circligase ssdna ligase kit Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs t4 polynucleotide kinase
    T4 Polynucleotide Kinase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 29387 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 polynucleotide kinase/product/New England Biolabs
    Average 99 stars, based on 29387 article reviews
    Price from $9.99 to $1999.99
    t4 polynucleotide kinase - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    98
    Thermo Fisher sodium acetate
    Sodium Acetate, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 2805 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sodium acetate/product/Thermo Fisher
    Average 98 stars, based on 2805 article reviews
    Price from $9.99 to $1999.99
    sodium acetate - by Bioz Stars, 2020-11
    98/100 stars
      Buy from Supplier

    99
    New England Biolabs phusion high fidelity dna polymerase
    Phusion High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 23530 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phusion high fidelity dna polymerase/product/New England Biolabs
    Average 99 stars, based on 23530 article reviews
    Price from $9.99 to $1999.99
    phusion high fidelity dna polymerase - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs t4 rna ligase 2
    T4 Rna Ligase 2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2023 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2/product/New England Biolabs
    Average 99 stars, based on 2023 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher sybr gold nucleic acid gel stain
    Sybr Gold Nucleic Acid Gel Stain, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2935 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr gold nucleic acid gel stain/product/Thermo Fisher
    Average 99 stars, based on 2935 article reviews
    Price from $9.99 to $1999.99
    sybr gold nucleic acid gel stain - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript iii
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Superscript Iii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 58743 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii/product/Thermo Fisher
    Average 99 stars, based on 58743 article reviews
    Price from $9.99 to $1999.99
    superscript iii - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher tris
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Tris, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 14380 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tris/product/Thermo Fisher
    Average 99 stars, based on 14380 article reviews
    Price from $9.99 to $1999.99
    tris - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs deoxynucleotide solution mix
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Deoxynucleotide Solution Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 596 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleotide solution mix/product/New England Biolabs
    Average 99 stars, based on 596 article reviews
    Price from $9.99 to $1999.99
    deoxynucleotide solution mix - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad tbe urea
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Tbe Urea, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 157 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tbe urea/product/Bio-Rad
    Average 99 stars, based on 157 article reviews
    Price from $9.99 to $1999.99
    tbe urea - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript iii first strand synthesis system
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Superscript Iii First Strand Synthesis System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 53495 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii first strand synthesis system/product/Thermo Fisher
    Average 99 stars, based on 53495 article reviews
    Price from $9.99 to $1999.99
    superscript iii first strand synthesis system - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher dnase i
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Dnase I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 73125 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i/product/Thermo Fisher
    Average 99 stars, based on 73125 article reviews
    Price from $9.99 to $1999.99
    dnase i - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher edta
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Edta, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 16222 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/edta/product/Thermo Fisher
    Average 99 stars, based on 16222 article reviews
    Price from $9.99 to $1999.99
    edta - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    rna  (Qiagen)
    99
    Qiagen rna
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Rna, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 49618 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna/product/Qiagen
    Average 99 stars, based on 49618 article reviews
    Price from $9.99 to $1999.99
    rna - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher pcr amplification
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Pcr Amplification, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 69101 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr amplification/product/Thermo Fisher
    Average 99 stars, based on 69101 article reviews
    Price from $9.99 to $1999.99
    pcr amplification - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    89
    Illumina Inc illumina truseq adapter
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Illumina Truseq Adapter, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 89/100, based on 149 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina truseq adapter/product/Illumina Inc
    Average 89 stars, based on 149 article reviews
    Price from $9.99 to $1999.99
    illumina truseq adapter - by Bioz Stars, 2020-11
    89/100 stars
      Buy from Supplier

    99
    New England Biolabs mcrbc
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Mcrbc, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 585 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mcrbc/product/New England Biolabs
    Average 99 stars, based on 585 article reviews
    Price from $9.99 to $1999.99
    mcrbc - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher nanodrop 2000 spectrophotometer
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Nanodrop 2000 Spectrophotometer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 27341 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nanodrop 2000 spectrophotometer/product/Thermo Fisher
    Average 99 stars, based on 27341 article reviews
    Price from $9.99 to $1999.99
    nanodrop 2000 spectrophotometer - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher novex tbe gels
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Novex Tbe Gels, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 586 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/novex tbe gels/product/Thermo Fisher
    Average 99 stars, based on 586 article reviews
    Price from $9.99 to $1999.99
    novex tbe gels - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher novex
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Novex, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 5281 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/novex/product/Thermo Fisher
    Average 99 stars, based on 5281 article reviews
    Price from $9.99 to $1999.99
    novex - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher tbe urea gels
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Tbe Urea Gels, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 477 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tbe urea gels/product/Thermo Fisher
    Average 99 stars, based on 477 article reviews
    Price from $9.99 to $1999.99
    tbe urea gels - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs universal mirna cloning linker
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    Universal Mirna Cloning Linker, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 107 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/universal mirna cloning linker/product/New England Biolabs
    Average 99 stars, based on 107 article reviews
    Price from $9.99 to $1999.99
    universal mirna cloning linker - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    93
    Becton Dickinson 20g needle
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    20g Needle, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 93/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/20g needle/product/Becton Dickinson
    Average 93 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    20g needle - by Bioz Stars, 2020-11
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher 2x tbe urea
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    2x Tbe Urea, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/2x tbe urea/product/Thermo Fisher
    Average 99 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    2x tbe urea - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    90
    Solexa 5 aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct 3 p3 solexa pcr primer
    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an <t>RNA</t> G-quadruplex (RG4). The schematic depicts an RG4 with <t>three</t> layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P
    5 Aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct 3 P3 Solexa Pcr Primer, supplied by Solexa, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct 3 p3 solexa pcr primer/product/Solexa
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    5 aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct 3 p3 solexa pcr primer - by Bioz Stars, 2020-11
    90/100 stars
      Buy from Supplier

    Image Search Results


    rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an RNA G-quadruplex (RG4). The schematic depicts an RG4 with three layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P

    Journal: Genome Biology

    Article Title: RNA G-quadruplex structures exist and function in vivo in plants

    doi: 10.1186/s13059-020-02142-9

    Figure Lengend Snippet: rG4-seq reveals the global landscape of G-rich regions with the potential to fold into RG4s in Arabidopsis . a Schematic of an RNA G-quadruplex (RG4). The schematic depicts an RG4 with three layers of G-quartets (G3 RG4, guanine (G) coloured in orange), with the loop length of any nucleotide (N, coloured in grey), potassium ions (K + , grey ball) coordinated within the G-quartets stabilize RG4s. b Workflow of rG4-seq. Poly(A)-enriched RNAs were subjected to reverse transcription under the buffers with Li + (non-stabilizing condition), K + (stabilizing condition) or K + +PDS (stronger stabilizing condition), respectively. The G-rich region sites with folding potential were identified by comparing the coverage of reads between the rG4-seq libraries with different cations as described above. c rG4-seq profiles of AtSMXL5 displayed the read coverage of reverse transcription (RT) with Li + (top), K + (middle) and K + +PDS (bottom), respectively. The 3′end of the G-rich region is indicated by a red triangle. A (blue), C (light grey), G (yellow) and U (green). d Residue distribution around RTS sites. Guanine (G) was strongly enriched in the upstream sequences of RT stalling (RTS) identified under both K + and K + +PDS conditions, but not in the transcriptome and the downstream sequences of RTS. A (blue), C (light grey), G (yellow) and U (green). e Classification of G-rich regions with folding potential. G-rich regions with folding potential identified in K + (dark blue) and K + +PDS conditions (black) were classified into six categories according to the number of G-quartets (G2 with two G-quartets or G3 with three G-quartets), loop length (L, 1–15 nt) and bulge size (non-canonical G3 RG4s with a guanine vacancy: G3VL1-9, or a bulge: G3bulge). f , g rG4-seq profiles of G2 G-rich region on AT4G30460 ( f ) and G3 G-rich region on AT3G23450 ( g ), otherwise in c . h The prevalence of both detected and computational-predicted G-rich regions in different genic regions. Computational-predicted G-rich regions were obtained by searching the sequence feature of GxLnGxLnGxLnGx in Arabidopsis transcriptome. i Comparison of base-pairing probability (BPP) of alternative secondary structure in G-rich regions that are detected with K + (blue) and undetected (grey) using rG4-seq. The Gs in the G-rich region were classed into 8 bins; flanking sequences (100 nt on both sides) were classed into 20 bins, with 15 bins close to G-rich regions shown. Differences of BPPs between G-rich regions and flanking regions, detected by rG4 with K + , P = 0.444; undetected regions, P

    Article Snippet: In vitro or in vivo NAI probed, poly(A)-selected RNA was recovered and reverse transcribed using superscript III (Invitrogen) and RT primer (5′CAGACGTGTGCTCTTCCGATCTNNNNNN3′) with home-made RT buffer (20 mM Tris (pH 8.3), 100 mM LiCl, 3 mM MgCl2, 1 mM DTT).

    Techniques: Sequencing