cdnas Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher revertaid first strand cdna synthesis kit
    IL-37 + T-cells play a protective role in DSS-induced chronic colitis in mice. ( A ) Relative weight curves of WT mice, DSS-induced WT mice, DSS-induced WT mice treated with PBS, and DSS-induced WT mice injected with IL-37 + T-cells in chronic colitis. The statistical significance between the relative weights of DSS-induced mice injected with IL-37 + T-cells versus DSS-induced mice treated with PBS at the end of the experiment is shown. ( B ) The disease activity index (DAI) was determined at day 63 of the study period, based on body weight loss (0, none; 1, 1–5%; 2, 5–10%; 3, 10–20%; 4, > 20%), stool consistency (0, normal; 2, loose stool; 4, diarrhea), and stool blood (0, negative; 2, fecal occult blood test positive; 4, gross bleeding). ( C ) Representative pictures of the colon from indicated treatment cohorts. ( D ) Macroscopic damage score of the colon in the four groups. ( E ) Representative haematoxylin and eosin (H E) staining of colon sections of mice. ( F ) Histological inflammation score. This score comprises the sum of architecture of the bowel, infiltration of neutrophils and mononuclear cells, gobleT-cell depletion, and epithelial cell erosion. Three sections per animal were evaluated. ( G ) Expressions of IFN-γ, IL-1β, TNF-α, and IL-10 mRNAs within colonic tissues in the four groups. Total RNA with the RNAiso Plusi Kit. cDNAs were synthesized by using the <t>RevertAid</t> First Strand <t>cDNA</t> Synthesis Kit according to the manufacturer’s instructions. qPCR amplification reactions were prepared with the SYBR Green PCR Kit and performed using the CFX96 Real-Time System. Data are means ± SEM ( n = 6). * p
    Revertaid First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 40345 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/revertaid first strand cdna synthesis kit/product/Thermo Fisher
    Average 99 stars, based on 40345 article reviews
    Price from $9.99 to $1999.99
    revertaid first strand cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher high capacity cdna reverse transcription kit
    α 2 M expression in primary villous cytotrophoblastic cells and BeWo cells. vCTB were purified from early (8 weeks of gestation) and late first-trimester (11 weeks of gestation) trophoblast and term placenta and seeded for 24, 48, 72 and 96 h. BeWo cells were seeded and treated or not with 20 µM Forskolin (FSK) for 48 h. <t>RNA</t> was retrotranscribed, and 50 ng of <t>cDNA</t> was used to perform α 2 M and GAPDH PCR. n = 3.
    High Capacity Cdna Reverse Transcription Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 118304 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high capacity cdna reverse transcription kit/product/Thermo Fisher
    Average 99 stars, based on 118304 article reviews
    Price from $9.99 to $1999.99
    high capacity cdna reverse transcription kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Bio-Rad iscript cdna synthesis kit
    RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to <t>cDNA</t> using <t>iScript</t> cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.
    Iscript Cdna Synthesis Kit, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 95548 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iscript cdna synthesis kit/product/Bio-Rad
    Average 99 stars, based on 95548 article reviews
    Price from $9.99 to $1999.99
    iscript cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher first strand cdna
    Reduced expression of SENP1/SuPr-2 transcriptional isoforms in mutants. (A) RT-PCR analysis of <t>e12.5</t> wild-type (wt) or mutant (m) littermates. The size of the RT-PCR products in base pairs is at the left. The schematics to the right of each panel indicate the corresponding <t>cDNA</t> structure and location of primers used for the reactions. The upper five panels show PCR of SENP1/SuPr-2, and the lower panel shows HPRT results as the control. (B) Real-time RT-PCR analysis of SENP1/SuPr-2. Relative expression levels were normalized to HPRT.
    First Strand Cdna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 88551 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/first strand cdna/product/Thermo Fisher
    Average 99 stars, based on 88551 article reviews
    Price from $9.99 to $1999.99
    first strand cdna - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    95
    Illumina Inc cdna libraries
    Viral RNA fragments produced by <t>RNase</t> L and RNase A. HCV and PV RNAs were incubated with RNase L and RNase A to produce RNA fragments for 2′, 3′-cyclic phosphate <t>cDNA</t> synthesis and sequencing. Agarose gel electrophoresis and ethidium bromide staining revealed the size of viral RNA fragments. ( A ) Diagram of HCV and PV RNAs. HCV RNA is 9648 bases long. PV RNA is 7500 bases long. ( B ) Viral RNAs incubated with RNase L. HCV and PV RNAs were incubated with RNase L for 20 min in the absence of 2-5A (no 2-5A), or with RNase L and 2-5A for 0, 2.5, 5, 10 and 20 min. ( C ) Viral RNAs incubated with RNase A. HCV and PV RNAs were incubated for 20 min in the absence of RNase A (−), and the presence of RNase A for 0, 2.5, 5, 10 and 20 min.
    Cdna Libraries, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 95/100, based on 30682 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna libraries/product/Illumina Inc
    Average 95 stars, based on 30682 article reviews
    Price from $9.99 to $1999.99
    cdna libraries - by Bioz Stars, 2020-09
    95/100 stars
      Buy from Supplier

    99
    Thermo Fisher cdna
    Improved hierarchical clustering of combined NCI-60 cell-lines profiled by <t>Affymetrix</t> gene-chip and <t>cDNA</t> microarray by sequence-overlapping probe measurements. The gene expression profiles obtained for the sixty cell lines by the Affymetrix gene chips and the Stanford cDNA microarray platform were pooled after data transformation as described in the text. Gene expression data by the two different platforms were matched by either Unigene ID matching or by redefining the Affymetrix probe sets based on the sequence overlap criteria of the probes. The pooled gene expression profiles were subjected to average linkage hierarchical clustering. Matched cell-lines from the two platforms which cluster together are marked by red branches in the dendrogram. ( A ) Unigene-matched measurements tended to cluster the cell-lines by measurement platform, and produced only 28 instances of matched cell-lines clustering together. ( B ) Sequence-overlapping probe measurements produced more (43) instances of matched cell-lines from each platform clustering together.
    Cdna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 160058 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna/product/Thermo Fisher
    Average 99 stars, based on 160058 article reviews
    Price from $9.99 to $1999.99
    cdna - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher high capacity rna to cdna kit
    Relative expression of TREM-1 and DAP12 genes. THP-1 cells were exposed to bacteria at multiplicity of infection (MOI) of 10 or 100. After 4 and 24 h post exposure <t>RNA</t> was extracted, <t>cDNA</t> synthesized and the relative gene expression was determined by quantitative polymerase chain reaction, as described. (A) TREM-1 at 4 h; (B) TREM-1 at 24 h, (C) DAP12 at 4 h, (D) DAP12 at 24 h. Experiments were repeated three times. Data shown are mean ± SD of triplicates from a representative experiment. * P ≤ 0.05 compared with uninfected control.
    High Capacity Rna To Cdna Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 18369 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high capacity rna to cdna kit/product/Thermo Fisher
    Average 99 stars, based on 18369 article reviews
    Price from $9.99 to $1999.99
    high capacity rna to cdna kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher high capacity cdna archive kit
    Genomic structures of novel TUs . A. TU4. B. TU7. C. TU11. D. TU52. E. TU54. Initial paired-end ditag: dark blue. Exons of validated full-length <t>cDNA</t> sequences: orange. Exons of previously known transcripts at each locus: teal (protein-coding sequence: shaded). 3' terminal exon arrows: direction of transcription. Quantitative real-time <t>PCR</t> primer locations: red arrows. All validated cDNA sequences can be found in Additional file 2 .
    High Capacity Cdna Archive Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 19585 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high capacity cdna archive kit/product/Thermo Fisher
    Average 99 stars, based on 19585 article reviews
    Price from $9.99 to $1999.99
    high capacity cdna archive kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher superscript vilo cdna synthesis kit
    mtDNA increases SOCE and expression of Sphk1 in PMN. (A) Human PMN were treated with 20 µg/mL of E.coli DNA or mtDNA for 60 min then loaded with fura-2. Thapsigargin (1 µM) was applied to under nominally calcium-free conditions and then 1.8 mM extracellular calcium was applied at the indicated times. Calcium influx was calculated as described elsewhere [9] as the area under the curve for [Ca 2+ ] i (AUC) over 120 sec. Data were analyzed using medium-treated PMN as 100%. Mean and SE values are shown. At least 3 experiment were done per condition. * denotes a significant difference by student t-test (SigmaPlot 11) compared to time “0” value. Experiments were repeated at least three times. (7B) Freshly isolated human PMN (5 million cells in 2 mL) were incubated with medium, mtDNA (10 µg/mL), E.coli DNA (10 µg/mL), or LPS (100 ng/mL) for 60 min. Then RNA and <t>cDNA</t> were prepared using the RNesay mini kit (Qiagen) and SuperScript <t>VILO</t> cDNA Synthesis kit (Life technologies), respectively. 200 ng of cDNA per reaction was used for TaqMan qPCR assay for Sphk1 and GAPDH to evaluate expression levels. Sphk1 expression levels were then further normalized by GAPDH using the medium control result as 100%. Four different PMN preparations were used for stimulation and qPCR assays were done in triplicates. Mean and SE values from four different experiments are shown. Data were analyzed by One Way ANOVA. * denotes a significant difference between mtDNA treatment and the medium control (p
    Superscript Vilo Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 17594 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript vilo cdna synthesis kit/product/Thermo Fisher
    Average 99 stars, based on 17594 article reviews
    Price from $9.99 to $1999.99
    superscript vilo cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher cdna synthesis
    Expression levels of type I collagen, Smad2/3, and TGF-β1 genes after ES-P treatment in aged mice. (A) The left ears of fourteen-week old mice were treated daily with 30 μg T . spiralis ES-P for 14 days (red color). The right ears of were treated daily with PBS for 14 days as control (blue color). After 14 days, ears were collected. Total <t>RNA</t> was extracted from each ear tissue and <t>cDNA</t> was constructed. (B) The gene expression levels of collagen I , TGF-β1 , and Smad2/3 were analyzed by real-time PCR. The gene expression value of each group was normalized by control value, 14 weeks group. (**; P
    Cdna Synthesis, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 106131 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna synthesis/product/Thermo Fisher
    Average 90 stars, based on 106131 article reviews
    Price from $9.99 to $1999.99
    cdna synthesis - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher cdna synthesis kit
    Gene expression profiles in GANT61-treated SKOV3 cells. ( A ) Identification of differentially expressed genes (DEGs) in GANT61-treated SKOV3 cells. Cells were treated with GANT61 (20 µM) or DMSO for 60 hr, and total <t>RNA</t> was extracted as described in Methods . Changes in gene expression were determined by <t>cDNA</t> microarray gene profiling using the Illumina Human HT expression BeadChip V4 (Illumina Inc., San Diego, CA). Differential expressions for the DEGs are shown. ( B ) The top 11 canonical signaling pathways influenced by inhibition of Gli1/Gli2 function in SKOV3 cells. The top 11 canonical signaling pathways, determined by IPA, that were significantly up-regulated or down-regulated by GANT61 treatment in SKOV3 cells, are shown. The 412 DEGs were mapped to the IPA-defined network. The significant P -values that determine the probability that the association between the genes in the dataset and the canonical pathway is by chance alone were calculated by Fisher's exact test, and are expressed as −log ( P -value). ( C ) Heat map of DEGs in the focal adhesion signal pathway in GANT61-treated SKOV3 cells. The heat map shows that 17 genes were significantly differentially expressed, including seven up-regulated genes and 12 down-regulated genes, in the GANT61-treated compared to control SKOV3 cells. ( D ) Selected DEGs from cDNA array gene expression profiling analyzed by real-time PCR. SKOV3 cells were treated with DMSO or GANT61 for the indicated times, total RNA was extracted for real-time PCR as described in Methods using the primer sets in Table 1 . The data represent the mean ± SD of three determinations, and GAPDH was used to normalize the relative mRNA levels.
    Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 10447 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna synthesis kit/product/Thermo Fisher
    Average 99 stars, based on 10447 article reviews
    Price from $9.99 to $1999.99
    cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    Thermo Fisher revertaid h minus first strand cdna synthesis kit
    Gene expression profiles in GANT61-treated SKOV3 cells. ( A ) Identification of differentially expressed genes (DEGs) in GANT61-treated SKOV3 cells. Cells were treated with GANT61 (20 µM) or DMSO for 60 hr, and total <t>RNA</t> was extracted as described in Methods . Changes in gene expression were determined by <t>cDNA</t> microarray gene profiling using the Illumina Human HT expression BeadChip V4 (Illumina Inc., San Diego, CA). Differential expressions for the DEGs are shown. ( B ) The top 11 canonical signaling pathways influenced by inhibition of Gli1/Gli2 function in SKOV3 cells. The top 11 canonical signaling pathways, determined by IPA, that were significantly up-regulated or down-regulated by GANT61 treatment in SKOV3 cells, are shown. The 412 DEGs were mapped to the IPA-defined network. The significant P -values that determine the probability that the association between the genes in the dataset and the canonical pathway is by chance alone were calculated by Fisher's exact test, and are expressed as −log ( P -value). ( C ) Heat map of DEGs in the focal adhesion signal pathway in GANT61-treated SKOV3 cells. The heat map shows that 17 genes were significantly differentially expressed, including seven up-regulated genes and 12 down-regulated genes, in the GANT61-treated compared to control SKOV3 cells. ( D ) Selected DEGs from cDNA array gene expression profiling analyzed by real-time PCR. SKOV3 cells were treated with DMSO or GANT61 for the indicated times, total RNA was extracted for real-time PCR as described in Methods using the primer sets in Table 1 . The data represent the mean ± SD of three determinations, and GAPDH was used to normalize the relative mRNA levels.
    Revertaid H Minus First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 9555 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/revertaid h minus first strand cdna synthesis kit/product/Thermo Fisher
    Average 94 stars, based on 9555 article reviews
    Price from $9.99 to $1999.99
    revertaid h minus first strand cdna synthesis kit - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    92
    Bio-Rad cdna synthesis
    Adora2b -deficient mice have increased inflammation with impaired induction of Tregs after LPS-induced lung injury. LPS-induced inflammation was initiated in 9–12 wk-old male Adora2b +/+ (C57BL/6J) or age and weight matched Adora2b −/− mice by intratracheal instillation of LPS or saline. Bronchoalveolar lavage (BAL) fluids were collected 1 d post treatment. A) Leukocyte cell counts of BAL fluid were determined utilizing a cellometer (mean ± SEM, n = 2–4). B) Protein content of BAL fluid was determined with BCA assay. Fold increase of protein concentration in LPS treated BAL samples over respective saline BAL samples is displayed (mean ± SEM, n = 3–10). C) Analysis of cell infiltration into the lung airspace (BAL) of mice exposed to inhaled LPS. Mice ( Adora2b +/+ or Adora2b −/−) were exposed to nebulized saline or lipopolysaccharide (LPS); 24 hours post-exposure, mice were euthanized, and BAL was harvested. Cells were then subjected to flow cytometric analysis to identify neutrophils (highly granular, Gr1+ cells). D) Analysis of FoxP3 gene expression in lungs of mice exposed to inhaled LPS. Mice ( Adora2b +/+ or −/−) were exposed to nebulized saline or lipopolysaccharide (LPS); 24 hours post-exposure, mice were euthanized, and perfused lungs were harvested. Total <t>RNA</t> was harvested from lungs, <t>cDNA</t> prepared and analyzed by real-time PCR. Data depict mean (± SEM) fold changes in indicated genes. Fold change was calculated based on primer efficiencies, standardized to changes in actin, with Adora2b +/+ Saline mean value defined as 1. E) Fold change in cell number of either regulatory T cells (lymphocyte size, CD3+ CD4+ FoxP3+) in the lung airspace (BAL) of mice exposed to inhaled saline or LPS as above. Data are from 2–6 mice; 2 independent experiments. F) Relative abundance of CD4 effector T cells (Teffs, defined as lymphocyte size, CD3+ CD4+ CD44high cells) to Tregs based on cell counts from either Adora2b +/+ or Adora2b −/− mice, with pie charts depicting mean cell count for the indicated cell populations from 2–6 mice; 2 independent expts. Analysis of total cellular infiltration into airways and protein leakage (panels A–B) was done in animals treated with intratracheal LPS. Analysis of neutrophil infiltration and Tregs (panels C–F) was done in animals treated with inhaled LPS. Statistically significant differences are indicated and were calculated either by one-way ANOVA (A) or by unpaired t test (B–E) with a focus on whether Adora2b −/− LPS treated animals were statistically different from either saline treated or Adora2b +/+ LPS treated mice.
    Cdna Synthesis, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 92/100, based on 14206 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna synthesis/product/Bio-Rad
    Average 92 stars, based on 14206 article reviews
    Price from $9.99 to $1999.99
    cdna synthesis - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    94
    Quanta Biosciences qscript cdna supermix
    Adora2b -deficient mice have increased inflammation with impaired induction of Tregs after LPS-induced lung injury. LPS-induced inflammation was initiated in 9–12 wk-old male Adora2b +/+ (C57BL/6J) or age and weight matched Adora2b −/− mice by intratracheal instillation of LPS or saline. Bronchoalveolar lavage (BAL) fluids were collected 1 d post treatment. A) Leukocyte cell counts of BAL fluid were determined utilizing a cellometer (mean ± SEM, n = 2–4). B) Protein content of BAL fluid was determined with BCA assay. Fold increase of protein concentration in LPS treated BAL samples over respective saline BAL samples is displayed (mean ± SEM, n = 3–10). C) Analysis of cell infiltration into the lung airspace (BAL) of mice exposed to inhaled LPS. Mice ( Adora2b +/+ or Adora2b −/−) were exposed to nebulized saline or lipopolysaccharide (LPS); 24 hours post-exposure, mice were euthanized, and BAL was harvested. Cells were then subjected to flow cytometric analysis to identify neutrophils (highly granular, Gr1+ cells). D) Analysis of FoxP3 gene expression in lungs of mice exposed to inhaled LPS. Mice ( Adora2b +/+ or −/−) were exposed to nebulized saline or lipopolysaccharide (LPS); 24 hours post-exposure, mice were euthanized, and perfused lungs were harvested. Total <t>RNA</t> was harvested from lungs, <t>cDNA</t> prepared and analyzed by real-time PCR. Data depict mean (± SEM) fold changes in indicated genes. Fold change was calculated based on primer efficiencies, standardized to changes in actin, with Adora2b +/+ Saline mean value defined as 1. E) Fold change in cell number of either regulatory T cells (lymphocyte size, CD3+ CD4+ FoxP3+) in the lung airspace (BAL) of mice exposed to inhaled saline or LPS as above. Data are from 2–6 mice; 2 independent experiments. F) Relative abundance of CD4 effector T cells (Teffs, defined as lymphocyte size, CD3+ CD4+ CD44high cells) to Tregs based on cell counts from either Adora2b +/+ or Adora2b −/− mice, with pie charts depicting mean cell count for the indicated cell populations from 2–6 mice; 2 independent expts. Analysis of total cellular infiltration into airways and protein leakage (panels A–B) was done in animals treated with intratracheal LPS. Analysis of neutrophil infiltration and Tregs (panels C–F) was done in animals treated with inhaled LPS. Statistically significant differences are indicated and were calculated either by one-way ANOVA (A) or by unpaired t test (B–E) with a focus on whether Adora2b −/− LPS treated animals were statistically different from either saline treated or Adora2b +/+ LPS treated mice.
    Qscript Cdna Supermix, supplied by Quanta Biosciences, used in various techniques. Bioz Stars score: 94/100, based on 7210 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qscript cdna supermix/product/Quanta Biosciences
    Average 94 stars, based on 7210 article reviews
    Price from $9.99 to $1999.99
    qscript cdna supermix - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher cdna ends
    Morphological Phenotypes of Transgenic Plants Expressing Wild-Type or Mutant <t>PHS1</t> Transgenes. Seedlings were grown for 7 d on a vertically placed agar plate with or without 3 μM propyzamide in the medium. Root epidermal cells are shown on the right side of each seedling picture. Bar in seedling view = 1 cm; bar in magnified root view = 100 μm. (A) phs1-1 seedlings transformed with a wild-type genomic clone of PHS1 . (B) Wild-type seedlings transformed with a PHS1 genomic clone containing the R64C mutation. (C) Wild-type seedlings transformed with the R64C mutant PHS1 <t>cDNA</t> under the control of the CaMV35S promoter.
    Cdna Ends, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 9717 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna ends/product/Thermo Fisher
    Average 99 stars, based on 9717 article reviews
    Price from $9.99 to $1999.99
    cdna ends - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    TaKaRa primescript 1st strand cdna synthesis kit
    Morphological Phenotypes of Transgenic Plants Expressing Wild-Type or Mutant <t>PHS1</t> Transgenes. Seedlings were grown for 7 d on a vertically placed agar plate with or without 3 μM propyzamide in the medium. Root epidermal cells are shown on the right side of each seedling picture. Bar in seedling view = 1 cm; bar in magnified root view = 100 μm. (A) phs1-1 seedlings transformed with a wild-type genomic clone of PHS1 . (B) Wild-type seedlings transformed with a PHS1 genomic clone containing the R64C mutation. (C) Wild-type seedlings transformed with the R64C mutant PHS1 <t>cDNA</t> under the control of the CaMV35S promoter.
    Primescript 1st Strand Cdna Synthesis Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 7752 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primescript 1st strand cdna synthesis kit/product/TaKaRa
    Average 99 stars, based on 7752 article reviews
    Price from $9.99 to $1999.99
    primescript 1st strand cdna synthesis kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    Bio-Rad cdnas
    VICKZ1 mediates Integrin α6 expression and co-immunoprecipitates with Integrin α6 mRNA. 2-4ss embryos were electroporated with control-GFP (A), full length VICKZ1- GFP (B), or Y396F-GFP (C), and then fixed and stained for Integrin α6 (red) and GFP (green) 10 hours later. In control-GFP transfected embryos, Integrin α6 is down-regulated in the dorsal aspect of the tube in the region where CNC delaminate, on both the transfected and non-transfected sides (A, inset 1 and 2). Overexpression of VICKZ1 maintains Integrin α6 expression even in the most dorsal regions of the tube, but only on the transfected side (B, inset 1), and not on the non-transfected side (B, inset 2). Y396F expression causes a precocious emigration of CNC and down-regulation of Integrin α6 in more lateral regions of the tube, only on the transfected side (C, inset 1) and not on the non-transected side (C, inset 2). All insets show only the red channel (ITGA6). Arrows in insets indicate areas of downregulation of ITGA6. (D) RNP complexes were prepared from 3d and 4d old chick embryos and immunoprecipitated with either pre-immune serum or pan-VICKZ antibody. Equal volumes of total lysates (Total) and immunoprecipitates (IP) were subjected to western blot analysis using the pan-VICKZ antibody. VICKZ protein is pulled down exclusively by the pan-VICKZ antibody. (E) Quantitative <t>RT-PCR</t> analysis was performed on <t>cDNAs</t> prepared from both pre-immune and pan-VICKZ immunoprecipitations and tested for the presence of ITGA6 mRNA. Values of pan-VICKZ IP mRNA were normalized to the amounts of total mRNA, and compared to the pre-immune normalized values (pan-VICKZ/pre-immune). A 15–16 fold enrichment of ITGA6 mRNA is observed in the pan-VICKZ IP, as compared to the pre-immune serum. A control RNA, 18S, shows only 1–2 fold enrichment when analysed in the same way. The data show the mean±SEM.
    Cdnas, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 94/100, based on 8564 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdnas/product/Bio-Rad
    Average 94 stars, based on 8564 article reviews
    Price from $9.99 to $1999.99
    cdnas - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    94
    Quanta Biosciences qscript cdna synthesis kit
    VICKZ1 mediates Integrin α6 expression and co-immunoprecipitates with Integrin α6 mRNA. 2-4ss embryos were electroporated with control-GFP (A), full length VICKZ1- GFP (B), or Y396F-GFP (C), and then fixed and stained for Integrin α6 (red) and GFP (green) 10 hours later. In control-GFP transfected embryos, Integrin α6 is down-regulated in the dorsal aspect of the tube in the region where CNC delaminate, on both the transfected and non-transfected sides (A, inset 1 and 2). Overexpression of VICKZ1 maintains Integrin α6 expression even in the most dorsal regions of the tube, but only on the transfected side (B, inset 1), and not on the non-transfected side (B, inset 2). Y396F expression causes a precocious emigration of CNC and down-regulation of Integrin α6 in more lateral regions of the tube, only on the transfected side (C, inset 1) and not on the non-transected side (C, inset 2). All insets show only the red channel (ITGA6). Arrows in insets indicate areas of downregulation of ITGA6. (D) RNP complexes were prepared from 3d and 4d old chick embryos and immunoprecipitated with either pre-immune serum or pan-VICKZ antibody. Equal volumes of total lysates (Total) and immunoprecipitates (IP) were subjected to western blot analysis using the pan-VICKZ antibody. VICKZ protein is pulled down exclusively by the pan-VICKZ antibody. (E) Quantitative <t>RT-PCR</t> analysis was performed on <t>cDNAs</t> prepared from both pre-immune and pan-VICKZ immunoprecipitations and tested for the presence of ITGA6 mRNA. Values of pan-VICKZ IP mRNA were normalized to the amounts of total mRNA, and compared to the pre-immune normalized values (pan-VICKZ/pre-immune). A 15–16 fold enrichment of ITGA6 mRNA is observed in the pan-VICKZ IP, as compared to the pre-immune serum. A control RNA, 18S, shows only 1–2 fold enrichment when analysed in the same way. The data show the mean±SEM.
    Qscript Cdna Synthesis Kit, supplied by Quanta Biosciences, used in various techniques. Bioz Stars score: 94/100, based on 4783 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qscript cdna synthesis kit/product/Quanta Biosciences
    Average 94 stars, based on 4783 article reviews
    Price from $9.99 to $1999.99
    qscript cdna synthesis kit - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    IL-37 + T-cells play a protective role in DSS-induced chronic colitis in mice. ( A ) Relative weight curves of WT mice, DSS-induced WT mice, DSS-induced WT mice treated with PBS, and DSS-induced WT mice injected with IL-37 + T-cells in chronic colitis. The statistical significance between the relative weights of DSS-induced mice injected with IL-37 + T-cells versus DSS-induced mice treated with PBS at the end of the experiment is shown. ( B ) The disease activity index (DAI) was determined at day 63 of the study period, based on body weight loss (0, none; 1, 1–5%; 2, 5–10%; 3, 10–20%; 4, > 20%), stool consistency (0, normal; 2, loose stool; 4, diarrhea), and stool blood (0, negative; 2, fecal occult blood test positive; 4, gross bleeding). ( C ) Representative pictures of the colon from indicated treatment cohorts. ( D ) Macroscopic damage score of the colon in the four groups. ( E ) Representative haematoxylin and eosin (H E) staining of colon sections of mice. ( F ) Histological inflammation score. This score comprises the sum of architecture of the bowel, infiltration of neutrophils and mononuclear cells, gobleT-cell depletion, and epithelial cell erosion. Three sections per animal were evaluated. ( G ) Expressions of IFN-γ, IL-1β, TNF-α, and IL-10 mRNAs within colonic tissues in the four groups. Total RNA with the RNAiso Plusi Kit. cDNAs were synthesized by using the RevertAid First Strand cDNA Synthesis Kit according to the manufacturer’s instructions. qPCR amplification reactions were prepared with the SYBR Green PCR Kit and performed using the CFX96 Real-Time System. Data are means ± SEM ( n = 6). * p

    Journal: International Journal of Molecular Sciences

    Article Title: Anti-Inflammatory Effect of IL-37-Producing T-Cell Population in DSS-Induced Chronic Inflammatory Bowel Disease in Mice

    doi: 10.3390/ijms19123884

    Figure Lengend Snippet: IL-37 + T-cells play a protective role in DSS-induced chronic colitis in mice. ( A ) Relative weight curves of WT mice, DSS-induced WT mice, DSS-induced WT mice treated with PBS, and DSS-induced WT mice injected with IL-37 + T-cells in chronic colitis. The statistical significance between the relative weights of DSS-induced mice injected with IL-37 + T-cells versus DSS-induced mice treated with PBS at the end of the experiment is shown. ( B ) The disease activity index (DAI) was determined at day 63 of the study period, based on body weight loss (0, none; 1, 1–5%; 2, 5–10%; 3, 10–20%; 4, > 20%), stool consistency (0, normal; 2, loose stool; 4, diarrhea), and stool blood (0, negative; 2, fecal occult blood test positive; 4, gross bleeding). ( C ) Representative pictures of the colon from indicated treatment cohorts. ( D ) Macroscopic damage score of the colon in the four groups. ( E ) Representative haematoxylin and eosin (H E) staining of colon sections of mice. ( F ) Histological inflammation score. This score comprises the sum of architecture of the bowel, infiltration of neutrophils and mononuclear cells, gobleT-cell depletion, and epithelial cell erosion. Three sections per animal were evaluated. ( G ) Expressions of IFN-γ, IL-1β, TNF-α, and IL-10 mRNAs within colonic tissues in the four groups. Total RNA with the RNAiso Plusi Kit. cDNAs were synthesized by using the RevertAid First Strand cDNA Synthesis Kit according to the manufacturer’s instructions. qPCR amplification reactions were prepared with the SYBR Green PCR Kit and performed using the CFX96 Real-Time System. Data are means ± SEM ( n = 6). * p

    Article Snippet: The Nanodrop spectrophotometer (Thermo Scientific, Waltham, MA, USA) was used to measure absorbance. cDNAs were synthesized by using the RevertAid First Strand cDNA Synthesis Kit (ThermoFisher, Waltham, MA, USA) according to manufacturer’s instructions.

    Techniques: Mouse Assay, Injection, Activity Assay, Staining, Synthesized, Real-time Polymerase Chain Reaction, Amplification, SYBR Green Assay, Polymerase Chain Reaction

    Long non-coding RNA LINC01021 was downregulated by Da0324 treatment in gastric cancer cells. A. Volcano plots of lncRNAs differentially expressed between the control and Da0324 treatment groups. SGC7901 cells were treated with DMSO (control) or 4 μM Da0324 for 48 h and high-throughput sequencing assay was performed. The X-axis represents log 2 of fold changes. The Y-axis represents -log 10 of P values. Red spots denote upregulated lncRNAs, blue spots denote downregulated lncRNAs. B. Heatmap of the top 40 lncRNAs most significantly differentially expressed in SGC7901 cells with Da0324 treatment. C. Ten differentially expressed lncRNAs regulated by Da0324 were validated by qRT-PCR. SGC7901 cells were treated with DMSO (control) or 4 μM Da0324 for 48 h. RNAs were isolated and converted to cDNA. Quantitative real-time PCR was performed to determine the expression level of lncRNAs. GAPDH was used as a housekeeping gene. All bars represent relative expression levels and data represent mean ± SD. ***, P

    Journal: American Journal of Translational Research

    Article Title: Downregulation of LINC01021 by curcumin analog Da0324 inhibits gastric cancer progression through activation of P53

    doi:

    Figure Lengend Snippet: Long non-coding RNA LINC01021 was downregulated by Da0324 treatment in gastric cancer cells. A. Volcano plots of lncRNAs differentially expressed between the control and Da0324 treatment groups. SGC7901 cells were treated with DMSO (control) or 4 μM Da0324 for 48 h and high-throughput sequencing assay was performed. The X-axis represents log 2 of fold changes. The Y-axis represents -log 10 of P values. Red spots denote upregulated lncRNAs, blue spots denote downregulated lncRNAs. B. Heatmap of the top 40 lncRNAs most significantly differentially expressed in SGC7901 cells with Da0324 treatment. C. Ten differentially expressed lncRNAs regulated by Da0324 were validated by qRT-PCR. SGC7901 cells were treated with DMSO (control) or 4 μM Da0324 for 48 h. RNAs were isolated and converted to cDNA. Quantitative real-time PCR was performed to determine the expression level of lncRNAs. GAPDH was used as a housekeeping gene. All bars represent relative expression levels and data represent mean ± SD. ***, P

    Article Snippet: Total RNA was reverse transcribed to cDNA using the Revert Aid First-Strand cDNA Synthesis Kit (Thermo Fisher Scientific).

    Techniques: Next-Generation Sequencing, Quantitative RT-PCR, Isolation, Real-time Polymerase Chain Reaction, Expressing

    α 2 M expression in primary villous cytotrophoblastic cells and BeWo cells. vCTB were purified from early (8 weeks of gestation) and late first-trimester (11 weeks of gestation) trophoblast and term placenta and seeded for 24, 48, 72 and 96 h. BeWo cells were seeded and treated or not with 20 µM Forskolin (FSK) for 48 h. RNA was retrotranscribed, and 50 ng of cDNA was used to perform α 2 M and GAPDH PCR. n = 3.

    Journal: Scientific Reports

    Article Title: Activated α2-macroglobulin binding to cell surface GRP78 induces trophoblastic cell fusion

    doi: 10.1038/s41598-020-66554-0

    Figure Lengend Snippet: α 2 M expression in primary villous cytotrophoblastic cells and BeWo cells. vCTB were purified from early (8 weeks of gestation) and late first-trimester (11 weeks of gestation) trophoblast and term placenta and seeded for 24, 48, 72 and 96 h. BeWo cells were seeded and treated or not with 20 µM Forskolin (FSK) for 48 h. RNA was retrotranscribed, and 50 ng of cDNA was used to perform α 2 M and GAPDH PCR. n = 3.

    Article Snippet: Reverse transcription was performed with 1 µg of total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Life Technologies).

    Techniques: Expressing, Purification, Polymerase Chain Reaction

    α 2 M* induced BeWo cell fusion through p-CREB, p-ERK1/2 and p-JNK activation, without affecting syncytin expression. ( A,B ) BeWo cells were seeded for 24 h prior to 24 h of starvation. Subsequently, cells were treated with 5 μM KT5720, 10 μM SP600125 or 10 μM UO126 for 1 h, and 100 pM of α 2 M* was added or not for 30 min. ( A ) Western blotting was performed. p-CREB, CREB, p-ERK1/2, ERK1/2, p-JNK and JNK levels were quantified using the ImageJ software, and data are expressed as the fold change relative to the control. n = 3. The images of bands for the target proteins were taken from the same gel, and each image was cropped, as delineated by black dividing lines, as well as adjusted for image intensity for optimal visualisation. ( B ) Nuclei and syncytia were counted, and a fusion index was calculated. n = 3. Data represented as mean±SEM. ns (not significant), *P ≤ 0.05, **P ≤ 0.01, *** P ≤ 0.005; ANOVA comparison test. ( C , D ) BeWo cells were seeded for 24 h prior to treatment with or without 100 pM of α 2 M*. ( C ) RNA was retrotranscribed, and 10 ng of cDNA was used to perform qPCR using syncytin-1 and syncytin-2 primers. n = 3. Data represented as mean±SEM. **P ≤ 0.01; t-test comparison test. ( D ) BeWo cells were seeded for 24 h prior to treatment with or without 100 pM of α 2 M* for 48 h. Western blotting was performed. Syncytin-1 and GAPDH levels were quantified using the ImageJ software, and data are expressed as the fold change relative to the control. n = 3. The images of bands for the target proteins were taken from the same gel, and each image was cropped, as delineated by black dividing lines, as well as adjusted for image intensity for optimal visualisation.

    Journal: Scientific Reports

    Article Title: Activated α2-macroglobulin binding to cell surface GRP78 induces trophoblastic cell fusion

    doi: 10.1038/s41598-020-66554-0

    Figure Lengend Snippet: α 2 M* induced BeWo cell fusion through p-CREB, p-ERK1/2 and p-JNK activation, without affecting syncytin expression. ( A,B ) BeWo cells were seeded for 24 h prior to 24 h of starvation. Subsequently, cells were treated with 5 μM KT5720, 10 μM SP600125 or 10 μM UO126 for 1 h, and 100 pM of α 2 M* was added or not for 30 min. ( A ) Western blotting was performed. p-CREB, CREB, p-ERK1/2, ERK1/2, p-JNK and JNK levels were quantified using the ImageJ software, and data are expressed as the fold change relative to the control. n = 3. The images of bands for the target proteins were taken from the same gel, and each image was cropped, as delineated by black dividing lines, as well as adjusted for image intensity for optimal visualisation. ( B ) Nuclei and syncytia were counted, and a fusion index was calculated. n = 3. Data represented as mean±SEM. ns (not significant), *P ≤ 0.05, **P ≤ 0.01, *** P ≤ 0.005; ANOVA comparison test. ( C , D ) BeWo cells were seeded for 24 h prior to treatment with or without 100 pM of α 2 M*. ( C ) RNA was retrotranscribed, and 10 ng of cDNA was used to perform qPCR using syncytin-1 and syncytin-2 primers. n = 3. Data represented as mean±SEM. **P ≤ 0.01; t-test comparison test. ( D ) BeWo cells were seeded for 24 h prior to treatment with or without 100 pM of α 2 M* for 48 h. Western blotting was performed. Syncytin-1 and GAPDH levels were quantified using the ImageJ software, and data are expressed as the fold change relative to the control. n = 3. The images of bands for the target proteins were taken from the same gel, and each image was cropped, as delineated by black dividing lines, as well as adjusted for image intensity for optimal visualisation.

    Article Snippet: Reverse transcription was performed with 1 µg of total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Life Technologies).

    Techniques: Activation Assay, Expressing, Western Blot, Software, Real-time Polymerase Chain Reaction

    Plk1 mRNA and protein expression in BT-474 cells after incubating with nanoparticles. (A) An RT-PCR analysis was performed 48 hours after incubating with nanoparticle formulations using primers specific for Plk1 and for GAPDH for standardization. Representative gels show Plk1 cDNA (top) and GAPDH cDNA for standardization (bottom). Percentage of Plk1 cDNA expression is given as percentage of GAPDH-standardized Plk1 cDNA expression in control cells ( n = 8, mean ± SD). A quantitative real-time PCR analysis was performed (B) 24 and (C) 48 hours after incubating with the nanoparticle formulations using Plk1- and GAPDH-specific primers. Graphical summary of gene expression values of treated cells standardized to control cells are shown ( n = 3–5, mean ± SD). (D–F) Western blot analyses were performed using anti-Plk1 antibodies 24, 48, and 72 hours after incubating with the nanoparticle formulations. To control for variability of loading, membranes were reprobed with antibodies against p38 (24 and 48 hours) or β-actin (72 hours). Representative Western blots show Plk1 (top) and β-actin or p38 protein (bottom) for standardization. Percentage of Plk1 protein expression is given as percentage of β-actin- or p38-standardized Plk1 levels in control cells ( n = 3, mean ± SD).

    Journal: Neoplasia (New York, N.Y.)

    Article Title: Downregulation of Plk1 Expression By Receptor-Mediated Uptake of Antisense Oligonucleotide-Loaded Nanoparticles 1

    doi:

    Figure Lengend Snippet: Plk1 mRNA and protein expression in BT-474 cells after incubating with nanoparticles. (A) An RT-PCR analysis was performed 48 hours after incubating with nanoparticle formulations using primers specific for Plk1 and for GAPDH for standardization. Representative gels show Plk1 cDNA (top) and GAPDH cDNA for standardization (bottom). Percentage of Plk1 cDNA expression is given as percentage of GAPDH-standardized Plk1 cDNA expression in control cells ( n = 8, mean ± SD). A quantitative real-time PCR analysis was performed (B) 24 and (C) 48 hours after incubating with the nanoparticle formulations using Plk1- and GAPDH-specific primers. Graphical summary of gene expression values of treated cells standardized to control cells are shown ( n = 3–5, mean ± SD). (D–F) Western blot analyses were performed using anti-Plk1 antibodies 24, 48, and 72 hours after incubating with the nanoparticle formulations. To control for variability of loading, membranes were reprobed with antibodies against p38 (24 and 48 hours) or β-actin (72 hours). Representative Western blots show Plk1 (top) and β-actin or p38 protein (bottom) for standardization. Percentage of Plk1 protein expression is given as percentage of β-actin- or p38-standardized Plk1 levels in control cells ( n = 3, mean ± SD).

    Article Snippet: After isolation of total RNA using RNeasy Mini Kits (Qiagen) according to the manufacturer's protocol 24 and 48 hours after incubating with the nanoparticle formulations, the mRNA was transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, Darmstadt, Germany).

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Western Blot

    RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to cDNA using iScript cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.

    Journal: Bio-protocol

    Article Title: Immunoprecipitation of Tri-methylated Capped RNA

    doi: 10.21769/BioProtoc.2717

    Figure Lengend Snippet: RNA immunoprecipitation of (TMG)-capped primary miRNAs (Pri-miRNAs) in quiescent human foreskin fibroblasts (HFFs) RT-PCR data shows the RNA immunoprecipitation of Pri-miR-34a and Pri-miR-3188 in quiescent HFFs (as well as the positive control snRNA U7), but not Pri-miR-423 using an antibody against (TMG)-capped RNAs. Total RNA was extracted using TRIzol Reagent, and 10 μg of RNA was diluted in NET-2 buffer, precleared and incubated with Protein G Sepharose 4 Fast Flow beads loaded with 15 μl of control antibody (Normal Rabbit Serum, EMD-Millipore) or with antibody recognizing the (TMG)-cap (Anti-m3G-cap, rabbit polyclonal, Synaptic Systems). Beads were rinsed five times with NET-2 buffer and were resuspended in G-50 buffer. RNA was extracted from the beads by phenol-chloroform-isoamyl alcohol extraction and resuspended in 20 μl of nuclease-free water. Immunoprecipitated tri-methylated capped RNA was converted to cDNA using iScript cDNA synthesis kit (Bio-Rad), followed by RT-PCR, and visualized after gel electrophoresis.

    Article Snippet: Protein G Sepharose® 4 Fast Flow Beads (GE Healthcare, catalog number: 17061801) Normal rabbit serum (control, EMD Millipore, catalog number: NS01L-1ML) Sodium chloride (NaCl) (Fisher Scientific, catalog number: S671-3) NP-40 (Thermo Fisher Scientific, catalog number: 28324) Tris base (Fisher Scientific, catalog number: BP152-5) Hydrochloric acid (HCl) (VWR, catalog number: BDH7204-1) RNasin™ Plus RNase inhibitor (Promega, catalog number: N2611) NaOAc (AMRESCO, catalog number: 0602) Ethylenediaminetetraacetate acid (EDTA), pH 8 (Thermo Fisher Scientific, catalog number: AM9260G) Ethylenediaminetetraacetate acid (EDTA) (AMRESCO, catalog number: 0105) Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: AM9822) Phenol/Chloroform/Isoamyl Alcohol; 125:24:1 mixture, pH 4.5 (Thermo Fisher Scientific, catalog number: AM9720) Agarose LE (Denville Scientific, catalog number: CA3510-8) iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, catalog number: 1708891) Sso Advanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, catalog number: 1725274) PARIS™ Kit (Thermo Fisher Scientific, catalog number: AM1921) Boric acid (Fisher Scientific, catalog number: A73-1) NET-2 Buffer (see Recipes) G-50 Buffer (see Recipes) 1× TBE (see Recipes)

    Techniques: Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction, Positive Control, Incubation, Flow Cytometry, Methylation, Nucleic Acid Electrophoresis

    Reduced expression of SENP1/SuPr-2 transcriptional isoforms in mutants. (A) RT-PCR analysis of e12.5 wild-type (wt) or mutant (m) littermates. The size of the RT-PCR products in base pairs is at the left. The schematics to the right of each panel indicate the corresponding cDNA structure and location of primers used for the reactions. The upper five panels show PCR of SENP1/SuPr-2, and the lower panel shows HPRT results as the control. (B) Real-time RT-PCR analysis of SENP1/SuPr-2. Relative expression levels were normalized to HPRT.

    Journal: Molecular and Cellular Biology

    Article Title: Mutation of SENP1/SuPr-2 Reveals an Essential Role for Desumoylation in Mouse Development

    doi: 10.1128/MCB.25.12.5171-5182.2005

    Figure Lengend Snippet: Reduced expression of SENP1/SuPr-2 transcriptional isoforms in mutants. (A) RT-PCR analysis of e12.5 wild-type (wt) or mutant (m) littermates. The size of the RT-PCR products in base pairs is at the left. The schematics to the right of each panel indicate the corresponding cDNA structure and location of primers used for the reactions. The upper five panels show PCR of SENP1/SuPr-2, and the lower panel shows HPRT results as the control. (B) Real-time RT-PCR analysis of SENP1/SuPr-2. Relative expression levels were normalized to HPRT.

    Article Snippet: Briefly, first-strand cDNA was synthesized from total e12.5 RNA isolated with TRIzol Reagent (Invitrogen), using Superscript II reverse transcriptase (Invitrogen) primed with oligonucleotides TGAGCCAAGGAAACTGTCTGAGG (lying in SENP1/SuPr-2 exon 5) and AAGCAGTGGTATCAACGCAGAGTACGCGGG.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Mutagenesis, Polymerase Chain Reaction, Quantitative RT-PCR

    Elevated gene 50 transcription is accompanied by hypomethylation of the gene 50 promoter at day 18. (A) Quantitative RT-PCR for total gene 50 (G50) (exon 2) transcripts on cDNA generated from total splenocyte RNA. Transcript levels are elevated in Cre-positive

    Journal: Journal of Virology

    Article Title: The De Novo Methyltransferases DNMT3a and DNMT3b Target the Murine Gammaherpesvirus Immediate-Early Gene 50 Promoter during Establishment of Latency ▿

    doi: 10.1128/JVI.00060-10

    Figure Lengend Snippet: Elevated gene 50 transcription is accompanied by hypomethylation of the gene 50 promoter at day 18. (A) Quantitative RT-PCR for total gene 50 (G50) (exon 2) transcripts on cDNA generated from total splenocyte RNA. Transcript levels are elevated in Cre-positive

    Article Snippet: Twenty microliters of DNase-treated RNA was subsequently used for first-strand cDNA synthesis by use of SuperScript II reverse transcriptase (Invitrogen).

    Techniques: Quantitative RT-PCR, Generated

    Calponin-3-GFP is expressed from the endogenous Cnn3 locus. A. RT-PCR analysis of the Cnn3 mRNA splicing in targeted cells. Total RNA from the pre-B cell line Oct as well as from pre-B cells derived from a Cnn3 ki f/f mouse was transcribed into cDNA and analyzed by PCR. Primer pairs for PCRs 1 and 2 are depicted in the schematic illustration of the targeted allele. A sample lacking cDNA served as a control. B. Western blot analysis for expression of the calponin-3-GFP fusion protein from the targeted Cnn3 locus. Pre-B cells derived from a Cnn3 ki f/f mouse or a non-targeted littermate were lysed and subjected to SDS-PAGE and blotting. Oct pre-B cells expressing GFP and calponin-3-GFP were used as a control. Equal loading was demonstrated by anti-eIF4α. C. Flow cytometric analysis of cells from a Cnn3 ki f/f mouse or a non-targeted +/+ littermate. Cells were isolated from the bone marrow of the respective mice, stained with an anti-IgM antibody and analyzed for expression of IgM and GFP by flow cytometry. Numbers indicate the percentage of cells in the respective gate.

    Journal: PLoS ONE

    Article Title: A Conditional Knockout Mouse Model Reveals That Calponin-3 Is Dispensable for Early B Cell Development

    doi: 10.1371/journal.pone.0128385

    Figure Lengend Snippet: Calponin-3-GFP is expressed from the endogenous Cnn3 locus. A. RT-PCR analysis of the Cnn3 mRNA splicing in targeted cells. Total RNA from the pre-B cell line Oct as well as from pre-B cells derived from a Cnn3 ki f/f mouse was transcribed into cDNA and analyzed by PCR. Primer pairs for PCRs 1 and 2 are depicted in the schematic illustration of the targeted allele. A sample lacking cDNA served as a control. B. Western blot analysis for expression of the calponin-3-GFP fusion protein from the targeted Cnn3 locus. Pre-B cells derived from a Cnn3 ki f/f mouse or a non-targeted littermate were lysed and subjected to SDS-PAGE and blotting. Oct pre-B cells expressing GFP and calponin-3-GFP were used as a control. Equal loading was demonstrated by anti-eIF4α. C. Flow cytometric analysis of cells from a Cnn3 ki f/f mouse or a non-targeted +/+ littermate. Cells were isolated from the bone marrow of the respective mice, stained with an anti-IgM antibody and analyzed for expression of IgM and GFP by flow cytometry. Numbers indicate the percentage of cells in the respective gate.

    Article Snippet: 1 μg of RNA was reverse-transcribed into cDNA using the First Strand cDNA Synthesis Kit (Fermentas) according to the manufacturers’ instructions.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Derivative Assay, Polymerase Chain Reaction, Western Blot, Expressing, SDS Page, Flow Cytometry, Isolation, Mouse Assay, Staining, Cytometry

    Genetic organization of PeWBVYV. (A) PeWBVYV ORFs and validation strategy using RT-PCR amplification. UTR, untranslated region. (B) Strategy for assembly of cDNA corresponding to the PeWBVYV RNA genome from overlapping fragments by overlap extension PCR. (C) PCR amplification of cDNA corresponding to the PeWBVYV RNA genome by overlap PCR.

    Journal: Journal of Virology

    Article Title: Transmission of a New Polerovirus Infecting Pepper by the Whitefly Bemisia tabaci

    doi: 10.1128/JVI.00488-19

    Figure Lengend Snippet: Genetic organization of PeWBVYV. (A) PeWBVYV ORFs and validation strategy using RT-PCR amplification. UTR, untranslated region. (B) Strategy for assembly of cDNA corresponding to the PeWBVYV RNA genome from overlapping fragments by overlap extension PCR. (C) PCR amplification of cDNA corresponding to the PeWBVYV RNA genome by overlap PCR.

    Article Snippet: Treatment with DNase I and synthesis of first-strand cDNA with 2 μg RNA and random hexamers were done using a Maxima first-strand cDNA synthesis kit (Thermo Fisher Scientific).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction

    Viral RNA fragments produced by RNase L and RNase A. HCV and PV RNAs were incubated with RNase L and RNase A to produce RNA fragments for 2′, 3′-cyclic phosphate cDNA synthesis and sequencing. Agarose gel electrophoresis and ethidium bromide staining revealed the size of viral RNA fragments. ( A ) Diagram of HCV and PV RNAs. HCV RNA is 9648 bases long. PV RNA is 7500 bases long. ( B ) Viral RNAs incubated with RNase L. HCV and PV RNAs were incubated with RNase L for 20 min in the absence of 2-5A (no 2-5A), or with RNase L and 2-5A for 0, 2.5, 5, 10 and 20 min. ( C ) Viral RNAs incubated with RNase A. HCV and PV RNAs were incubated for 20 min in the absence of RNase A (−), and the presence of RNase A for 0, 2.5, 5, 10 and 20 min.

    Journal: Nucleic Acids Research

    Article Title: Ribonuclease L and metal-ion-independent endoribonuclease cleavage sites in host and viral RNAs

    doi: 10.1093/nar/gku118

    Figure Lengend Snippet: Viral RNA fragments produced by RNase L and RNase A. HCV and PV RNAs were incubated with RNase L and RNase A to produce RNA fragments for 2′, 3′-cyclic phosphate cDNA synthesis and sequencing. Agarose gel electrophoresis and ethidium bromide staining revealed the size of viral RNA fragments. ( A ) Diagram of HCV and PV RNAs. HCV RNA is 9648 bases long. PV RNA is 7500 bases long. ( B ) Viral RNAs incubated with RNase L. HCV and PV RNAs were incubated with RNase L for 20 min in the absence of 2-5A (no 2-5A), or with RNase L and 2-5A for 0, 2.5, 5, 10 and 20 min. ( C ) Viral RNAs incubated with RNase A. HCV and PV RNAs were incubated for 20 min in the absence of RNase A (−), and the presence of RNase A for 0, 2.5, 5, 10 and 20 min.

    Article Snippet: When RNAs from the PV-infected cells were analyzed by agarose gel electrophoresis, the accumulation of viral RNA was evident at 4–8 h post adsorption (hpa) ( B). rRNA fragments characteristic of RNase L activity were evident in RNAs from PV-infected W12 HeLa cells at 6 and 8 hpa, but these rRNA fragments were not detected in PV-infected M25 HeLa cells ( B, asterisks indicate the location of rRNA fragments characteristic of RNase L activity). cDNA libraries were prepared and sequenced using the RNAs from HeLa cells ( C and D and Supplementary Table S3 ). cDNA reads corresponding to PV RNA increased from undetectable levels at early times after infection to 5% of the cDNA at 6 hpa in W12 HeLa cells and 26.1% of the cDNA at 6 hpa in M25 HeLa cells ( C and D and Supplementary Table S3 ).

    Techniques: Produced, Incubation, Sequencing, Agarose Gel Electrophoresis, Staining

    Endoribonuclease cleavage sites in PV RNA isolated from HeLa cells. RNAs from PV-infected HeLa cells ( Figure 3 B) were used for 2′, 3′-cyclic phosphate cDNA synthesis and Illumina sequencing. ( A ) Location and frequency of cleavage sites in PV RNA from W12 HeLa cells. X-axis: Nucleotide position in PV RNA. Y-axis: Number of distinct UMI-tagged linkers detected at each cleavage site. ( B ) Dinucleotide specificity of cleavage sites in PV RNA from W12 HeLa cells. X-axis: Dinucleotide at the 3′-end of PV RNA fragments (adjacent to 8 base UMI sequence in RNA linkers as illustrated in Supplementary Figure S1 ). Y-axis: Percent of PV cDNA reads. ( C ) Location and frequency of cleavage sites in PV RNA from M25 HeLa cells. X-axis: Nucleotide position in PV RNA. Y-axis: Number of distinct UMI-tagged linkers detected at each cleavage site. ( D ) Dinucleotide specificity of cleavage sites in PV RNA from M25 HeLa cells. X-axis: Dinucleotide at the 3′-end of PV RNA fragments. Y-axis: Percent of PV cDNA reads.

    Journal: Nucleic Acids Research

    Article Title: Ribonuclease L and metal-ion-independent endoribonuclease cleavage sites in host and viral RNAs

    doi: 10.1093/nar/gku118

    Figure Lengend Snippet: Endoribonuclease cleavage sites in PV RNA isolated from HeLa cells. RNAs from PV-infected HeLa cells ( Figure 3 B) were used for 2′, 3′-cyclic phosphate cDNA synthesis and Illumina sequencing. ( A ) Location and frequency of cleavage sites in PV RNA from W12 HeLa cells. X-axis: Nucleotide position in PV RNA. Y-axis: Number of distinct UMI-tagged linkers detected at each cleavage site. ( B ) Dinucleotide specificity of cleavage sites in PV RNA from W12 HeLa cells. X-axis: Dinucleotide at the 3′-end of PV RNA fragments (adjacent to 8 base UMI sequence in RNA linkers as illustrated in Supplementary Figure S1 ). Y-axis: Percent of PV cDNA reads. ( C ) Location and frequency of cleavage sites in PV RNA from M25 HeLa cells. X-axis: Nucleotide position in PV RNA. Y-axis: Number of distinct UMI-tagged linkers detected at each cleavage site. ( D ) Dinucleotide specificity of cleavage sites in PV RNA from M25 HeLa cells. X-axis: Dinucleotide at the 3′-end of PV RNA fragments. Y-axis: Percent of PV cDNA reads.

    Article Snippet: When RNAs from the PV-infected cells were analyzed by agarose gel electrophoresis, the accumulation of viral RNA was evident at 4–8 h post adsorption (hpa) ( B). rRNA fragments characteristic of RNase L activity were evident in RNAs from PV-infected W12 HeLa cells at 6 and 8 hpa, but these rRNA fragments were not detected in PV-infected M25 HeLa cells ( B, asterisks indicate the location of rRNA fragments characteristic of RNase L activity). cDNA libraries were prepared and sequenced using the RNAs from HeLa cells ( C and D and Supplementary Table S3 ). cDNA reads corresponding to PV RNA increased from undetectable levels at early times after infection to 5% of the cDNA at 6 hpa in W12 HeLa cells and 26.1% of the cDNA at 6 hpa in M25 HeLa cells ( C and D and Supplementary Table S3 ).

    Techniques: Isolation, Infection, Sequencing

    Endoribonuclease cleavage sites in rRNAs from M25 HeLa cells. RNAs from mock-infected and PV-infected M25 HeLa cells ( Figure 3 B) were used for 2′, 3′-cyclic phosphate cDNA synthesis and Illumina sequencing. The location and frequency of cleavage sites in 28S rRNA ( A ), 18S rRNA ( B ), 5.8S rRNA ( C ) and 5S rRNA ( D ) are shown for mock-infected and PV-infected RNA samples isolated at 8 hpa. X-axis: Nucleotide position of each RNA. Y-axis: Percentage of total UMIs at each cleavage site. Dinucleotides at the 3′-end of abundant RNA fragments are annotated at the corresponding positions in the graphs. The locations of GC-rich expansion segments are highlighted by light blue rectangles.

    Journal: Nucleic Acids Research

    Article Title: Ribonuclease L and metal-ion-independent endoribonuclease cleavage sites in host and viral RNAs

    doi: 10.1093/nar/gku118

    Figure Lengend Snippet: Endoribonuclease cleavage sites in rRNAs from M25 HeLa cells. RNAs from mock-infected and PV-infected M25 HeLa cells ( Figure 3 B) were used for 2′, 3′-cyclic phosphate cDNA synthesis and Illumina sequencing. The location and frequency of cleavage sites in 28S rRNA ( A ), 18S rRNA ( B ), 5.8S rRNA ( C ) and 5S rRNA ( D ) are shown for mock-infected and PV-infected RNA samples isolated at 8 hpa. X-axis: Nucleotide position of each RNA. Y-axis: Percentage of total UMIs at each cleavage site. Dinucleotides at the 3′-end of abundant RNA fragments are annotated at the corresponding positions in the graphs. The locations of GC-rich expansion segments are highlighted by light blue rectangles.

    Article Snippet: When RNAs from the PV-infected cells were analyzed by agarose gel electrophoresis, the accumulation of viral RNA was evident at 4–8 h post adsorption (hpa) ( B). rRNA fragments characteristic of RNase L activity were evident in RNAs from PV-infected W12 HeLa cells at 6 and 8 hpa, but these rRNA fragments were not detected in PV-infected M25 HeLa cells ( B, asterisks indicate the location of rRNA fragments characteristic of RNase L activity). cDNA libraries were prepared and sequenced using the RNAs from HeLa cells ( C and D and Supplementary Table S3 ). cDNA reads corresponding to PV RNA increased from undetectable levels at early times after infection to 5% of the cDNA at 6 hpa in W12 HeLa cells and 26.1% of the cDNA at 6 hpa in M25 HeLa cells ( C and D and Supplementary Table S3 ).

    Techniques: Infection, Sequencing, Isolation

    Frequency, location and dinucleotide specificity of cleavage sites in viral RNAs. 2′, 3′-cyclic phosphate cDNA synthesis and Illumina sequencing was used to analyze the viral RNA fragments shown in Figure 1 . ( A ) Frequency, location and dinucleotide specificity of endoribonuclease cleavage sites in HCV RNA (from 20 min samples). ( B ) Frequency, location and dinucleotide specificity of cleavage sites in PV RNA (from 20 min samples).

    Journal: Nucleic Acids Research

    Article Title: Ribonuclease L and metal-ion-independent endoribonuclease cleavage sites in host and viral RNAs

    doi: 10.1093/nar/gku118

    Figure Lengend Snippet: Frequency, location and dinucleotide specificity of cleavage sites in viral RNAs. 2′, 3′-cyclic phosphate cDNA synthesis and Illumina sequencing was used to analyze the viral RNA fragments shown in Figure 1 . ( A ) Frequency, location and dinucleotide specificity of endoribonuclease cleavage sites in HCV RNA (from 20 min samples). ( B ) Frequency, location and dinucleotide specificity of cleavage sites in PV RNA (from 20 min samples).

    Article Snippet: When RNAs from the PV-infected cells were analyzed by agarose gel electrophoresis, the accumulation of viral RNA was evident at 4–8 h post adsorption (hpa) ( B). rRNA fragments characteristic of RNase L activity were evident in RNAs from PV-infected W12 HeLa cells at 6 and 8 hpa, but these rRNA fragments were not detected in PV-infected M25 HeLa cells ( B, asterisks indicate the location of rRNA fragments characteristic of RNase L activity). cDNA libraries were prepared and sequenced using the RNAs from HeLa cells ( C and D and Supplementary Table S3 ). cDNA reads corresponding to PV RNA increased from undetectable levels at early times after infection to 5% of the cDNA at 6 hpa in W12 HeLa cells and 26.1% of the cDNA at 6 hpa in M25 HeLa cells ( C and D and Supplementary Table S3 ).

    Techniques: Sequencing

    Endoribonuclease cleavage sites in rRNAs from W12 HeLa cells. RNAs from mock-infected and PV-infected W12 HeLa cells ( Figure 3 B) were used for 2′, 3′-cyclic phosphate cDNA synthesis and Illumina sequencing. The location and frequency of cleavage sites in 28S rRNA ( A ), 18S rRNA ( B ), 5.8S rRNA ( C ) and 5S rRNA ( D ) are shown for mock-infected and PV-infected RNA samples isolated at 8 hpa. X-axis: Nucleotide position of each RNA. Y-axis: Percentage of total UMIs at each cleavage site. Dinucleotides at the 3′-end of abundant RNA fragments are annotated at the corresponding positions in the graphs. The locations of GC-rich expansion segments are highlighted by light blue rectangles. RNase L cleavage sites are highlighted in red.

    Journal: Nucleic Acids Research

    Article Title: Ribonuclease L and metal-ion-independent endoribonuclease cleavage sites in host and viral RNAs

    doi: 10.1093/nar/gku118

    Figure Lengend Snippet: Endoribonuclease cleavage sites in rRNAs from W12 HeLa cells. RNAs from mock-infected and PV-infected W12 HeLa cells ( Figure 3 B) were used for 2′, 3′-cyclic phosphate cDNA synthesis and Illumina sequencing. The location and frequency of cleavage sites in 28S rRNA ( A ), 18S rRNA ( B ), 5.8S rRNA ( C ) and 5S rRNA ( D ) are shown for mock-infected and PV-infected RNA samples isolated at 8 hpa. X-axis: Nucleotide position of each RNA. Y-axis: Percentage of total UMIs at each cleavage site. Dinucleotides at the 3′-end of abundant RNA fragments are annotated at the corresponding positions in the graphs. The locations of GC-rich expansion segments are highlighted by light blue rectangles. RNase L cleavage sites are highlighted in red.

    Article Snippet: When RNAs from the PV-infected cells were analyzed by agarose gel electrophoresis, the accumulation of viral RNA was evident at 4–8 h post adsorption (hpa) ( B). rRNA fragments characteristic of RNase L activity were evident in RNAs from PV-infected W12 HeLa cells at 6 and 8 hpa, but these rRNA fragments were not detected in PV-infected M25 HeLa cells ( B, asterisks indicate the location of rRNA fragments characteristic of RNase L activity). cDNA libraries were prepared and sequenced using the RNAs from HeLa cells ( C and D and Supplementary Table S3 ). cDNA reads corresponding to PV RNA increased from undetectable levels at early times after infection to 5% of the cDNA at 6 hpa in W12 HeLa cells and 26.1% of the cDNA at 6 hpa in M25 HeLa cells ( C and D and Supplementary Table S3 ).

    Techniques: Infection, Sequencing, Isolation

    Host and viral RNA from mock-infected and PV-infected HeLa cells. RNA was isolated from mock-infected and PV-infected HeLa cells for 2′, 3′-cyclic phosphate cDNA synthesis and Illumina sequencing. ( A ) PV infection. W12 and M25 HeLa cells were infected with PV using 10 PFUs per cell. PV titers determined by plaque assay and plotted versus time (hpa). ( B ) RNA from PV-infected HeLa cells. RNA was isolated from infected cells, fractionated by agarose gel electrophoresis and visualized using ethidium bromide and UV light. ( C and D ) cDNA reads from W12 (C) and M25 (D) HeLa cells. The RNAs shown in Figure 3 B were used for 2′, 3′-cyclic phosphate cDNA synthesis and Illumina sequencing. Amounts of host and viral cDNA in each sample are plotted (data from Supplementary Table S3 ).

    Journal: Nucleic Acids Research

    Article Title: Ribonuclease L and metal-ion-independent endoribonuclease cleavage sites in host and viral RNAs

    doi: 10.1093/nar/gku118

    Figure Lengend Snippet: Host and viral RNA from mock-infected and PV-infected HeLa cells. RNA was isolated from mock-infected and PV-infected HeLa cells for 2′, 3′-cyclic phosphate cDNA synthesis and Illumina sequencing. ( A ) PV infection. W12 and M25 HeLa cells were infected with PV using 10 PFUs per cell. PV titers determined by plaque assay and plotted versus time (hpa). ( B ) RNA from PV-infected HeLa cells. RNA was isolated from infected cells, fractionated by agarose gel electrophoresis and visualized using ethidium bromide and UV light. ( C and D ) cDNA reads from W12 (C) and M25 (D) HeLa cells. The RNAs shown in Figure 3 B were used for 2′, 3′-cyclic phosphate cDNA synthesis and Illumina sequencing. Amounts of host and viral cDNA in each sample are plotted (data from Supplementary Table S3 ).

    Article Snippet: When RNAs from the PV-infected cells were analyzed by agarose gel electrophoresis, the accumulation of viral RNA was evident at 4–8 h post adsorption (hpa) ( B). rRNA fragments characteristic of RNase L activity were evident in RNAs from PV-infected W12 HeLa cells at 6 and 8 hpa, but these rRNA fragments were not detected in PV-infected M25 HeLa cells ( B, asterisks indicate the location of rRNA fragments characteristic of RNase L activity). cDNA libraries were prepared and sequenced using the RNAs from HeLa cells ( C and D and Supplementary Table S3 ). cDNA reads corresponding to PV RNA increased from undetectable levels at early times after infection to 5% of the cDNA at 6 hpa in W12 HeLa cells and 26.1% of the cDNA at 6 hpa in M25 HeLa cells ( C and D and Supplementary Table S3 ).

    Techniques: Infection, Isolation, Sequencing, Plaque Assay, Agarose Gel Electrophoresis

    Improved hierarchical clustering of combined NCI-60 cell-lines profiled by Affymetrix gene-chip and cDNA microarray by sequence-overlapping probe measurements. The gene expression profiles obtained for the sixty cell lines by the Affymetrix gene chips and the Stanford cDNA microarray platform were pooled after data transformation as described in the text. Gene expression data by the two different platforms were matched by either Unigene ID matching or by redefining the Affymetrix probe sets based on the sequence overlap criteria of the probes. The pooled gene expression profiles were subjected to average linkage hierarchical clustering. Matched cell-lines from the two platforms which cluster together are marked by red branches in the dendrogram. ( A ) Unigene-matched measurements tended to cluster the cell-lines by measurement platform, and produced only 28 instances of matched cell-lines clustering together. ( B ) Sequence-overlapping probe measurements produced more (43) instances of matched cell-lines from each platform clustering together.

    Journal: BMC Bioinformatics

    Article Title: Redefinition of Affymetrix probe sets by sequence overlap with cDNA microarray probes reduces cross-platform inconsistencies in cancer-associated gene expression measurements

    doi: 10.1186/1471-2105-6-107

    Figure Lengend Snippet: Improved hierarchical clustering of combined NCI-60 cell-lines profiled by Affymetrix gene-chip and cDNA microarray by sequence-overlapping probe measurements. The gene expression profiles obtained for the sixty cell lines by the Affymetrix gene chips and the Stanford cDNA microarray platform were pooled after data transformation as described in the text. Gene expression data by the two different platforms were matched by either Unigene ID matching or by redefining the Affymetrix probe sets based on the sequence overlap criteria of the probes. The pooled gene expression profiles were subjected to average linkage hierarchical clustering. Matched cell-lines from the two platforms which cluster together are marked by red branches in the dendrogram. ( A ) Unigene-matched measurements tended to cluster the cell-lines by measurement platform, and produced only 28 instances of matched cell-lines clustering together. ( B ) Sequence-overlapping probe measurements produced more (43) instances of matched cell-lines from each platform clustering together.

    Article Snippet: However, for a clear presentation of results we chose to compare the following classes representing different levels of shared identity: a) Affymetrix probe sets that share a Unigene ID with a cDNA clone. (termed Shared Unigene probes) b) Affymetrix probe sets containing probes that could be sequence-matched to the same transcript sequence as the cDNA clone, but for which no Affymetrix probe actually overlaps the cDNA clone sequence (termed Shared Transcript probes); c) Affymetrix probe sets with 1 to 10 probes sequence overlapping with the cDNA clone (termed Partially Overlapping probes); d) Affymetrix probe sets with 20 (i.e. all) probes sequence overlapping with the cDNA clone (termed Completely Overlapping probes); e) alt-CDF or "redefined probe sets" for which all probes across the entire array that matched to a given cDNA clone insert were used to define a new derivative probe set.

    Techniques: Chromatin Immunoprecipitation, Microarray, Sequencing, Expressing, Transformation Assay, Produced

    Increased efficiency of breast cancer subtype classification transfer from cDNA microarray to Affymetrix HG-U95Av2 gene-chip tumor-profiles by sequence-overlapping probe measurements. Tumor samples profiled on the Affymetrix platform were classified according to their correlation with the set of subtype median-centroids derived from cDNA microarray measurements (see methods). The classified samples were then hierarchically clustered using Pearson correlation and average-linkage agglomeration. ( A ), Affymetrix measurements matched to the cDNA centroids by Unigene identifier. ( B ), Affymetrix measurements matched to cDNA centroids by sequence-overlap of probe features produced more coherent classifications. In particular, the large ERbB2+ subtype cluster (upper left) is mostly absent from the unigene-based classification. The significance of this cluster is supported by the observation that all tumors in this cluster for which Her-2 amplification was assessed by immunohistochemistry were designated positive.

    Journal: BMC Bioinformatics

    Article Title: Redefinition of Affymetrix probe sets by sequence overlap with cDNA microarray probes reduces cross-platform inconsistencies in cancer-associated gene expression measurements

    doi: 10.1186/1471-2105-6-107

    Figure Lengend Snippet: Increased efficiency of breast cancer subtype classification transfer from cDNA microarray to Affymetrix HG-U95Av2 gene-chip tumor-profiles by sequence-overlapping probe measurements. Tumor samples profiled on the Affymetrix platform were classified according to their correlation with the set of subtype median-centroids derived from cDNA microarray measurements (see methods). The classified samples were then hierarchically clustered using Pearson correlation and average-linkage agglomeration. ( A ), Affymetrix measurements matched to the cDNA centroids by Unigene identifier. ( B ), Affymetrix measurements matched to cDNA centroids by sequence-overlap of probe features produced more coherent classifications. In particular, the large ERbB2+ subtype cluster (upper left) is mostly absent from the unigene-based classification. The significance of this cluster is supported by the observation that all tumors in this cluster for which Her-2 amplification was assessed by immunohistochemistry were designated positive.

    Article Snippet: However, for a clear presentation of results we chose to compare the following classes representing different levels of shared identity: a) Affymetrix probe sets that share a Unigene ID with a cDNA clone. (termed Shared Unigene probes) b) Affymetrix probe sets containing probes that could be sequence-matched to the same transcript sequence as the cDNA clone, but for which no Affymetrix probe actually overlaps the cDNA clone sequence (termed Shared Transcript probes); c) Affymetrix probe sets with 1 to 10 probes sequence overlapping with the cDNA clone (termed Partially Overlapping probes); d) Affymetrix probe sets with 20 (i.e. all) probes sequence overlapping with the cDNA clone (termed Completely Overlapping probes); e) alt-CDF or "redefined probe sets" for which all probes across the entire array that matched to a given cDNA clone insert were used to define a new derivative probe set.

    Techniques: Microarray, Chromatin Immunoprecipitation, Sequencing, Derivative Assay, Produced, Amplification, Immunohistochemistry

    Sequence-overlapping probes give greater cross-platform concordance for the NCI-60 panel. ( A ) Pearson correlation coefficient was calculated for each gene between its expression values measured on the Affymetrix Hu6800 platforms and its expression values measured on the Stanford cDNA microarray across sixty cell lines of the NCI-60 panel. The figure shows the cumulative distribution of the Pearson correlation coefficients for all genes analyzed. The five different curves reflect the level of cross-platform consistency of probe sets with various levels of overlap between the two microarray platforms. Matched gene measurements across the two platforms showed higher correlation when greater numbers of probes in the Affymetrix probe sets overlapped the insert region of the cDNA clone. The highest correlation was attained when only those Affymetrix probes overlapping the insert-sequence of a given cDNA clone were retained. Measurements for which the probes targeted the same transcript as the cDNA clone, but did not overlap the clone sequence, showed the lowest correlation. ( B ), Pearson correlation coefficient was calculated across all genes for each matched sample pair profiled by the Affymetrix Hu6800 platform and by the Stanford cDNA microarray. The figure shows the cumulative distribution of the Pearson correlation coefficients for the sixty cell lines of the NCI-60 panel. Matched cell-line measurements showed identical stratification of correlation levels by feature-matching criteria.

    Journal: BMC Bioinformatics

    Article Title: Redefinition of Affymetrix probe sets by sequence overlap with cDNA microarray probes reduces cross-platform inconsistencies in cancer-associated gene expression measurements

    doi: 10.1186/1471-2105-6-107

    Figure Lengend Snippet: Sequence-overlapping probes give greater cross-platform concordance for the NCI-60 panel. ( A ) Pearson correlation coefficient was calculated for each gene between its expression values measured on the Affymetrix Hu6800 platforms and its expression values measured on the Stanford cDNA microarray across sixty cell lines of the NCI-60 panel. The figure shows the cumulative distribution of the Pearson correlation coefficients for all genes analyzed. The five different curves reflect the level of cross-platform consistency of probe sets with various levels of overlap between the two microarray platforms. Matched gene measurements across the two platforms showed higher correlation when greater numbers of probes in the Affymetrix probe sets overlapped the insert region of the cDNA clone. The highest correlation was attained when only those Affymetrix probes overlapping the insert-sequence of a given cDNA clone were retained. Measurements for which the probes targeted the same transcript as the cDNA clone, but did not overlap the clone sequence, showed the lowest correlation. ( B ), Pearson correlation coefficient was calculated across all genes for each matched sample pair profiled by the Affymetrix Hu6800 platform and by the Stanford cDNA microarray. The figure shows the cumulative distribution of the Pearson correlation coefficients for the sixty cell lines of the NCI-60 panel. Matched cell-line measurements showed identical stratification of correlation levels by feature-matching criteria.

    Article Snippet: However, for a clear presentation of results we chose to compare the following classes representing different levels of shared identity: a) Affymetrix probe sets that share a Unigene ID with a cDNA clone. (termed Shared Unigene probes) b) Affymetrix probe sets containing probes that could be sequence-matched to the same transcript sequence as the cDNA clone, but for which no Affymetrix probe actually overlaps the cDNA clone sequence (termed Shared Transcript probes); c) Affymetrix probe sets with 1 to 10 probes sequence overlapping with the cDNA clone (termed Partially Overlapping probes); d) Affymetrix probe sets with 20 (i.e. all) probes sequence overlapping with the cDNA clone (termed Completely Overlapping probes); e) alt-CDF or "redefined probe sets" for which all probes across the entire array that matched to a given cDNA clone insert were used to define a new derivative probe set.

    Techniques: Sequencing, Expressing, Microarray

    Conserved clustering pattern of the NCI-60 cell lines profiled using cDNA microarray and Affymetrix gene chips. Data was normalized as described (methods). Average linkage Pearson correlation hierarchical clustering was computed for each dataset. Cell line names are colored according to cancer type.

    Journal: BMC Bioinformatics

    Article Title: Redefinition of Affymetrix probe sets by sequence overlap with cDNA microarray probes reduces cross-platform inconsistencies in cancer-associated gene expression measurements

    doi: 10.1186/1471-2105-6-107

    Figure Lengend Snippet: Conserved clustering pattern of the NCI-60 cell lines profiled using cDNA microarray and Affymetrix gene chips. Data was normalized as described (methods). Average linkage Pearson correlation hierarchical clustering was computed for each dataset. Cell line names are colored according to cancer type.

    Article Snippet: However, for a clear presentation of results we chose to compare the following classes representing different levels of shared identity: a) Affymetrix probe sets that share a Unigene ID with a cDNA clone. (termed Shared Unigene probes) b) Affymetrix probe sets containing probes that could be sequence-matched to the same transcript sequence as the cDNA clone, but for which no Affymetrix probe actually overlaps the cDNA clone sequence (termed Shared Transcript probes); c) Affymetrix probe sets with 1 to 10 probes sequence overlapping with the cDNA clone (termed Partially Overlapping probes); d) Affymetrix probe sets with 20 (i.e. all) probes sequence overlapping with the cDNA clone (termed Completely Overlapping probes); e) alt-CDF or "redefined probe sets" for which all probes across the entire array that matched to a given cDNA clone insert were used to define a new derivative probe set.

    Techniques: Microarray

    Increased efficiency of breast cancer subtype classification transfer from cDNA microarray to Affymetrix HuFL gene-chip tumor-profiles by sequence-overlapping probe measurements. Tumor samples profiled on the Affymetrix platform were classified according to their correlation with the set of subtype median-centroids derived from cDNA microarray measurements (see methods). The classified samples were then hierarchically clustered using Pearson correlation and average-linkage agglomeration. Affymetrix measurements matched to cDNA centroids by sequence-overlap of probe features produced more coherent classifications than those obtained in the original transfer (Sørlie), specifically, more coherent Luminal A and ERBB2+ subtype clusters.

    Journal: BMC Bioinformatics

    Article Title: Redefinition of Affymetrix probe sets by sequence overlap with cDNA microarray probes reduces cross-platform inconsistencies in cancer-associated gene expression measurements

    doi: 10.1186/1471-2105-6-107

    Figure Lengend Snippet: Increased efficiency of breast cancer subtype classification transfer from cDNA microarray to Affymetrix HuFL gene-chip tumor-profiles by sequence-overlapping probe measurements. Tumor samples profiled on the Affymetrix platform were classified according to their correlation with the set of subtype median-centroids derived from cDNA microarray measurements (see methods). The classified samples were then hierarchically clustered using Pearson correlation and average-linkage agglomeration. Affymetrix measurements matched to cDNA centroids by sequence-overlap of probe features produced more coherent classifications than those obtained in the original transfer (Sørlie), specifically, more coherent Luminal A and ERBB2+ subtype clusters.

    Article Snippet: However, for a clear presentation of results we chose to compare the following classes representing different levels of shared identity: a) Affymetrix probe sets that share a Unigene ID with a cDNA clone. (termed Shared Unigene probes) b) Affymetrix probe sets containing probes that could be sequence-matched to the same transcript sequence as the cDNA clone, but for which no Affymetrix probe actually overlaps the cDNA clone sequence (termed Shared Transcript probes); c) Affymetrix probe sets with 1 to 10 probes sequence overlapping with the cDNA clone (termed Partially Overlapping probes); d) Affymetrix probe sets with 20 (i.e. all) probes sequence overlapping with the cDNA clone (termed Completely Overlapping probes); e) alt-CDF or "redefined probe sets" for which all probes across the entire array that matched to a given cDNA clone insert were used to define a new derivative probe set.

    Techniques: Microarray, Chromatin Immunoprecipitation, Sequencing, Derivative Assay, Produced

    Composition of redefined Affymetrix probe-sets based on overlap with cDNA clone insert sequence. Stacked histograms show the distribution of probe-set size for sets consisting of a single Affymetrix-defined probe-set (black) and for those comprised of probes originally grouped into separate probe-sets by Affymetrix (gray). A , NCI-60 10 k cDNA microarray to HuFL alternative CDF. B , Breast cancer 8 k cDNA microarray to HuFL alternative CDF. C , Breast cancer 8 k cDNA microarray to HG-U95Av2 alternative CDF. D , Lung cancer 22 k cDNA microarray to HG-U95Av2 alternative CDF.

    Journal: BMC Bioinformatics

    Article Title: Redefinition of Affymetrix probe sets by sequence overlap with cDNA microarray probes reduces cross-platform inconsistencies in cancer-associated gene expression measurements

    doi: 10.1186/1471-2105-6-107

    Figure Lengend Snippet: Composition of redefined Affymetrix probe-sets based on overlap with cDNA clone insert sequence. Stacked histograms show the distribution of probe-set size for sets consisting of a single Affymetrix-defined probe-set (black) and for those comprised of probes originally grouped into separate probe-sets by Affymetrix (gray). A , NCI-60 10 k cDNA microarray to HuFL alternative CDF. B , Breast cancer 8 k cDNA microarray to HuFL alternative CDF. C , Breast cancer 8 k cDNA microarray to HG-U95Av2 alternative CDF. D , Lung cancer 22 k cDNA microarray to HG-U95Av2 alternative CDF.

    Article Snippet: However, for a clear presentation of results we chose to compare the following classes representing different levels of shared identity: a) Affymetrix probe sets that share a Unigene ID with a cDNA clone. (termed Shared Unigene probes) b) Affymetrix probe sets containing probes that could be sequence-matched to the same transcript sequence as the cDNA clone, but for which no Affymetrix probe actually overlaps the cDNA clone sequence (termed Shared Transcript probes); c) Affymetrix probe sets with 1 to 10 probes sequence overlapping with the cDNA clone (termed Partially Overlapping probes); d) Affymetrix probe sets with 20 (i.e. all) probes sequence overlapping with the cDNA clone (termed Completely Overlapping probes); e) alt-CDF or "redefined probe sets" for which all probes across the entire array that matched to a given cDNA clone insert were used to define a new derivative probe set.

    Techniques: Sequencing, Microarray

    Relative expression of TREM-1 and DAP12 genes. THP-1 cells were exposed to bacteria at multiplicity of infection (MOI) of 10 or 100. After 4 and 24 h post exposure RNA was extracted, cDNA synthesized and the relative gene expression was determined by quantitative polymerase chain reaction, as described. (A) TREM-1 at 4 h; (B) TREM-1 at 24 h, (C) DAP12 at 4 h, (D) DAP12 at 24 h. Experiments were repeated three times. Data shown are mean ± SD of triplicates from a representative experiment. * P ≤ 0.05 compared with uninfected control.

    Journal: Molecular oral microbiology

    Article Title: Activation of the TREM-1 pathway in human monocytes by periodontal pathogens and oral commensal bacteria

    doi: 10.1111/omi.12169

    Figure Lengend Snippet: Relative expression of TREM-1 and DAP12 genes. THP-1 cells were exposed to bacteria at multiplicity of infection (MOI) of 10 or 100. After 4 and 24 h post exposure RNA was extracted, cDNA synthesized and the relative gene expression was determined by quantitative polymerase chain reaction, as described. (A) TREM-1 at 4 h; (B) TREM-1 at 24 h, (C) DAP12 at 4 h, (D) DAP12 at 24 h. Experiments were repeated three times. Data shown are mean ± SD of triplicates from a representative experiment. * P ≤ 0.05 compared with uninfected control.

    Article Snippet: Reverse transcription was performed using the High Capacity RNA-to-cDNA kit (Applied Biosystems, Foster City, CA) according to manufacturer’s instructions.

    Techniques: Expressing, Infection, Synthesized, Real-time Polymerase Chain Reaction

    Genomic structures of novel TUs . A. TU4. B. TU7. C. TU11. D. TU52. E. TU54. Initial paired-end ditag: dark blue. Exons of validated full-length cDNA sequences: orange. Exons of previously known transcripts at each locus: teal (protein-coding sequence: shaded). 3' terminal exon arrows: direction of transcription. Quantitative real-time PCR primer locations: red arrows. All validated cDNA sequences can be found in Additional file 2 .

    Journal: BMC Genomics

    Article Title: Detailed characterization of the mouse embryonic stem cell transcriptome reveals novel genes and intergenic splicing associated with pluripotency

    doi: 10.1186/1471-2164-9-155

    Figure Lengend Snippet: Genomic structures of novel TUs . A. TU4. B. TU7. C. TU11. D. TU52. E. TU54. Initial paired-end ditag: dark blue. Exons of validated full-length cDNA sequences: orange. Exons of previously known transcripts at each locus: teal (protein-coding sequence: shaded). 3' terminal exon arrows: direction of transcription. Quantitative real-time PCR primer locations: red arrows. All validated cDNA sequences can be found in Additional file 2 .

    Article Snippet: Quantitative Real-Time PCR cDNA synthesis of 2 μg total RNA was performed using High Capacity cDNA Archive Kit (Applied Biosystems) followed by ten-fold dilution of the product.

    Techniques: Sequencing, Real-time Polymerase Chain Reaction

    mtDNA increases SOCE and expression of Sphk1 in PMN. (A) Human PMN were treated with 20 µg/mL of E.coli DNA or mtDNA for 60 min then loaded with fura-2. Thapsigargin (1 µM) was applied to under nominally calcium-free conditions and then 1.8 mM extracellular calcium was applied at the indicated times. Calcium influx was calculated as described elsewhere [9] as the area under the curve for [Ca 2+ ] i (AUC) over 120 sec. Data were analyzed using medium-treated PMN as 100%. Mean and SE values are shown. At least 3 experiment were done per condition. * denotes a significant difference by student t-test (SigmaPlot 11) compared to time “0” value. Experiments were repeated at least three times. (7B) Freshly isolated human PMN (5 million cells in 2 mL) were incubated with medium, mtDNA (10 µg/mL), E.coli DNA (10 µg/mL), or LPS (100 ng/mL) for 60 min. Then RNA and cDNA were prepared using the RNesay mini kit (Qiagen) and SuperScript VILO cDNA Synthesis kit (Life technologies), respectively. 200 ng of cDNA per reaction was used for TaqMan qPCR assay for Sphk1 and GAPDH to evaluate expression levels. Sphk1 expression levels were then further normalized by GAPDH using the medium control result as 100%. Four different PMN preparations were used for stimulation and qPCR assays were done in triplicates. Mean and SE values from four different experiments are shown. Data were analyzed by One Way ANOVA. * denotes a significant difference between mtDNA treatment and the medium control (p

    Journal: PLoS ONE

    Article Title: Mitochondrial DAMPs Increase Endothelial Permeability through Neutrophil Dependent and Independent Pathways

    doi: 10.1371/journal.pone.0059989

    Figure Lengend Snippet: mtDNA increases SOCE and expression of Sphk1 in PMN. (A) Human PMN were treated with 20 µg/mL of E.coli DNA or mtDNA for 60 min then loaded with fura-2. Thapsigargin (1 µM) was applied to under nominally calcium-free conditions and then 1.8 mM extracellular calcium was applied at the indicated times. Calcium influx was calculated as described elsewhere [9] as the area under the curve for [Ca 2+ ] i (AUC) over 120 sec. Data were analyzed using medium-treated PMN as 100%. Mean and SE values are shown. At least 3 experiment were done per condition. * denotes a significant difference by student t-test (SigmaPlot 11) compared to time “0” value. Experiments were repeated at least three times. (7B) Freshly isolated human PMN (5 million cells in 2 mL) were incubated with medium, mtDNA (10 µg/mL), E.coli DNA (10 µg/mL), or LPS (100 ng/mL) for 60 min. Then RNA and cDNA were prepared using the RNesay mini kit (Qiagen) and SuperScript VILO cDNA Synthesis kit (Life technologies), respectively. 200 ng of cDNA per reaction was used for TaqMan qPCR assay for Sphk1 and GAPDH to evaluate expression levels. Sphk1 expression levels were then further normalized by GAPDH using the medium control result as 100%. Four different PMN preparations were used for stimulation and qPCR assays were done in triplicates. Mean and SE values from four different experiments are shown. Data were analyzed by One Way ANOVA. * denotes a significant difference between mtDNA treatment and the medium control (p

    Article Snippet: RNA and cDNA Preparation and Quantitative PCR RNA and cDNA were prepared using the RNesay mini kit (Qiagen, Valencia, CA) and the SuperScript VILO cDNA Synthesis kit (Life Technologies, Carlsbad, CA), respectively.

    Techniques: Expressing, Size-exclusion Chromatography, Isolation, Incubation, Real-time Polymerase Chain Reaction

    Expression levels of type I collagen, Smad2/3, and TGF-β1 genes after ES-P treatment in aged mice. (A) The left ears of fourteen-week old mice were treated daily with 30 μg T . spiralis ES-P for 14 days (red color). The right ears of were treated daily with PBS for 14 days as control (blue color). After 14 days, ears were collected. Total RNA was extracted from each ear tissue and cDNA was constructed. (B) The gene expression levels of collagen I , TGF-β1 , and Smad2/3 were analyzed by real-time PCR. The gene expression value of each group was normalized by control value, 14 weeks group. (**; P

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Identification of a host collagen inducing factor from the excretory secretory proteins of Trichinella spiralis

    doi: 10.1371/journal.pntd.0006516

    Figure Lengend Snippet: Expression levels of type I collagen, Smad2/3, and TGF-β1 genes after ES-P treatment in aged mice. (A) The left ears of fourteen-week old mice were treated daily with 30 μg T . spiralis ES-P for 14 days (red color). The right ears of were treated daily with PBS for 14 days as control (blue color). After 14 days, ears were collected. Total RNA was extracted from each ear tissue and cDNA was constructed. (B) The gene expression levels of collagen I , TGF-β1 , and Smad2/3 were analyzed by real-time PCR. The gene expression value of each group was normalized by control value, 14 weeks group. (**; P

    Article Snippet: Real-time PCR Homogenized ear tissues were mixed with TRIzol (Invitrogen, Germany), and total RNA extraction and cDNA synthesis (Invitrogen, Germany) was performed in accordance with the manufacturer’s protocols.

    Techniques: Expressing, Mouse Assay, Construct, Real-time Polymerase Chain Reaction

    Gene expression profiles in GANT61-treated SKOV3 cells. ( A ) Identification of differentially expressed genes (DEGs) in GANT61-treated SKOV3 cells. Cells were treated with GANT61 (20 µM) or DMSO for 60 hr, and total RNA was extracted as described in Methods . Changes in gene expression were determined by cDNA microarray gene profiling using the Illumina Human HT expression BeadChip V4 (Illumina Inc., San Diego, CA). Differential expressions for the DEGs are shown. ( B ) The top 11 canonical signaling pathways influenced by inhibition of Gli1/Gli2 function in SKOV3 cells. The top 11 canonical signaling pathways, determined by IPA, that were significantly up-regulated or down-regulated by GANT61 treatment in SKOV3 cells, are shown. The 412 DEGs were mapped to the IPA-defined network. The significant P -values that determine the probability that the association between the genes in the dataset and the canonical pathway is by chance alone were calculated by Fisher's exact test, and are expressed as −log ( P -value). ( C ) Heat map of DEGs in the focal adhesion signal pathway in GANT61-treated SKOV3 cells. The heat map shows that 17 genes were significantly differentially expressed, including seven up-regulated genes and 12 down-regulated genes, in the GANT61-treated compared to control SKOV3 cells. ( D ) Selected DEGs from cDNA array gene expression profiling analyzed by real-time PCR. SKOV3 cells were treated with DMSO or GANT61 for the indicated times, total RNA was extracted for real-time PCR as described in Methods using the primer sets in Table 1 . The data represent the mean ± SD of three determinations, and GAPDH was used to normalize the relative mRNA levels.

    Journal: PLoS ONE

    Article Title: Down-Regulation of Gli Transcription Factor Leads to the Inhibition of Migration and Invasion of Ovarian Cancer Cells via Integrin ?4-Mediated FAK Signaling

    doi: 10.1371/journal.pone.0088386

    Figure Lengend Snippet: Gene expression profiles in GANT61-treated SKOV3 cells. ( A ) Identification of differentially expressed genes (DEGs) in GANT61-treated SKOV3 cells. Cells were treated with GANT61 (20 µM) or DMSO for 60 hr, and total RNA was extracted as described in Methods . Changes in gene expression were determined by cDNA microarray gene profiling using the Illumina Human HT expression BeadChip V4 (Illumina Inc., San Diego, CA). Differential expressions for the DEGs are shown. ( B ) The top 11 canonical signaling pathways influenced by inhibition of Gli1/Gli2 function in SKOV3 cells. The top 11 canonical signaling pathways, determined by IPA, that were significantly up-regulated or down-regulated by GANT61 treatment in SKOV3 cells, are shown. The 412 DEGs were mapped to the IPA-defined network. The significant P -values that determine the probability that the association between the genes in the dataset and the canonical pathway is by chance alone were calculated by Fisher's exact test, and are expressed as −log ( P -value). ( C ) Heat map of DEGs in the focal adhesion signal pathway in GANT61-treated SKOV3 cells. The heat map shows that 17 genes were significantly differentially expressed, including seven up-regulated genes and 12 down-regulated genes, in the GANT61-treated compared to control SKOV3 cells. ( D ) Selected DEGs from cDNA array gene expression profiling analyzed by real-time PCR. SKOV3 cells were treated with DMSO or GANT61 for the indicated times, total RNA was extracted for real-time PCR as described in Methods using the primer sets in Table 1 . The data represent the mean ± SD of three determinations, and GAPDH was used to normalize the relative mRNA levels.

    Article Snippet: Real-time PCR Total RNA (1 µg) was employed to prepare cDNA via reverse transcription using cDNA synthesis kit (Invitrogen) according to manufacturer's instructions and analyzed using an Applied Biosystems 7500 PCR Detection System (Applied Biosystems Inc.).

    Techniques: Expressing, Microarray, Inhibition, Indirect Immunoperoxidase Assay, Real-time Polymerase Chain Reaction

    Differential expressions of genes modulating the mechanism of resistance to A. alternata in naturally infected mango fruits. (A) Effect of HWB on alternaria black spot (ABS) symptom development on mango cvs. Palmer, Kent, Tommy Atkins, Keitt, Lily and Shelly. (B) ABS symptom development on naturally infected fruits cv. Keitt following HWB treatment. (C) qRT-PCR differential expression profiling of genes Syn121 , glutardoxin , IT1K2 and AOS of cv. Shelly. Fruit peel tissues were sampled at four different time points after HWB treatment. RNA was extracted and served as a template for cDNA followed by qRT-PCR analysis of the genes of interest. Proportional increases in relative expression values were normalized against the samples of untreated mango fruits at 0 h. Expression data are means of two replicates. ABS-covered area was evaluated after 4 weeks of storage at 12°C. Average values followed by different letters differ significantly at P

    Journal: BMC Genomics

    Article Title: De-novo assembly of mango fruit peel transcriptome reveals mechanisms of mango response to hot water treatment

    doi: 10.1186/1471-2164-15-957

    Figure Lengend Snippet: Differential expressions of genes modulating the mechanism of resistance to A. alternata in naturally infected mango fruits. (A) Effect of HWB on alternaria black spot (ABS) symptom development on mango cvs. Palmer, Kent, Tommy Atkins, Keitt, Lily and Shelly. (B) ABS symptom development on naturally infected fruits cv. Keitt following HWB treatment. (C) qRT-PCR differential expression profiling of genes Syn121 , glutardoxin , IT1K2 and AOS of cv. Shelly. Fruit peel tissues were sampled at four different time points after HWB treatment. RNA was extracted and served as a template for cDNA followed by qRT-PCR analysis of the genes of interest. Proportional increases in relative expression values were normalized against the samples of untreated mango fruits at 0 h. Expression data are means of two replicates. ABS-covered area was evaluated after 4 weeks of storage at 12°C. Average values followed by different letters differ significantly at P

    Article Snippet: Analysis by qRT-PCR Single-stranded cDNA was synthesized from 1 μg of total RNA by means of the Verso cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA).

    Techniques: Infection, Quantitative RT-PCR, Expressing

    Adora2b -deficient mice have increased inflammation with impaired induction of Tregs after LPS-induced lung injury. LPS-induced inflammation was initiated in 9–12 wk-old male Adora2b +/+ (C57BL/6J) or age and weight matched Adora2b −/− mice by intratracheal instillation of LPS or saline. Bronchoalveolar lavage (BAL) fluids were collected 1 d post treatment. A) Leukocyte cell counts of BAL fluid were determined utilizing a cellometer (mean ± SEM, n = 2–4). B) Protein content of BAL fluid was determined with BCA assay. Fold increase of protein concentration in LPS treated BAL samples over respective saline BAL samples is displayed (mean ± SEM, n = 3–10). C) Analysis of cell infiltration into the lung airspace (BAL) of mice exposed to inhaled LPS. Mice ( Adora2b +/+ or Adora2b −/−) were exposed to nebulized saline or lipopolysaccharide (LPS); 24 hours post-exposure, mice were euthanized, and BAL was harvested. Cells were then subjected to flow cytometric analysis to identify neutrophils (highly granular, Gr1+ cells). D) Analysis of FoxP3 gene expression in lungs of mice exposed to inhaled LPS. Mice ( Adora2b +/+ or −/−) were exposed to nebulized saline or lipopolysaccharide (LPS); 24 hours post-exposure, mice were euthanized, and perfused lungs were harvested. Total RNA was harvested from lungs, cDNA prepared and analyzed by real-time PCR. Data depict mean (± SEM) fold changes in indicated genes. Fold change was calculated based on primer efficiencies, standardized to changes in actin, with Adora2b +/+ Saline mean value defined as 1. E) Fold change in cell number of either regulatory T cells (lymphocyte size, CD3+ CD4+ FoxP3+) in the lung airspace (BAL) of mice exposed to inhaled saline or LPS as above. Data are from 2–6 mice; 2 independent experiments. F) Relative abundance of CD4 effector T cells (Teffs, defined as lymphocyte size, CD3+ CD4+ CD44high cells) to Tregs based on cell counts from either Adora2b +/+ or Adora2b −/− mice, with pie charts depicting mean cell count for the indicated cell populations from 2–6 mice; 2 independent expts. Analysis of total cellular infiltration into airways and protein leakage (panels A–B) was done in animals treated with intratracheal LPS. Analysis of neutrophil infiltration and Tregs (panels C–F) was done in animals treated with inhaled LPS. Statistically significant differences are indicated and were calculated either by one-way ANOVA (A) or by unpaired t test (B–E) with a focus on whether Adora2b −/− LPS treated animals were statistically different from either saline treated or Adora2b +/+ LPS treated mice.

    Journal: PLoS ONE

    Article Title: Adora2b Adenosine Receptor Engagement Enhances Regulatory T Cell Abundance during Endotoxin-Induced Pulmonary Inflammation

    doi: 10.1371/journal.pone.0032416

    Figure Lengend Snippet: Adora2b -deficient mice have increased inflammation with impaired induction of Tregs after LPS-induced lung injury. LPS-induced inflammation was initiated in 9–12 wk-old male Adora2b +/+ (C57BL/6J) or age and weight matched Adora2b −/− mice by intratracheal instillation of LPS or saline. Bronchoalveolar lavage (BAL) fluids were collected 1 d post treatment. A) Leukocyte cell counts of BAL fluid were determined utilizing a cellometer (mean ± SEM, n = 2–4). B) Protein content of BAL fluid was determined with BCA assay. Fold increase of protein concentration in LPS treated BAL samples over respective saline BAL samples is displayed (mean ± SEM, n = 3–10). C) Analysis of cell infiltration into the lung airspace (BAL) of mice exposed to inhaled LPS. Mice ( Adora2b +/+ or Adora2b −/−) were exposed to nebulized saline or lipopolysaccharide (LPS); 24 hours post-exposure, mice were euthanized, and BAL was harvested. Cells were then subjected to flow cytometric analysis to identify neutrophils (highly granular, Gr1+ cells). D) Analysis of FoxP3 gene expression in lungs of mice exposed to inhaled LPS. Mice ( Adora2b +/+ or −/−) were exposed to nebulized saline or lipopolysaccharide (LPS); 24 hours post-exposure, mice were euthanized, and perfused lungs were harvested. Total RNA was harvested from lungs, cDNA prepared and analyzed by real-time PCR. Data depict mean (± SEM) fold changes in indicated genes. Fold change was calculated based on primer efficiencies, standardized to changes in actin, with Adora2b +/+ Saline mean value defined as 1. E) Fold change in cell number of either regulatory T cells (lymphocyte size, CD3+ CD4+ FoxP3+) in the lung airspace (BAL) of mice exposed to inhaled saline or LPS as above. Data are from 2–6 mice; 2 independent experiments. F) Relative abundance of CD4 effector T cells (Teffs, defined as lymphocyte size, CD3+ CD4+ CD44high cells) to Tregs based on cell counts from either Adora2b +/+ or Adora2b −/− mice, with pie charts depicting mean cell count for the indicated cell populations from 2–6 mice; 2 independent expts. Analysis of total cellular infiltration into airways and protein leakage (panels A–B) was done in animals treated with intratracheal LPS. Analysis of neutrophil infiltration and Tregs (panels C–F) was done in animals treated with inhaled LPS. Statistically significant differences are indicated and were calculated either by one-way ANOVA (A) or by unpaired t test (B–E) with a focus on whether Adora2b −/− LPS treated animals were statistically different from either saline treated or Adora2b +/+ LPS treated mice.

    Article Snippet: RNA isolation and Real-time PCR Total RNA was extracted from cells or tissue by Trizol, followed by cDNA synthesis using iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc, Munich, Germany) according to the manufacturer's instructions.

    Techniques: Mouse Assay, BIA-KA, Protein Concentration, Flow Cytometry, Expressing, Real-time Polymerase Chain Reaction, Cell Counting

    Morphological Phenotypes of Transgenic Plants Expressing Wild-Type or Mutant PHS1 Transgenes. Seedlings were grown for 7 d on a vertically placed agar plate with or without 3 μM propyzamide in the medium. Root epidermal cells are shown on the right side of each seedling picture. Bar in seedling view = 1 cm; bar in magnified root view = 100 μm. (A) phs1-1 seedlings transformed with a wild-type genomic clone of PHS1 . (B) Wild-type seedlings transformed with a PHS1 genomic clone containing the R64C mutation. (C) Wild-type seedlings transformed with the R64C mutant PHS1 cDNA under the control of the CaMV35S promoter.

    Journal: The Plant Cell

    Article Title: A Semidominant Mutation in an Arabidopsis Mitogen-Activated Protein Kinase Phosphatase-Like Gene Compromises Cortical Microtubule Organization W⃞

    doi: 10.1105/tpc.021865

    Figure Lengend Snippet: Morphological Phenotypes of Transgenic Plants Expressing Wild-Type or Mutant PHS1 Transgenes. Seedlings were grown for 7 d on a vertically placed agar plate with or without 3 μM propyzamide in the medium. Root epidermal cells are shown on the right side of each seedling picture. Bar in seedling view = 1 cm; bar in magnified root view = 100 μm. (A) phs1-1 seedlings transformed with a wild-type genomic clone of PHS1 . (B) Wild-type seedlings transformed with a PHS1 genomic clone containing the R64C mutation. (C) Wild-type seedlings transformed with the R64C mutant PHS1 cDNA under the control of the CaMV35S promoter.

    Article Snippet: Because publicly available cDNA clones lacked a part of the 5′ region, the missing N-terminal part of PHS1 was obtained by the method of 5′-rapid amplification of cDNA ends (5′-RACE) using the 5′-RACE system, version 2.0 (Gibco BRL, Cleveland, OH).

    Techniques: Transgenic Assay, Expressing, Mutagenesis, Transformation Assay

    VICKZ1 mediates Integrin α6 expression and co-immunoprecipitates with Integrin α6 mRNA. 2-4ss embryos were electroporated with control-GFP (A), full length VICKZ1- GFP (B), or Y396F-GFP (C), and then fixed and stained for Integrin α6 (red) and GFP (green) 10 hours later. In control-GFP transfected embryos, Integrin α6 is down-regulated in the dorsal aspect of the tube in the region where CNC delaminate, on both the transfected and non-transfected sides (A, inset 1 and 2). Overexpression of VICKZ1 maintains Integrin α6 expression even in the most dorsal regions of the tube, but only on the transfected side (B, inset 1), and not on the non-transfected side (B, inset 2). Y396F expression causes a precocious emigration of CNC and down-regulation of Integrin α6 in more lateral regions of the tube, only on the transfected side (C, inset 1) and not on the non-transected side (C, inset 2). All insets show only the red channel (ITGA6). Arrows in insets indicate areas of downregulation of ITGA6. (D) RNP complexes were prepared from 3d and 4d old chick embryos and immunoprecipitated with either pre-immune serum or pan-VICKZ antibody. Equal volumes of total lysates (Total) and immunoprecipitates (IP) were subjected to western blot analysis using the pan-VICKZ antibody. VICKZ protein is pulled down exclusively by the pan-VICKZ antibody. (E) Quantitative RT-PCR analysis was performed on cDNAs prepared from both pre-immune and pan-VICKZ immunoprecipitations and tested for the presence of ITGA6 mRNA. Values of pan-VICKZ IP mRNA were normalized to the amounts of total mRNA, and compared to the pre-immune normalized values (pan-VICKZ/pre-immune). A 15–16 fold enrichment of ITGA6 mRNA is observed in the pan-VICKZ IP, as compared to the pre-immune serum. A control RNA, 18S, shows only 1–2 fold enrichment when analysed in the same way. The data show the mean±SEM.

    Journal: PLoS ONE

    Article Title: A Novel Role for VICKZ Proteins in Maintaining Epithelial Integrity during Embryogenesis

    doi: 10.1371/journal.pone.0136408

    Figure Lengend Snippet: VICKZ1 mediates Integrin α6 expression and co-immunoprecipitates with Integrin α6 mRNA. 2-4ss embryos were electroporated with control-GFP (A), full length VICKZ1- GFP (B), or Y396F-GFP (C), and then fixed and stained for Integrin α6 (red) and GFP (green) 10 hours later. In control-GFP transfected embryos, Integrin α6 is down-regulated in the dorsal aspect of the tube in the region where CNC delaminate, on both the transfected and non-transfected sides (A, inset 1 and 2). Overexpression of VICKZ1 maintains Integrin α6 expression even in the most dorsal regions of the tube, but only on the transfected side (B, inset 1), and not on the non-transfected side (B, inset 2). Y396F expression causes a precocious emigration of CNC and down-regulation of Integrin α6 in more lateral regions of the tube, only on the transfected side (C, inset 1) and not on the non-transected side (C, inset 2). All insets show only the red channel (ITGA6). Arrows in insets indicate areas of downregulation of ITGA6. (D) RNP complexes were prepared from 3d and 4d old chick embryos and immunoprecipitated with either pre-immune serum or pan-VICKZ antibody. Equal volumes of total lysates (Total) and immunoprecipitates (IP) were subjected to western blot analysis using the pan-VICKZ antibody. VICKZ protein is pulled down exclusively by the pan-VICKZ antibody. (E) Quantitative RT-PCR analysis was performed on cDNAs prepared from both pre-immune and pan-VICKZ immunoprecipitations and tested for the presence of ITGA6 mRNA. Values of pan-VICKZ IP mRNA were normalized to the amounts of total mRNA, and compared to the pre-immune normalized values (pan-VICKZ/pre-immune). A 15–16 fold enrichment of ITGA6 mRNA is observed in the pan-VICKZ IP, as compared to the pre-immune serum. A control RNA, 18S, shows only 1–2 fold enrichment when analysed in the same way. The data show the mean±SEM.

    Article Snippet: Total and IP’d RNAs were isolated using the EZ-RNA Isolation Kit (Biological Industries) and reverse-transcribed with random primers using the ImPromII Reverse Transcription System (Promega) in 20ul reactions. cDNAs were analyzed by quantitative PCR reaction using the iQ SYBR Green Supermix and the iCycler system (Bio-Rad).

    Techniques: Expressing, Staining, Transfection, Over Expression, Immunoprecipitation, Western Blot, Quantitative RT-PCR