clai Search Results


5 ccatcgatgg3  (New England Biolabs)
96
New England Biolabs 5 ccatcgatgg3
5 Ccatcgatgg3, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clai/us06962791-1192-21-22?v=New+England+Biolabs
Average 96 stars, based on 1 article reviews
5 ccatcgatgg3 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier
clai  (New England Biolabs)
96
New England Biolabs clai
Clai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clai/us08628966-221-4-31?v=New+England+Biolabs
Average 96 stars, based on 1 article reviews
clai - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier
restriction enzymes sphi, psti, clai, hindiii, saci, xbai and bamhi  (Promega)
90
Promega restriction enzymes sphi, psti, clai, hindiii, saci, xbai and bamhi
Restriction Enzymes Sphi, Psti, Clai, Hindiii, Saci, Xbai And Bamhi, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clai/pm11295459-98-22-32?v=Promega
Average 90 stars, based on 1 article reviews
restriction enzymes sphi, psti, clai, hindiii, saci, xbai and bamhi - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
restriction enzymes psti, smai, xhoi, xbai, sali, pvuii, clai  (Promega)
90
Promega restriction enzymes psti, smai, xhoi, xbai, sali, pvuii, clai
Restriction Enzymes Psti, Smai, Xhoi, Xbai, Sali, Pvuii, Clai, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clai/pm17250749-74-17-18?v=Promega
Average 90 stars, based on 1 article reviews
restriction enzymes psti, smai, xhoi, xbai, sali, pvuii, clai - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
clai  (Promega)
90
Promega clai
Clai, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clai/pmc03147592-181-5-10?v=Promega
Average 90 stars, based on 1 article reviews
clai - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
32p-labeled clai-psti promoter segment (2427 to)  (ICN Biomedicals)
90
ICN Biomedicals 32p-labeled clai-psti promoter segment (2427 to)
32p Labeled Clai Psti Promoter Segment (2427 To), supplied by ICN Biomedicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clai/pm10579330-126-3-4?v=ICN+Biomedicals
Average 90 stars, based on 1 article reviews
32p-labeled clai-psti promoter segment (2427 to) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
ecori and clai restriction endonuclease  (Promega)
90
Promega ecori and clai restriction endonuclease
Ecori And Clai Restriction Endonuclease, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clai/pm15869962-94-29-34?v=Promega
Average 90 stars, based on 1 article reviews
ecori and clai restriction endonuclease - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
paci -frt - kozak-rfp-e2a-puro-f3- clai  (GenScript corporation)
90
GenScript corporation paci -frt - kozak-rfp-e2a-puro-f3- clai
Paci Frt Kozak Rfp E2a Puro F3 Clai, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clai/pmc04991790-138-1-8?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
paci -frt - kozak-rfp-e2a-puro-f3- clai - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
fadr _clai_r  (ACGT Inc)
90
ACGT Inc fadr _clai_r
Fatty acid synthesis and degradation cycles have been depicted with blue and orange arrows, respectively. Regulatory proteins have been shown in dotted box in green and red color denoting activation and repression, respectively. Genes that have been overexpressed in this study have been denoted with green upward arrow, while genes that have been deleted are shown along with red cross. Abbreviations: TesAT—thioesterase of Anaerococcus tetradius ; TesBT–thioesterase of Bacteroides thetaiotaomicron ; TesBF—thioesterase of Bryantella formatexigens ; Acc*—acetyl-CoA carboxylase of Corynebacterium glutamicum ; FabD–malonyl CoA-ACP transacylase; FabH - β- ketoacyl-ACP synthase III; FabG - β-ketoacyl-ACP reductase; FabA and FabZ - β-hydroxyacyl-ACP dehydratase; FabI—enoyl-ACP reductase; FabB - β-ketoacyl-ACP synthase I; FadD—fatty acyl-CoA synthetase; FadE—acyl CoA dehydrogenase; FabR–transcriptional repressor of FASII; <t>FadR–transcriptional</t> enhancer of FASII and repressor of β-oxidation.
Fadr Clai R, supplied by ACGT Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clai/pmc04965127-36-0-3?v=ACGT+Inc
Average 90 stars, based on 1 article reviews
fadr _clai_r - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
restriction endonuclease clai  (Promega)
90
Promega restriction endonuclease clai
Fatty acid synthesis and degradation cycles have been depicted with blue and orange arrows, respectively. Regulatory proteins have been shown in dotted box in green and red color denoting activation and repression, respectively. Genes that have been overexpressed in this study have been denoted with green upward arrow, while genes that have been deleted are shown along with red cross. Abbreviations: TesAT—thioesterase of Anaerococcus tetradius ; TesBT–thioesterase of Bacteroides thetaiotaomicron ; TesBF—thioesterase of Bryantella formatexigens ; Acc*—acetyl-CoA carboxylase of Corynebacterium glutamicum ; FabD–malonyl CoA-ACP transacylase; FabH - β- ketoacyl-ACP synthase III; FabG - β-ketoacyl-ACP reductase; FabA and FabZ - β-hydroxyacyl-ACP dehydratase; FabI—enoyl-ACP reductase; FabB - β-ketoacyl-ACP synthase I; FadD—fatty acyl-CoA synthetase; FadE—acyl CoA dehydrogenase; FabR–transcriptional repressor of FASII; <t>FadR–transcriptional</t> enhancer of FASII and repressor of β-oxidation.
Restriction Endonuclease Clai, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clai/pm25812934-64-45-48?v=Promega
Average 90 stars, based on 1 article reviews
restriction endonuclease clai - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
restriction endonucleases apai, bamhi, clai and ecori  (Promega)
90
Promega restriction endonucleases apai, bamhi, clai and ecori
Fatty acid synthesis and degradation cycles have been depicted with blue and orange arrows, respectively. Regulatory proteins have been shown in dotted box in green and red color denoting activation and repression, respectively. Genes that have been overexpressed in this study have been denoted with green upward arrow, while genes that have been deleted are shown along with red cross. Abbreviations: TesAT—thioesterase of Anaerococcus tetradius ; TesBT–thioesterase of Bacteroides thetaiotaomicron ; TesBF—thioesterase of Bryantella formatexigens ; Acc*—acetyl-CoA carboxylase of Corynebacterium glutamicum ; FabD–malonyl CoA-ACP transacylase; FabH - β- ketoacyl-ACP synthase III; FabG - β-ketoacyl-ACP reductase; FabA and FabZ - β-hydroxyacyl-ACP dehydratase; FabI—enoyl-ACP reductase; FabB - β-ketoacyl-ACP synthase I; FadD—fatty acyl-CoA synthetase; FadE—acyl CoA dehydrogenase; FabR–transcriptional repressor of FASII; <t>FadR–transcriptional</t> enhancer of FASII and repressor of β-oxidation.
Restriction Endonucleases Apai, Bamhi, Clai And Ecori, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clai/pm28233144-15-11-12?v=Promega
Average 90 stars, based on 1 article reviews
restriction endonucleases apai, bamhi, clai and ecori - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
synthesized terminator sequence kpni-texp1-sali-clai  (GenScript corporation)
90
GenScript corporation synthesized terminator sequence kpni-texp1-sali-clai
Fatty acid synthesis and degradation cycles have been depicted with blue and orange arrows, respectively. Regulatory proteins have been shown in dotted box in green and red color denoting activation and repression, respectively. Genes that have been overexpressed in this study have been denoted with green upward arrow, while genes that have been deleted are shown along with red cross. Abbreviations: TesAT—thioesterase of Anaerococcus tetradius ; TesBT–thioesterase of Bacteroides thetaiotaomicron ; TesBF—thioesterase of Bryantella formatexigens ; Acc*—acetyl-CoA carboxylase of Corynebacterium glutamicum ; FabD–malonyl CoA-ACP transacylase; FabH - β- ketoacyl-ACP synthase III; FabG - β-ketoacyl-ACP reductase; FabA and FabZ - β-hydroxyacyl-ACP dehydratase; FabI—enoyl-ACP reductase; FabB - β-ketoacyl-ACP synthase I; FadD—fatty acyl-CoA synthetase; FadE—acyl CoA dehydrogenase; FabR–transcriptional repressor of FASII; <t>FadR–transcriptional</t> enhancer of FASII and repressor of β-oxidation.
Synthesized Terminator Sequence Kpni Texp1 Sali Clai, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/clai/pmc08733397__Data_Sheet_1-16-5-10?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
synthesized terminator sequence kpni-texp1-sali-clai - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Fatty acid synthesis and degradation cycles have been depicted with blue and orange arrows, respectively. Regulatory proteins have been shown in dotted box in green and red color denoting activation and repression, respectively. Genes that have been overexpressed in this study have been denoted with green upward arrow, while genes that have been deleted are shown along with red cross. Abbreviations: TesAT—thioesterase of Anaerococcus tetradius ; TesBT–thioesterase of Bacteroides thetaiotaomicron ; TesBF—thioesterase of Bryantella formatexigens ; Acc*—acetyl-CoA carboxylase of Corynebacterium glutamicum ; FabD–malonyl CoA-ACP transacylase; FabH - β- ketoacyl-ACP synthase III; FabG - β-ketoacyl-ACP reductase; FabA and FabZ - β-hydroxyacyl-ACP dehydratase; FabI—enoyl-ACP reductase; FabB - β-ketoacyl-ACP synthase I; FadD—fatty acyl-CoA synthetase; FadE—acyl CoA dehydrogenase; FabR–transcriptional repressor of FASII; FadR–transcriptional enhancer of FASII and repressor of β-oxidation.

Journal: PLoS ONE

Article Title: Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

doi: 10.1371/journal.pone.0160035

Figure Lengend Snippet: Fatty acid synthesis and degradation cycles have been depicted with blue and orange arrows, respectively. Regulatory proteins have been shown in dotted box in green and red color denoting activation and repression, respectively. Genes that have been overexpressed in this study have been denoted with green upward arrow, while genes that have been deleted are shown along with red cross. Abbreviations: TesAT—thioesterase of Anaerococcus tetradius ; TesBT–thioesterase of Bacteroides thetaiotaomicron ; TesBF—thioesterase of Bryantella formatexigens ; Acc*—acetyl-CoA carboxylase of Corynebacterium glutamicum ; FabD–malonyl CoA-ACP transacylase; FabH - β- ketoacyl-ACP synthase III; FabG - β-ketoacyl-ACP reductase; FabA and FabZ - β-hydroxyacyl-ACP dehydratase; FabI—enoyl-ACP reductase; FabB - β-ketoacyl-ACP synthase I; FadD—fatty acyl-CoA synthetase; FadE—acyl CoA dehydrogenase; FabR–transcriptional repressor of FASII; FadR–transcriptional enhancer of FASII and repressor of β-oxidation.

Article Snippet: fadR _claI_R , AGCT ATCGAT TTAGTGATGGTGATGGTGATGTCGCCCCTGAATGGCTAAATC , This Study.

Techniques: Activation Assay

E . coli MG1655 was co-transformed with plasmid containing gene for thioesterase TesBT along with the plasmid containing gene(s) having positive on host fatty acid biosynthesis and analyzed for production of various chain length free fatty acids. Gene function: fabZ - β-hydroxyacyl-ACP dehydratase; fadR –transcriptional enhancer of FASII and repressor of β-oxidation; acc –acetyl-CoA carboxylase of Corynebacterium glutamicum .

Journal: PLoS ONE

Article Title: Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

doi: 10.1371/journal.pone.0160035

Figure Lengend Snippet: E . coli MG1655 was co-transformed with plasmid containing gene for thioesterase TesBT along with the plasmid containing gene(s) having positive on host fatty acid biosynthesis and analyzed for production of various chain length free fatty acids. Gene function: fabZ - β-hydroxyacyl-ACP dehydratase; fadR –transcriptional enhancer of FASII and repressor of β-oxidation; acc –acetyl-CoA carboxylase of Corynebacterium glutamicum .

Article Snippet: fadR _claI_R , AGCT ATCGAT TTAGTGATGGTGATGGTGATGTCGCCCCTGAATGGCTAAATC , This Study.

Techniques: Transformation Assay, Plasmid Preparation