/product/Qiagen
    Average 99 stars, based on 329 article reviews
    Price from $9.99 to $1999.99
    dna genomic dna - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Qiagen dneasy blood and tissue kit
    LV-RTM-S6m transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) <t>PCR</t> analysis on genomic <t>DNA</t> of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.
    Dneasy Blood And Tissue Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 51440 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dneasy blood and tissue kit/product/Qiagen
    Average 99 stars, based on 51440 article reviews
    Price from $9.99 to $1999.99
    dneasy blood and tissue kit - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher quantstudio 6 flex real time pcr system
    LV-RTM-S6m transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) <t>PCR</t> analysis on genomic <t>DNA</t> of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.
    Quantstudio 6 Flex Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 3960 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/quantstudio 6 flex real time pcr system/product/Thermo Fisher
    Average 99 stars, based on 3960 article reviews
    Price from $9.99 to $1999.99
    quantstudio 6 flex real time pcr system - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    COL7A1 Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. GAPDH expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells

    doi: 10.1016/j.omtn.2018.01.009

    Figure Lengend Snippet: COL7A1 Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. GAPDH expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.

    Article Snippet: For the real-time qPCR analysis, 1:20 dilutions of each cDNA synthesis reaction were analyzed in triplicate using Taqman gene-expression assays Hs00164310_m1 (COL7A1 exon64 probe), Hs01574801_g1 (COL7A1 exon80 probe), and Hs02758991_g1 (GAPDH probe, control).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification, Clone Assay, Molecular Weight, Marker, Negative Control, Sequencing, Real-time Polymerase Chain Reaction, Western Blot

    In Vivo Skin Regeneration from Frame-Restored Patient Keratinocyte Clones 11 and 40 Expressing a C7 Variant with a Four-Amino-Acid Substitution (A) COL7A1 cDNA and C7 amino acid sequences for WT, c.6527insC (cytosine insertion underlined in red), and ΔG (1-bp deletion, red arrowhead) alleles. Amino acid substitutions in c.6527insC and ΔG variants are shown in red. (B and C) Macroscopic appearance of human skin (delineated by dotted line) regenerated from clones 11 (B) and 40 (C). (D and E) Dermal-epidermal adhesion test. Detachment of epidermis (blue arrows) occurred after pulling from the edge of an incision on human skin grafts generated from clones 11 (D) and 40 (E). (F, G, H, and I) Immunofluorescence staining for the detection of human C7 (green) in grafts sections. In grafts from clones 11 (F) and 40 (G), C7 was retained within the cytoplasm of keratinocytes in the basal layer of epidermis. In contrast, grafts from normal human keratinocytes display C7 deposition in the BMZ (H). Grafts from unedited patient 2 keratinocytes were used as a negative control for staining (I). Cell nuclei were stained with DAPI (blue). Asterisks denote blisters formed between dermis and epidermis (F, G, and I). Scale bar, 50 μm.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells

    doi: 10.1016/j.omtn.2018.01.009

    Figure Lengend Snippet: In Vivo Skin Regeneration from Frame-Restored Patient Keratinocyte Clones 11 and 40 Expressing a C7 Variant with a Four-Amino-Acid Substitution (A) COL7A1 cDNA and C7 amino acid sequences for WT, c.6527insC (cytosine insertion underlined in red), and ΔG (1-bp deletion, red arrowhead) alleles. Amino acid substitutions in c.6527insC and ΔG variants are shown in red. (B and C) Macroscopic appearance of human skin (delineated by dotted line) regenerated from clones 11 (B) and 40 (C). (D and E) Dermal-epidermal adhesion test. Detachment of epidermis (blue arrows) occurred after pulling from the edge of an incision on human skin grafts generated from clones 11 (D) and 40 (E). (F, G, H, and I) Immunofluorescence staining for the detection of human C7 (green) in grafts sections. In grafts from clones 11 (F) and 40 (G), C7 was retained within the cytoplasm of keratinocytes in the basal layer of epidermis. In contrast, grafts from normal human keratinocytes display C7 deposition in the BMZ (H). Grafts from unedited patient 2 keratinocytes were used as a negative control for staining (I). Cell nuclei were stained with DAPI (blue). Asterisks denote blisters formed between dermis and epidermis (F, G, and I). Scale bar, 50 μm.

    Article Snippet: For the real-time qPCR analysis, 1:20 dilutions of each cDNA synthesis reaction were analyzed in triplicate using Taqman gene-expression assays Hs00164310_m1 (COL7A1 exon64 probe), Hs01574801_g1 (COL7A1 exon80 probe), and Hs02758991_g1 (GAPDH probe, control).

    Techniques: In Vivo, Clone Assay, Expressing, Variant Assay, Generated, Immunofluorescence, Staining, Negative Control

    Genotypes of RDEB Patient Keratinocyte Clones Carrying Different Frame-Restoring Indels and Collagen VII Expression Analysis (A) Sanger sequencing chromatograms of PCR products spanning the TALEN target site show the 1-bp ΔG deletion in one COL7A1 allele (clone 11, upper chromatogram) or in both (clone 40, lower chromatogram). The exon 80 sequence is shown in the red box. (B) Chromatograms corresponding to individual colonies of the TA-cloned PCR product for clone 19 showed three different alleles: unedited (upper), 9-bp deletion (Δ9, middle), and 114-bp deletion (Δ114, lower). (C) Immunofluorescence staining with anti-C7 antibody showed C7 expression in approximately half of the cells in clone 19 and in all cells from clones 11 and 40.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells

    doi: 10.1016/j.omtn.2018.01.009

    Figure Lengend Snippet: Genotypes of RDEB Patient Keratinocyte Clones Carrying Different Frame-Restoring Indels and Collagen VII Expression Analysis (A) Sanger sequencing chromatograms of PCR products spanning the TALEN target site show the 1-bp ΔG deletion in one COL7A1 allele (clone 11, upper chromatogram) or in both (clone 40, lower chromatogram). The exon 80 sequence is shown in the red box. (B) Chromatograms corresponding to individual colonies of the TA-cloned PCR product for clone 19 showed three different alleles: unedited (upper), 9-bp deletion (Δ9, middle), and 114-bp deletion (Δ114, lower). (C) Immunofluorescence staining with anti-C7 antibody showed C7 expression in approximately half of the cells in clone 19 and in all cells from clones 11 and 40.

    Article Snippet: For the real-time qPCR analysis, 1:20 dilutions of each cDNA synthesis reaction were analyzed in triplicate using Taqman gene-expression assays Hs00164310_m1 (COL7A1 exon64 probe), Hs01574801_g1 (COL7A1 exon80 probe), and Hs02758991_g1 (GAPDH probe, control).

    Techniques: Clone Assay, Expressing, Sequencing, Polymerase Chain Reaction, Immunofluorescence, Staining

    Indel Generation with TALEN Nucleases in Primary RDEB Patient Keratinocytes (A) TALEN pair T6/T7 targets the 5′ region of the COL7A1 exon 80 sequence (upper case) in the vicinity of the c.6527insC mutation (red arrowhead). TALEN spacer sequence is shaded. Intron sequences are in blue lower case. (B) The PCR product comprising the T6/T7 target site was analyzed with Surveyor (Cel I) mutation detection assay to establish optimal MOI in patient keratinocytes infected with adenoviral vectors for T6/T7 TALEN expression. Solid arrowhead indicates uncleaved DNA; arrowheads indicate cleavage fragments. Percentage of cleavage for each PCR product is shown at the bottom. M is IX molecular weight marker. (C) Indel spectrum in keratinocytes from RDEB patients 1 (experiment 1) and 2 (experiment 2) transduced with Ad-T6/T7 vectors. Two out 22 clones in experiment 1 and 14 out of 125 clones in experiment 2 carried indel alleles at the TALEN target site. The number of clones containing each indel is shown on the right. Intron sequences are in blue lowercase letters. Double slash marks represent DNA sequences that are not shown.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells

    doi: 10.1016/j.omtn.2018.01.009

    Figure Lengend Snippet: Indel Generation with TALEN Nucleases in Primary RDEB Patient Keratinocytes (A) TALEN pair T6/T7 targets the 5′ region of the COL7A1 exon 80 sequence (upper case) in the vicinity of the c.6527insC mutation (red arrowhead). TALEN spacer sequence is shaded. Intron sequences are in blue lower case. (B) The PCR product comprising the T6/T7 target site was analyzed with Surveyor (Cel I) mutation detection assay to establish optimal MOI in patient keratinocytes infected with adenoviral vectors for T6/T7 TALEN expression. Solid arrowhead indicates uncleaved DNA; arrowheads indicate cleavage fragments. Percentage of cleavage for each PCR product is shown at the bottom. M is IX molecular weight marker. (C) Indel spectrum in keratinocytes from RDEB patients 1 (experiment 1) and 2 (experiment 2) transduced with Ad-T6/T7 vectors. Two out 22 clones in experiment 1 and 14 out of 125 clones in experiment 2 carried indel alleles at the TALEN target site. The number of clones containing each indel is shown on the right. Intron sequences are in blue lowercase letters. Double slash marks represent DNA sequences that are not shown.

    Article Snippet: For the real-time qPCR analysis, 1:20 dilutions of each cDNA synthesis reaction were analyzed in triplicate using Taqman gene-expression assays Hs00164310_m1 (COL7A1 exon64 probe), Hs01574801_g1 (COL7A1 exon80 probe), and Hs02758991_g1 (GAPDH probe, control).

    Techniques: Sequencing, Mutagenesis, Polymerase Chain Reaction, Detection Assay, Infection, Expressing, Molecular Weight, Marker, Transduction, Clone Assay

    In Vivo Skin Regeneration from Frame-Restored Patient Keratinocyte Clone 19.C Expressing a C7 Variant Lacking the Exon 80-Encoded Sequence (A) COL7A1 cDNA and C7 amino acid sequences for WT, c.6527insC, and ΔE80 (114-bp deletion) alleles. Amino acid substitutions in c.6527insC are shown in red. (B) Macroscopic appearance of a representative human skin (delineated by dotted line) regenerated from clone 19.C. (C) Demonstration of dermal-epidermal adhesion in patient skin regenerated from clone 19.C. Firm pulling from the edge of an incision did not cause dermal-epidermal detachment. (D) H E staining of regenerated patient skin showing epidermal-dermal adhesion and normal epidermal architecture. Scale bar, 100 μm. (E) Immunohistochemical staining using an antibody specific for human involucrin to show normal human epidermal differentiation of the gene-corrected patient skin graft at the mouse (Mo)-human(Hu) skin boundary. Scale bar, 100μm. (F, G, and H) Immunofluorescence staining using an antibody specific for human C7 (red). Normal C7 deposition was found along the BMZ of a gene-corrected patient skin graft regenerated from clone 19.C keratinocytes (F) and in normal human keratinocyte positive control graft (G). No C7 staining was found in sections of a negative control graft regenerated from unedited patient 2 keratinocytes (H). Cell nuclei were stained with DAPI (blue). Asterisks denote blistering between dermis and epidermis. Scale bar, 50 μm. (I) Electron microscopy analysis showed the presence of mature anchoring fibrils (arrowheads) at the dermal-epidermal junction of gene-corrected patient skin regenerated from clone 19.C keratinocytes. Scale bar, 200 nm.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells

    doi: 10.1016/j.omtn.2018.01.009

    Figure Lengend Snippet: In Vivo Skin Regeneration from Frame-Restored Patient Keratinocyte Clone 19.C Expressing a C7 Variant Lacking the Exon 80-Encoded Sequence (A) COL7A1 cDNA and C7 amino acid sequences for WT, c.6527insC, and ΔE80 (114-bp deletion) alleles. Amino acid substitutions in c.6527insC are shown in red. (B) Macroscopic appearance of a representative human skin (delineated by dotted line) regenerated from clone 19.C. (C) Demonstration of dermal-epidermal adhesion in patient skin regenerated from clone 19.C. Firm pulling from the edge of an incision did not cause dermal-epidermal detachment. (D) H E staining of regenerated patient skin showing epidermal-dermal adhesion and normal epidermal architecture. Scale bar, 100 μm. (E) Immunohistochemical staining using an antibody specific for human involucrin to show normal human epidermal differentiation of the gene-corrected patient skin graft at the mouse (Mo)-human(Hu) skin boundary. Scale bar, 100μm. (F, G, and H) Immunofluorescence staining using an antibody specific for human C7 (red). Normal C7 deposition was found along the BMZ of a gene-corrected patient skin graft regenerated from clone 19.C keratinocytes (F) and in normal human keratinocyte positive control graft (G). No C7 staining was found in sections of a negative control graft regenerated from unedited patient 2 keratinocytes (H). Cell nuclei were stained with DAPI (blue). Asterisks denote blistering between dermis and epidermis. Scale bar, 50 μm. (I) Electron microscopy analysis showed the presence of mature anchoring fibrils (arrowheads) at the dermal-epidermal junction of gene-corrected patient skin regenerated from clone 19.C keratinocytes. Scale bar, 200 nm.

    Article Snippet: For the real-time qPCR analysis, 1:20 dilutions of each cDNA synthesis reaction were analyzed in triplicate using Taqman gene-expression assays Hs00164310_m1 (COL7A1 exon64 probe), Hs01574801_g1 (COL7A1 exon80 probe), and Hs02758991_g1 (GAPDH probe, control).

    Techniques: In Vivo, Expressing, Variant Assay, Sequencing, Staining, Immunohistochemistry, Immunofluorescence, Positive Control, Negative Control, Electron Microscopy

    COL7A1 Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. GAPDH expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells

    doi: 10.1016/j.omtn.2018.01.009

    Figure Lengend Snippet: COL7A1 Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. GAPDH expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.

    Article Snippet: For the real-time qPCR analysis, 1:20 dilutions of each cDNA synthesis reaction were analyzed in triplicate using Taqman gene-expression assays Hs00164310_m1 ( COL7A1 exon64 probe), Hs01574801_g1 ( COL7A1 exon80 probe), and Hs02758991_g1 (GAPDH probe, control).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification, Clone Assay, Molecular Weight, Marker, Negative Control, Sequencing, Real-time Polymerase Chain Reaction, Western Blot

    In Vivo Skin Regeneration from Frame-Restored Patient Keratinocyte Clones 11 and 40 Expressing a C7 Variant with a Four-Amino-Acid Substitution (A) COL7A1 cDNA and C7 amino acid sequences for WT, c.6527insC (cytosine insertion underlined in red), and ΔG (1-bp deletion, red arrowhead) alleles. Amino acid substitutions in c.6527insC and ΔG variants are shown in red. (B and C) Macroscopic appearance of human skin (delineated by dotted line) regenerated from clones 11 (B) and 40 (C). (D and E) Dermal-epidermal adhesion test. Detachment of epidermis (blue arrows) occurred after pulling from the edge of an incision on human skin grafts generated from clones 11 (D) and 40 (E). (F, G, H, and I) Immunofluorescence staining for the detection of human C7 (green) in grafts sections. In grafts from clones 11 (F) and 40 (G), C7 was retained within the cytoplasm of keratinocytes in the basal layer of epidermis. In contrast, grafts from normal human keratinocytes display C7 deposition in the BMZ (H). Grafts from unedited patient 2 keratinocytes were used as a negative control for staining (I). Cell nuclei were stained with DAPI (blue). Asterisks denote blisters formed between dermis and epidermis (F, G, and I). Scale bar, 50 μm.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells

    doi: 10.1016/j.omtn.2018.01.009

    Figure Lengend Snippet: In Vivo Skin Regeneration from Frame-Restored Patient Keratinocyte Clones 11 and 40 Expressing a C7 Variant with a Four-Amino-Acid Substitution (A) COL7A1 cDNA and C7 amino acid sequences for WT, c.6527insC (cytosine insertion underlined in red), and ΔG (1-bp deletion, red arrowhead) alleles. Amino acid substitutions in c.6527insC and ΔG variants are shown in red. (B and C) Macroscopic appearance of human skin (delineated by dotted line) regenerated from clones 11 (B) and 40 (C). (D and E) Dermal-epidermal adhesion test. Detachment of epidermis (blue arrows) occurred after pulling from the edge of an incision on human skin grafts generated from clones 11 (D) and 40 (E). (F, G, H, and I) Immunofluorescence staining for the detection of human C7 (green) in grafts sections. In grafts from clones 11 (F) and 40 (G), C7 was retained within the cytoplasm of keratinocytes in the basal layer of epidermis. In contrast, grafts from normal human keratinocytes display C7 deposition in the BMZ (H). Grafts from unedited patient 2 keratinocytes were used as a negative control for staining (I). Cell nuclei were stained with DAPI (blue). Asterisks denote blisters formed between dermis and epidermis (F, G, and I). Scale bar, 50 μm.

    Article Snippet: For the real-time qPCR analysis, 1:20 dilutions of each cDNA synthesis reaction were analyzed in triplicate using Taqman gene-expression assays Hs00164310_m1 ( COL7A1 exon64 probe), Hs01574801_g1 ( COL7A1 exon80 probe), and Hs02758991_g1 (GAPDH probe, control).

    Techniques: In Vivo, Clone Assay, Expressing, Variant Assay, Generated, Immunofluorescence, Staining, Negative Control

    Genotypes of RDEB Patient Keratinocyte Clones Carrying Different Frame-Restoring Indels and Collagen VII Expression Analysis (A) Sanger sequencing chromatograms of PCR products spanning the TALEN target site show the 1-bp ΔG deletion in one COL7A1 allele (clone 11, upper chromatogram) or in both (clone 40, lower chromatogram). The exon 80 sequence is shown in the red box. (B) Chromatograms corresponding to individual colonies of the TA-cloned PCR product for clone 19 showed three different alleles: unedited (upper), 9-bp deletion (Δ9, middle), and 114-bp deletion (Δ114, lower). (C) Immunofluorescence staining with anti-C7 antibody showed C7 expression in approximately half of the cells in clone 19 and in all cells from clones 11 and 40.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells

    doi: 10.1016/j.omtn.2018.01.009

    Figure Lengend Snippet: Genotypes of RDEB Patient Keratinocyte Clones Carrying Different Frame-Restoring Indels and Collagen VII Expression Analysis (A) Sanger sequencing chromatograms of PCR products spanning the TALEN target site show the 1-bp ΔG deletion in one COL7A1 allele (clone 11, upper chromatogram) or in both (clone 40, lower chromatogram). The exon 80 sequence is shown in the red box. (B) Chromatograms corresponding to individual colonies of the TA-cloned PCR product for clone 19 showed three different alleles: unedited (upper), 9-bp deletion (Δ9, middle), and 114-bp deletion (Δ114, lower). (C) Immunofluorescence staining with anti-C7 antibody showed C7 expression in approximately half of the cells in clone 19 and in all cells from clones 11 and 40.

    Article Snippet: For the real-time qPCR analysis, 1:20 dilutions of each cDNA synthesis reaction were analyzed in triplicate using Taqman gene-expression assays Hs00164310_m1 ( COL7A1 exon64 probe), Hs01574801_g1 ( COL7A1 exon80 probe), and Hs02758991_g1 (GAPDH probe, control).

    Techniques: Clone Assay, Expressing, Sequencing, Polymerase Chain Reaction, Immunofluorescence, Staining

    Indel Generation with TALEN Nucleases in Primary RDEB Patient Keratinocytes (A) TALEN pair T6/T7 targets the 5′ region of the COL7A1 exon 80 sequence (upper case) in the vicinity of the c.6527insC mutation (red arrowhead). TALEN spacer sequence is shaded. Intron sequences are in blue lower case. (B) The PCR product comprising the T6/T7 target site was analyzed with Surveyor (Cel I) mutation detection assay to establish optimal MOI in patient keratinocytes infected with adenoviral vectors for T6/T7 TALEN expression. Solid arrowhead indicates uncleaved DNA; arrowheads indicate cleavage fragments. Percentage of cleavage for each PCR product is shown at the bottom. M is IX molecular weight marker. (C) Indel spectrum in keratinocytes from RDEB patients 1 (experiment 1) and 2 (experiment 2) transduced with Ad-T6/T7 vectors. Two out 22 clones in experiment 1 and 14 out of 125 clones in experiment 2 carried indel alleles at the TALEN target site. The number of clones containing each indel is shown on the right. Intron sequences are in blue lowercase letters. Double slash marks represent DNA sequences that are not shown.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells

    doi: 10.1016/j.omtn.2018.01.009

    Figure Lengend Snippet: Indel Generation with TALEN Nucleases in Primary RDEB Patient Keratinocytes (A) TALEN pair T6/T7 targets the 5′ region of the COL7A1 exon 80 sequence (upper case) in the vicinity of the c.6527insC mutation (red arrowhead). TALEN spacer sequence is shaded. Intron sequences are in blue lower case. (B) The PCR product comprising the T6/T7 target site was analyzed with Surveyor (Cel I) mutation detection assay to establish optimal MOI in patient keratinocytes infected with adenoviral vectors for T6/T7 TALEN expression. Solid arrowhead indicates uncleaved DNA; arrowheads indicate cleavage fragments. Percentage of cleavage for each PCR product is shown at the bottom. M is IX molecular weight marker. (C) Indel spectrum in keratinocytes from RDEB patients 1 (experiment 1) and 2 (experiment 2) transduced with Ad-T6/T7 vectors. Two out 22 clones in experiment 1 and 14 out of 125 clones in experiment 2 carried indel alleles at the TALEN target site. The number of clones containing each indel is shown on the right. Intron sequences are in blue lowercase letters. Double slash marks represent DNA sequences that are not shown.

    Article Snippet: For the real-time qPCR analysis, 1:20 dilutions of each cDNA synthesis reaction were analyzed in triplicate using Taqman gene-expression assays Hs00164310_m1 ( COL7A1 exon64 probe), Hs01574801_g1 ( COL7A1 exon80 probe), and Hs02758991_g1 (GAPDH probe, control).

    Techniques: Sequencing, Mutagenesis, Polymerase Chain Reaction, Detection Assay, Infection, Expressing, Molecular Weight, Marker, Transduction, Clone Assay

    In Vivo Skin Regeneration from Frame-Restored Patient Keratinocyte Clone 19.C Expressing a C7 Variant Lacking the Exon 80-Encoded Sequence (A) COL7A1 cDNA and C7 amino acid sequences for WT, c.6527insC, and ΔE80 (114-bp deletion) alleles. Amino acid substitutions in c.6527insC are shown in red. (B) Macroscopic appearance of a representative human skin (delineated by dotted line) regenerated from clone 19.C. (C) Demonstration of dermal-epidermal adhesion in patient skin regenerated from clone 19.C. Firm pulling from the edge of an incision did not cause dermal-epidermal detachment. (D) H E staining of regenerated patient skin showing epidermal-dermal adhesion and normal epidermal architecture. Scale bar, 100 μm. (E) Immunohistochemical staining using an antibody specific for human involucrin to show normal human epidermal differentiation of the gene-corrected patient skin graft at the mouse (Mo)-human(Hu) skin boundary. Scale bar, 100μm. (F, G, and H) Immunofluorescence staining using an antibody specific for human C7 (red). Normal C7 deposition was found along the BMZ of a gene-corrected patient skin graft regenerated from clone 19.C keratinocytes (F) and in normal human keratinocyte positive control graft (G). No C7 staining was found in sections of a negative control graft regenerated from unedited patient 2 keratinocytes (H). Cell nuclei were stained with DAPI (blue). Asterisks denote blistering between dermis and epidermis. Scale bar, 50 μm. (I) Electron microscopy analysis showed the presence of mature anchoring fibrils (arrowheads) at the dermal-epidermal junction of gene-corrected patient skin regenerated from clone 19.C keratinocytes. Scale bar, 200 nm.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells

    doi: 10.1016/j.omtn.2018.01.009

    Figure Lengend Snippet: In Vivo Skin Regeneration from Frame-Restored Patient Keratinocyte Clone 19.C Expressing a C7 Variant Lacking the Exon 80-Encoded Sequence (A) COL7A1 cDNA and C7 amino acid sequences for WT, c.6527insC, and ΔE80 (114-bp deletion) alleles. Amino acid substitutions in c.6527insC are shown in red. (B) Macroscopic appearance of a representative human skin (delineated by dotted line) regenerated from clone 19.C. (C) Demonstration of dermal-epidermal adhesion in patient skin regenerated from clone 19.C. Firm pulling from the edge of an incision did not cause dermal-epidermal detachment. (D) H E staining of regenerated patient skin showing epidermal-dermal adhesion and normal epidermal architecture. Scale bar, 100 μm. (E) Immunohistochemical staining using an antibody specific for human involucrin to show normal human epidermal differentiation of the gene-corrected patient skin graft at the mouse (Mo)-human(Hu) skin boundary. Scale bar, 100μm. (F, G, and H) Immunofluorescence staining using an antibody specific for human C7 (red). Normal C7 deposition was found along the BMZ of a gene-corrected patient skin graft regenerated from clone 19.C keratinocytes (F) and in normal human keratinocyte positive control graft (G). No C7 staining was found in sections of a negative control graft regenerated from unedited patient 2 keratinocytes (H). Cell nuclei were stained with DAPI (blue). Asterisks denote blistering between dermis and epidermis. Scale bar, 50 μm. (I) Electron microscopy analysis showed the presence of mature anchoring fibrils (arrowheads) at the dermal-epidermal junction of gene-corrected patient skin regenerated from clone 19.C keratinocytes. Scale bar, 200 nm.

    Article Snippet: For the real-time qPCR analysis, 1:20 dilutions of each cDNA synthesis reaction were analyzed in triplicate using Taqman gene-expression assays Hs00164310_m1 ( COL7A1 exon64 probe), Hs01574801_g1 ( COL7A1 exon80 probe), and Hs02758991_g1 (GAPDH probe, control).

    Techniques: In Vivo, Expressing, Variant Assay, Sequencing, Staining, Immunohistochemistry, Immunofluorescence, Positive Control, Negative Control, Electron Microscopy

    LV-RTM-S6m transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) PCR analysis on genomic DNA of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.

    Journal: Nucleic Acids Research

    Article Title: An RNA-targeted therapy for dystrophic epidermolysis bullosa

    doi: 10.1093/nar/gkx669

    Figure Lengend Snippet: LV-RTM-S6m transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) PCR analysis on genomic DNA of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.

    Article Snippet: For detection of full-length LV-RTM-S6m, PCR analysis using a polyA signal specific forward primer (5′CCTCCCCCTGAACCTGAAACATAAAATGAATGC3′), a COL7A1 exon 65 specific reverse primer (5′GATTCAGGCGCCTCTGGGAGAGAAG3′) as well as the Long Range dNTPack (Roche, Vienna, Austria) was performed according to the manufacturer's protocol.

    Techniques: Expressing, Plasmid Preparation, Sequencing, Transduction, Polymerase Chain Reaction, Positive Control, Staining

    Analysis of the trans -spliced COL7A1 mRNA in the LV-RTM-S6m corrected RDEB single cell clone C47. ( A ) Via sqRT-PCR using primers specifically hybridizing to endogenous COL7A1 exon 62/63 and the introduced silent mutation in exon 65 on the RTM, we detected a product of 216 bp, corresponding to the trans -spliced COL7A1 mRNA in LV-RTM-S6m transduced RDEB cell pool and single cell clone C47. LV-RTM-woBD transduced cells served as negative control. ( B ) Sequence analysis of trans-spliced COL7A1 mRNA shows the correct exon 64/65 junction as well as the amplified silent mutations. ( C ) SqRT-PCR analysis showed that 2.113% of COL7A1 mRNA in C47 was correctly trans -spliced. Mean of four individual experiments and error bars (SEM). ***P-value

    Journal: Nucleic Acids Research

    Article Title: An RNA-targeted therapy for dystrophic epidermolysis bullosa

    doi: 10.1093/nar/gkx669

    Figure Lengend Snippet: Analysis of the trans -spliced COL7A1 mRNA in the LV-RTM-S6m corrected RDEB single cell clone C47. ( A ) Via sqRT-PCR using primers specifically hybridizing to endogenous COL7A1 exon 62/63 and the introduced silent mutation in exon 65 on the RTM, we detected a product of 216 bp, corresponding to the trans -spliced COL7A1 mRNA in LV-RTM-S6m transduced RDEB cell pool and single cell clone C47. LV-RTM-woBD transduced cells served as negative control. ( B ) Sequence analysis of trans-spliced COL7A1 mRNA shows the correct exon 64/65 junction as well as the amplified silent mutations. ( C ) SqRT-PCR analysis showed that 2.113% of COL7A1 mRNA in C47 was correctly trans -spliced. Mean of four individual experiments and error bars (SEM). ***P-value

    Article Snippet: For detection of full-length LV-RTM-S6m, PCR analysis using a polyA signal specific forward primer (5′CCTCCCCCTGAACCTGAAACATAAAATGAATGC3′), a COL7A1 exon 65 specific reverse primer (5′GATTCAGGCGCCTCTGGGAGAGAAG3′) as well as the Long Range dNTPack (Roche, Vienna, Austria) was performed according to the manufacturer's protocol.

    Techniques: Polymerase Chain Reaction, Mutagenesis, Negative Control, Sequencing, Amplification

    COL7A1 Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. GAPDH expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: Deletion of a Pathogenic Mutation-Containing Exon of COL7A1 Allows Clonal Gene Editing Correction of RDEB Patient Epidermal Stem Cells

    doi: 10.1016/j.omtn.2018.01.009

    Figure Lengend Snippet: COL7A1 Gene Expression Analysis in Frame-Restored Clones (A) RT-PCR analysis for detection of COL7A1 transcripts using primers in exons 78 to 84. A 240/241-bp band (black arrowhead) corresponding to wild-type/c.6527insC unedited transcripts was amplified from all RNA samples (left). In addition, a 205-bp band (red arrowhead) corresponding to exon 80-lacking transcripts was found in clones 19, 19.3, and 19.C. M, IX molecular weight marker; HK, healthy human keratinocytes; P2, patient keratinocytes; P2s, healthy heterozygous patient sibling; (−), negative control without cDNA. GAPDH expression was analyzed as a loading control (right). (B) TA-cloned RT-PCR products from clones 19, 19.3, and 19.C revealed the presence of transcripts originating from the unedited pathogenic allele (upper chromatogram) and transcripts lacking the exon 80-encoded sequence (lower chromatogram). Black lines depict exon boundaries. Chromatograms corresponding to clone 19.C are shown. (C) Real-time qPCR quantification of COL7A1 expression using Taqman probes specific for all COL7A1 transcripts (Ex64) and exon 80-containing transcripts (Ex80). (D) Western blot analysis of C7 expression. P2, patient 2 keratinocytes; 19, 19.3, 19.C, clones from P2 carrying the 114-bp deletion allele; 61, clone from P2 carrying the ΔG 1-bp deletion allele; P2s, healthy heterozygous sibling keratinocytes; HK, healthy human keratinocytes.

    Article Snippet: For the real-time qPCR analysis, 1:20 dilutions of each cDNA synthesis reaction were analyzed in triplicate using Taqman gene-expression assays Hs00164310_m1 ( COL7A1 exon64 probe), Hs01574801_g1 ( COL7A1 exon80 probe), and Hs02758991_g1 (GAPDH probe, control).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification, Clone Assay, Molecular Weight, Marker, Negative Control, Sequencing, Real-time Polymerase Chain Reaction, Western Blot

    LV-RTM-S6m transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) PCR analysis on genomic DNA of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.

    Journal: Nucleic Acids Research

    Article Title: An RNA-targeted therapy for dystrophic epidermolysis bullosa

    doi: 10.1093/nar/gkx669

    Figure Lengend Snippet: LV-RTM-S6m transduced RDEB patient keratinocytes showed trans -splicing corrected type VII collagen expression. ( A ) The bidirectional SIN lentiviral vector contained the coding sequence of COL7A1 exons 65–118 and the 224 bp BD in antisense direction expressed by a spleen focus forming virus promoter (SF-Pro). The GFP and puromycin cassette (Puro) under the control of a mnCMV promoter was inserted in sense direction. ( B ) Stable transduction of LV-RTM-S6m into an RDEB keratinocyte cell line induced accurate trans -splicing into the endogenous COL7A1 pre-mRNA, leading to the replacement of endogenous COL7A1 exons 65–118 by a wild-type copy provided by the RTM. Asterisk = silent mutations. ( C ) PCR analysis on genomic DNA of LV-RTM-S6m and LV-RTMm-woBD transduced RDEB keratinocytes showed full-length genomic RTM integration (3.6 kb). Positive control: LV-RTM-S6m plasmid. ( D ) Immunofluoresence staining showed a specific signal indicating type VII collagen expression (red) in LV-RTM-S6m transduced RDEB keratinocytes, similar to healthy wild-type keratinocytes (normal kc) and hardly visible in negative controls (untransduced and LV-RTMm-woBD). Cell nuclei: 4′,6-diamidin-2-phenylindol (DAPI, blue). Scale bar (SB) = 20 μm.

    Article Snippet: PCR analysis of genomic DNA Genomic DNA of transduced keratinocytes was isolated using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol.

    Techniques: Expressing, Plasmid Preparation, Sequencing, Transduction, Polymerase Chain Reaction, Positive Control, Staining