cdna library construction Illumina Inc Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Illumina Inc cdna library construction
    Non-stranded versus stranded <t>RNA-seq</t> protocol. The stranded protocol differs from the non-stranded protocol in two ways. First, during <t>cDNA</t> synthesis, the second-strand synthesis continues as normal except the nucleotide mix includes dUTPs instead of dTTPs. Second, after library preparation, a second-strand digestion step is added. This step ensures that only the first strand survives the subsequent PCR amplification step and hence the strand information of the libraries
    Cdna Library Construction, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 95/100, based on 7120 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna library construction/product/Illumina Inc
    Average 95 stars, based on 7120 article reviews
    Price from $9.99 to $1999.99
    cdna library construction - by Bioz Stars, 2020-09
    95/100 stars
      Buy from Supplier

    95
    Illumina Inc rna seq libraries
    Effect of SMG6 or UPF1 depletion on the concentration of the full-length TCRβ68 transcript and its 3′-terminal SMG6 cleavage product. HeLa cells that expressed a TCRβ68 transcript harboring a PTC at codon 68 (TCRβ68) or a wild-type TCRβ transcript lacking a PTC (TCRβwt) were transfected with siRNAs directed against XRN1, SMG6 or UPF1, or with siGL2 (negative control). Total <t>RNA</t> extracted from these cells was used to prepare <t>PARE</t> libraries. (A) Detection of both a full-length transcript (TCRβ68 FL) and a 3′-terminal decay intermediate (TCRβ68 3′) by northern blot analysis. As a control, some cells were transfected with an siRNA-resistant SMG6 gene (SMG6 R ) or a catalytically inactive variant thereof (SMG6 R -mut). In each case, the concentration of the full-length transcript relative to that in mock-transfected cells was calculated after normalization to GAPDH mRNA (internal standard). (B) D-plots for the TCRβ68 reporter identifying monophosphorylated 5′ ends detected by PARE in cells transfected with siXRN1 and either siGL2, siSMG6 or siUPF1. A map of the TCRβ68 transcript is shown above the D-plots. Alternating gray and white zones indicate exons. AUG, translation initiation codon; PTC, premature termination codon; TC, natural termination codon. Because the 5′-terminal portion of the reporter was derived from the human β-actin gene, TCRβ68-derived PARE sequences there cannot be distinguished from those originating from the endogenous β-actin transcript. Transcript positions represent the distance from the first nucleotide unique to the TCRβ68 reporter. (C) High-resolution D-plot identifying 5′ ends detected by PARE in RNA from cells transfected with siGL2 and siXRN1. Gray rectangle, PTC.
    Rna Seq Libraries, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 95/100, based on 14994 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna seq libraries/product/Illumina Inc
    Average 95 stars, based on 14994 article reviews
    Price from $9.99 to $1999.99
    rna seq libraries - by Bioz Stars, 2020-09
    95/100 stars
      Buy from Supplier

    99
    Illumina Inc truseq rna sample preparation kit
    Improved comparability across degradation effects and library preparation methods. ( a ) Correlation of unnormalized reads from normally processed iPSC <t>RNA</t> (HICL) and in-process degraded iPSC RNA (HICL_D). Reads for 51,552 loci over the read cutoff of 40 were plotted. ( b ) Correlation of SNV-normalized reads from the HICL and HICL_D samples. ( c ) Agreement of estimates for gene expression in HICL and HICL_D samples estimated by unnormalized reads and SNV-normalized reads. ( d ) Correlation of unnormalized reads generated by <t>TruSeq</t> method (HICL) and NexTera method (HICL_N). Reads for 53,585 loci were plotted. ( e ) Correlation of SNV-normalized reads from the HICL and HICL_N samples. ( f ) Agreement of estimates for gene expression in HICL and HICL_N samples estimated by unnormalized reads and SNV-normalized reads.
    Truseq Rna Sample Preparation Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 10957 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truseq rna sample preparation kit/product/Illumina Inc
    Average 99 stars, based on 10957 article reviews
    Price from $9.99 to $1999.99
    truseq rna sample preparation kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    Illumina Inc truseq rna sample prep kit
    Improved comparability across degradation effects and library preparation methods. ( a ) Correlation of unnormalized reads from normally processed iPSC <t>RNA</t> (HICL) and in-process degraded iPSC RNA (HICL_D). Reads for 51,552 loci over the read cutoff of 40 were plotted. ( b ) Correlation of SNV-normalized reads from the HICL and HICL_D samples. ( c ) Agreement of estimates for gene expression in HICL and HICL_D samples estimated by unnormalized reads and SNV-normalized reads. ( d ) Correlation of unnormalized reads generated by <t>TruSeq</t> method (HICL) and NexTera method (HICL_N). Reads for 53,585 loci were plotted. ( e ) Correlation of SNV-normalized reads from the HICL and HICL_N samples. ( f ) Agreement of estimates for gene expression in HICL and HICL_N samples estimated by unnormalized reads and SNV-normalized reads.
    Truseq Rna Sample Prep Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 5059 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truseq rna sample prep kit/product/Illumina Inc
    Average 94 stars, based on 5059 article reviews
    Price from $9.99 to $1999.99
    truseq rna sample prep kit - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    99
    Illumina Inc truseq rna
    Experimental pipeline of SUPeR-seq, and its sensitivity at the whole-transcriptome scale. a The schematic of SUPeR-seq analysis. A single cell is lysed to release RNAs. RNAs are then reverse transcribed into first-strand cDNAs using random primers with a fixed anchor sequence (AnchorX-T 15 N 6 ). Unreacted primers are then digested using ExoSAP-IT, followed by adding poly(A) tails to the 3′ ends of the first-strand cDNAs using dATP doped with 1 % ddATP to restrict the length of poly(A) tails. Second-strand cDNAs are synthesized using poly(T) primers with a different anchor sequence (AnchorY-T 24 ). Then the double-stranded cDNAs are evenly amplified by PCR using AnchorX-T 15 and AnchorY-T 24 primers. Finally the purified single cell cDNAs are used to prepare sequencing libraries following Illumina’s <t>TruSeq</t> DNA sample preparation protocols. b Detection sensitivity of SUPeR-seq on poly(A)- genes in individual cells. We identified 696 poly(A)- genes by bulk <t>RNA</t> sequencing, of which around 30 % could be recovered in a single cell by SUPeR-seq (for details, see Additional file 3 ). When merged the SUPeR-seq data of the seven single cell samples together, over 50 % of these 696 genes could be successfully recovered by SUPeR-seq in at least one cell. c The number of genes detected from individual and bulk HEK293T cells using different protocols. SUPeR-seq detected 10,911 genes on average from an individual cell with FPKM ≥1(Fragments Per Kilobase of exon model per Million mapped reads), 19.3 % more than the Tang2009 protocol did (9148 genes on average). For comparison, 14,931 genes were detected with FPKM ≥1 in the four rRNA-depleted total RNA samples from bulk HEK293T cells, and 15,535 genes were detected in the four oligo(dT)-enriched total RNA samples from bulk HEK293T cells
    Truseq Rna, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 6460 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truseq rna/product/Illumina Inc
    Average 99 stars, based on 6460 article reviews
    Price from $9.99 to $1999.99
    truseq rna - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Illumina Inc nextera xt dna library preparation kit
    NGS-library preparation using the homemade Tn5 constructs. (A) Workflow of Tn5 loading, cDNA tagmentation, and subsequent NGS library preparation for duplex index (Illumina i5/i7) full-length cDNA sequencing. Tn5 molecules are shown as gray hexamers. The double-stranded part of the linker oligonucleotide, the mosaic element, is shown in gray with a yellow circle depicting the phosphorylated 3′ end. The 5′ overhangs as templates for the i5 or i7 index adapter primers are shown in red or blue, respectively. cDNA is shown as two parallel black lines with a 3′ poly(A) tail. The synthesis of the 5′ overhang complementary strand (gap-filling step during PCR amplification) is depicted as a dotted arrow. i5 index adapter primer is shown in dark blue, while i7 index adapter primer is shown in orange. Fragments that are lost during library preparation are transparent. (B) Bioanalyzer traces of NGS libraries processed with different concentrations of the in-house-produced Tn5 R27S,E54K,L372P using only homemade or inexpensive commercially available reagents for tagmentation and subsequent PCR reaction. Following the tagmentation protocol presented here, fragmentation of the cDNA works best when using Tn5 R27S,E54K,L372P at a concentration of 30 ng/μl. (C) Heat scatter plot showing the correlation of read counts between libraries processed with either in-house-produced Tn5 E54K,L372P or Tn5 R27S,E54K,L372P . Data of three technical replicates per condition were pooled for this analysis. (D) Heat scatter plot showing the correlation of gene counts between libraries processed using either in-house-produced Tn5 R27S,E54K,L372P and the protocol presented here or the <t>Nextera</t> XT <t>DNA</t> library preparation kit following the manufacturer’s instructions. Data of three technical replicates per condition were pooled for this analysis. (E) Pairwise correlation of read counts between three technical replicates (samples processed from the same cDNA on the same day) when using homemade Tn5 R27S,E54K,L372P and the tagmentation protocol presented here. The Pearson correlation of r = 0.99 between all samples demonstrates high reproducibility of both the enzyme and the protocol. (F) Heat map analysis of gene counts in technical replicates processed from the same cDNA but on different days. The color code indicates the Pearson correlation between samples (see legend on the right side). NGS, next-generation sequencing; PCR, polymerase chain reaction; SDS, sodium dodecyl sulfate.
    Nextera Xt Dna Library Preparation Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 5201 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nextera xt dna library preparation kit/product/Illumina Inc
    Average 99 stars, based on 5201 article reviews
    Price from $9.99 to $1999.99
    nextera xt dna library preparation kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Illumina Inc illumina truseq rna
    Experimental pipeline of SUPeR-seq, and its sensitivity at the whole-transcriptome scale. a The schematic of SUPeR-seq analysis. A single cell is lysed to release RNAs. RNAs are then reverse transcribed into first-strand cDNAs using random primers with a fixed anchor sequence (AnchorX-T 15 N 6 ). Unreacted primers are then digested using ExoSAP-IT, followed by adding poly(A) tails to the 3′ ends of the first-strand cDNAs using dATP doped with 1 % ddATP to restrict the length of poly(A) tails. Second-strand cDNAs are synthesized using poly(T) primers with a different anchor sequence (AnchorY-T 24 ). Then the double-stranded cDNAs are evenly amplified by PCR using AnchorX-T 15 and AnchorY-T 24 primers. Finally the purified single cell cDNAs are used to prepare sequencing libraries following <t>Illumina’s</t> <t>TruSeq</t> DNA sample preparation protocols. b Detection sensitivity of SUPeR-seq on poly(A)- genes in individual cells. We identified 696 poly(A)- genes by bulk <t>RNA</t> sequencing, of which around 30 % could be recovered in a single cell by SUPeR-seq (for details, see Additional file 3 ). When merged the SUPeR-seq data of the seven single cell samples together, over 50 % of these 696 genes could be successfully recovered by SUPeR-seq in at least one cell. c The number of genes detected from individual and bulk HEK293T cells using different protocols. SUPeR-seq detected 10,911 genes on average from an individual cell with FPKM ≥1(Fragments Per Kilobase of exon model per Million mapped reads), 19.3 % more than the Tang2009 protocol did (9148 genes on average). For comparison, 14,931 genes were detected with FPKM ≥1 in the four rRNA-depleted total RNA samples from bulk HEK293T cells, and 15,535 genes were detected in the four oligo(dT)-enriched total RNA samples from bulk HEK293T cells
    Illumina Truseq Rna, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 3919 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina truseq rna/product/Illumina Inc
    Average 99 stars, based on 3919 article reviews
    Price from $9.99 to $1999.99
    illumina truseq rna - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Illumina Inc nextera xt dna sample preparation kit
    Experimental pipeline of SUPeR-seq, and its sensitivity at the whole-transcriptome scale. a The schematic of SUPeR-seq analysis. A single cell is lysed to release RNAs. RNAs are then reverse transcribed into first-strand cDNAs using random primers with a fixed anchor sequence (AnchorX-T 15 N 6 ). Unreacted primers are then digested using ExoSAP-IT, followed by adding poly(A) tails to the 3′ ends of the first-strand cDNAs using dATP doped with 1 % ddATP to restrict the length of poly(A) tails. Second-strand cDNAs are synthesized using poly(T) primers with a different anchor sequence (AnchorY-T 24 ). Then the double-stranded cDNAs are evenly amplified by PCR using AnchorX-T 15 and AnchorY-T 24 primers. Finally the purified single cell cDNAs are used to prepare sequencing libraries following <t>Illumina’s</t> <t>TruSeq</t> DNA sample preparation protocols. b Detection sensitivity of SUPeR-seq on poly(A)- genes in individual cells. We identified 696 poly(A)- genes by bulk <t>RNA</t> sequencing, of which around 30 % could be recovered in a single cell by SUPeR-seq (for details, see Additional file 3 ). When merged the SUPeR-seq data of the seven single cell samples together, over 50 % of these 696 genes could be successfully recovered by SUPeR-seq in at least one cell. c The number of genes detected from individual and bulk HEK293T cells using different protocols. SUPeR-seq detected 10,911 genes on average from an individual cell with FPKM ≥1(Fragments Per Kilobase of exon model per Million mapped reads), 19.3 % more than the Tang2009 protocol did (9148 genes on average). For comparison, 14,931 genes were detected with FPKM ≥1 in the four rRNA-depleted total RNA samples from bulk HEK293T cells, and 15,535 genes were detected in the four oligo(dT)-enriched total RNA samples from bulk HEK293T cells
    Nextera Xt Dna Sample Preparation Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 3963 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nextera xt dna sample preparation kit/product/Illumina Inc
    Average 99 stars, based on 3963 article reviews
    Price from $9.99 to $1999.99
    nextera xt dna sample preparation kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    94
    Illumina Inc sequencing total rna
    Experimental pipeline of SUPeR-seq, and its sensitivity at the whole-transcriptome scale. a The schematic of SUPeR-seq analysis. A single cell is lysed to release RNAs. RNAs are then reverse transcribed into first-strand cDNAs using random primers with a fixed anchor sequence (AnchorX-T 15 N 6 ). Unreacted primers are then digested using ExoSAP-IT, followed by adding poly(A) tails to the 3′ ends of the first-strand cDNAs using dATP doped with 1 % ddATP to restrict the length of poly(A) tails. Second-strand cDNAs are synthesized using poly(T) primers with a different anchor sequence (AnchorY-T 24 ). Then the double-stranded cDNAs are evenly amplified by PCR using AnchorX-T 15 and AnchorY-T 24 primers. Finally the purified single cell cDNAs are used to prepare sequencing libraries following <t>Illumina’s</t> <t>TruSeq</t> DNA sample preparation protocols. b Detection sensitivity of SUPeR-seq on poly(A)- genes in individual cells. We identified 696 poly(A)- genes by bulk <t>RNA</t> sequencing, of which around 30 % could be recovered in a single cell by SUPeR-seq (for details, see Additional file 3 ). When merged the SUPeR-seq data of the seven single cell samples together, over 50 % of these 696 genes could be successfully recovered by SUPeR-seq in at least one cell. c The number of genes detected from individual and bulk HEK293T cells using different protocols. SUPeR-seq detected 10,911 genes on average from an individual cell with FPKM ≥1(Fragments Per Kilobase of exon model per Million mapped reads), 19.3 % more than the Tang2009 protocol did (9148 genes on average). For comparison, 14,931 genes were detected with FPKM ≥1 in the four rRNA-depleted total RNA samples from bulk HEK293T cells, and 15,535 genes were detected in the four oligo(dT)-enriched total RNA samples from bulk HEK293T cells
    Sequencing Total Rna, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 1859 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sequencing total rna/product/Illumina Inc
    Average 94 stars, based on 1859 article reviews
    Price from $9.99 to $1999.99
    sequencing total rna - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    99
    Illumina Inc truseq dna sample preparation kit
    Experimental pipeline of SUPeR-seq, and its sensitivity at the whole-transcriptome scale. a The schematic of SUPeR-seq analysis. A single cell is lysed to release RNAs. RNAs are then reverse transcribed into first-strand cDNAs using random primers with a fixed anchor sequence (AnchorX-T 15 N 6 ). Unreacted primers are then digested using ExoSAP-IT, followed by adding poly(A) tails to the 3′ ends of the first-strand cDNAs using dATP doped with 1 % ddATP to restrict the length of poly(A) tails. Second-strand cDNAs are synthesized using poly(T) primers with a different anchor sequence (AnchorY-T 24 ). Then the double-stranded cDNAs are evenly amplified by PCR using AnchorX-T 15 and AnchorY-T 24 primers. Finally the purified single cell cDNAs are used to prepare sequencing libraries following <t>Illumina’s</t> <t>TruSeq</t> DNA sample preparation protocols. b Detection sensitivity of SUPeR-seq on poly(A)- genes in individual cells. We identified 696 poly(A)- genes by bulk <t>RNA</t> sequencing, of which around 30 % could be recovered in a single cell by SUPeR-seq (for details, see Additional file 3 ). When merged the SUPeR-seq data of the seven single cell samples together, over 50 % of these 696 genes could be successfully recovered by SUPeR-seq in at least one cell. c The number of genes detected from individual and bulk HEK293T cells using different protocols. SUPeR-seq detected 10,911 genes on average from an individual cell with FPKM ≥1(Fragments Per Kilobase of exon model per Million mapped reads), 19.3 % more than the Tang2009 protocol did (9148 genes on average). For comparison, 14,931 genes were detected with FPKM ≥1 in the four rRNA-depleted total RNA samples from bulk HEK293T cells, and 15,535 genes were detected in the four oligo(dT)-enriched total RNA samples from bulk HEK293T cells
    Truseq Dna Sample Preparation Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 2226 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truseq dna sample preparation kit/product/Illumina Inc
    Average 99 stars, based on 2226 article reviews
    Price from $9.99 to $1999.99
    truseq dna sample preparation kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    Illumina Inc truseq dna
    Experimental pipeline of SUPeR-seq, and its sensitivity at the whole-transcriptome scale. a The schematic of SUPeR-seq analysis. A single cell is lysed to release RNAs. RNAs are then reverse transcribed into first-strand cDNAs using random primers with a fixed anchor sequence (AnchorX-T 15 N 6 ). Unreacted primers are then digested using ExoSAP-IT, followed by adding poly(A) tails to the 3′ ends of the first-strand cDNAs using dATP doped with 1 % ddATP to restrict the length of poly(A) tails. Second-strand cDNAs are synthesized using poly(T) primers with a different anchor sequence (AnchorY-T 24 ). Then the double-stranded cDNAs are evenly amplified by PCR using AnchorX-T 15 and AnchorY-T 24 primers. Finally the purified single cell cDNAs are used to prepare sequencing libraries following <t>Illumina’s</t> <t>TruSeq</t> DNA sample preparation protocols. b Detection sensitivity of SUPeR-seq on poly(A)- genes in individual cells. We identified 696 poly(A)- genes by bulk <t>RNA</t> sequencing, of which around 30 % could be recovered in a single cell by SUPeR-seq (for details, see Additional file 3 ). When merged the SUPeR-seq data of the seven single cell samples together, over 50 % of these 696 genes could be successfully recovered by SUPeR-seq in at least one cell. c The number of genes detected from individual and bulk HEK293T cells using different protocols. SUPeR-seq detected 10,911 genes on average from an individual cell with FPKM ≥1(Fragments Per Kilobase of exon model per Million mapped reads), 19.3 % more than the Tang2009 protocol did (9148 genes on average). For comparison, 14,931 genes were detected with FPKM ≥1 in the four rRNA-depleted total RNA samples from bulk HEK293T cells, and 15,535 genes were detected in the four oligo(dT)-enriched total RNA samples from bulk HEK293T cells
    Truseq Dna, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 2818 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truseq dna/product/Illumina Inc
    Average 99 stars, based on 2818 article reviews
    Price from $9.99 to $1999.99
    truseq dna - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    91
    Illumina Inc truseq nano dna library prep kit
    Experimental pipeline of SUPeR-seq, and its sensitivity at the whole-transcriptome scale. a The schematic of SUPeR-seq analysis. A single cell is lysed to release RNAs. RNAs are then reverse transcribed into first-strand cDNAs using random primers with a fixed anchor sequence (AnchorX-T 15 N 6 ). Unreacted primers are then digested using ExoSAP-IT, followed by adding poly(A) tails to the 3′ ends of the first-strand cDNAs using dATP doped with 1 % ddATP to restrict the length of poly(A) tails. Second-strand cDNAs are synthesized using poly(T) primers with a different anchor sequence (AnchorY-T 24 ). Then the double-stranded cDNAs are evenly amplified by PCR using AnchorX-T 15 and AnchorY-T 24 primers. Finally the purified single cell cDNAs are used to prepare sequencing libraries following <t>Illumina’s</t> <t>TruSeq</t> DNA sample preparation protocols. b Detection sensitivity of SUPeR-seq on poly(A)- genes in individual cells. We identified 696 poly(A)- genes by bulk <t>RNA</t> sequencing, of which around 30 % could be recovered in a single cell by SUPeR-seq (for details, see Additional file 3 ). When merged the SUPeR-seq data of the seven single cell samples together, over 50 % of these 696 genes could be successfully recovered by SUPeR-seq in at least one cell. c The number of genes detected from individual and bulk HEK293T cells using different protocols. SUPeR-seq detected 10,911 genes on average from an individual cell with FPKM ≥1(Fragments Per Kilobase of exon model per Million mapped reads), 19.3 % more than the Tang2009 protocol did (9148 genes on average). For comparison, 14,931 genes were detected with FPKM ≥1 in the four rRNA-depleted total RNA samples from bulk HEK293T cells, and 15,535 genes were detected in the four oligo(dT)-enriched total RNA samples from bulk HEK293T cells
    Truseq Nano Dna Library Prep Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 91/100, based on 737 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truseq nano dna library prep kit/product/Illumina Inc
    Average 91 stars, based on 737 article reviews
    Price from $9.99 to $1999.99
    truseq nano dna library prep kit - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    92
    Illumina Inc nextera xt dna library prep kit
    Experimental pipeline of SUPeR-seq, and its sensitivity at the whole-transcriptome scale. a The schematic of SUPeR-seq analysis. A single cell is lysed to release RNAs. RNAs are then reverse transcribed into first-strand cDNAs using random primers with a fixed anchor sequence (AnchorX-T 15 N 6 ). Unreacted primers are then digested using ExoSAP-IT, followed by adding poly(A) tails to the 3′ ends of the first-strand cDNAs using dATP doped with 1 % ddATP to restrict the length of poly(A) tails. Second-strand cDNAs are synthesized using poly(T) primers with a different anchor sequence (AnchorY-T 24 ). Then the double-stranded cDNAs are evenly amplified by PCR using AnchorX-T 15 and AnchorY-T 24 primers. Finally the purified single cell cDNAs are used to prepare sequencing libraries following <t>Illumina’s</t> <t>TruSeq</t> DNA sample preparation protocols. b Detection sensitivity of SUPeR-seq on poly(A)- genes in individual cells. We identified 696 poly(A)- genes by bulk <t>RNA</t> sequencing, of which around 30 % could be recovered in a single cell by SUPeR-seq (for details, see Additional file 3 ). When merged the SUPeR-seq data of the seven single cell samples together, over 50 % of these 696 genes could be successfully recovered by SUPeR-seq in at least one cell. c The number of genes detected from individual and bulk HEK293T cells using different protocols. SUPeR-seq detected 10,911 genes on average from an individual cell with FPKM ≥1(Fragments Per Kilobase of exon model per Million mapped reads), 19.3 % more than the Tang2009 protocol did (9148 genes on average). For comparison, 14,931 genes were detected with FPKM ≥1 in the four rRNA-depleted total RNA samples from bulk HEK293T cells, and 15,535 genes were detected in the four oligo(dT)-enriched total RNA samples from bulk HEK293T cells
    Nextera Xt Dna Library Prep Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 1714 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nextera xt dna library prep kit/product/Illumina Inc
    Average 92 stars, based on 1714 article reviews
    Price from $9.99 to $1999.99
    nextera xt dna library prep kit - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    99
    Illumina Inc truseq dna pcr free library preparation kit
    Transgenic position of epidermal growth factor ( EGF ) locus on the rice chromosome 4 and polymerase chain reaction <t>(PCR)</t> test to identify <t>T-DNA</t> junction sequence. (A) The EGF is inserted on the position 31,104,341 of the chromosome 4. (B) The bold with underline is T-DNA sequence of the vector 2,026-2,223 bp and the next bases is rice transgenic locus chromosome 4 (31107341-31107690) in the fragment amplified by PCR test primer1 (5' TACCTGCATGCTGCGGTGAAG 3') and primer2 (5'AGGGCTGTGTAGAAGTACTCGC 3').
    Truseq Dna Pcr Free Library Preparation Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 809 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truseq dna pcr free library preparation kit/product/Illumina Inc
    Average 99 stars, based on 809 article reviews
    Price from $9.99 to $1999.99
    truseq dna pcr free library preparation kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Non-stranded versus stranded RNA-seq protocol. The stranded protocol differs from the non-stranded protocol in two ways. First, during cDNA synthesis, the second-strand synthesis continues as normal except the nucleotide mix includes dUTPs instead of dTTPs. Second, after library preparation, a second-strand digestion step is added. This step ensures that only the first strand survives the subsequent PCR amplification step and hence the strand information of the libraries

    Journal: BMC Genomics

    Article Title: Comparison of stranded and non-stranded RNA-seq transcriptome profiling and investigation of gene overlap

    doi: 10.1186/s12864-015-1876-7

    Figure Lengend Snippet: Non-stranded versus stranded RNA-seq protocol. The stranded protocol differs from the non-stranded protocol in two ways. First, during cDNA synthesis, the second-strand synthesis continues as normal except the nucleotide mix includes dUTPs instead of dTTPs. Second, after library preparation, a second-strand digestion step is added. This step ensures that only the first strand survives the subsequent PCR amplification step and hence the strand information of the libraries

    Article Snippet: cDNA library construction and sequencing For stranded RNA-seq, cDNA libraries were prepared with a TruSeq stranded mRNA library prep Kit (cat# RS-122-2101, Illumina, San Diego, CA , USA).

    Techniques: RNA Sequencing Assay, Polymerase Chain Reaction, Amplification

    Sequence features and validation of circRNAs in M. oryzae . ( a ) Venn diagram showing the number of tissue-preferentially expressed circRNAs in mycelium and conidium of M.oryzae . ( b ) Distribution of circRNAs in genome region of M. oryzae . ( c ) Length distribution of circRNAs. ( d ) An example of M. oryzae circRNAs (mor_circ_04492) shows the validation strategy. Divergent and convergent primers were designed to detect circular RNAs. Sanger sequencing was performed to confirm head-to-tail backsplicing. ( e ) Experimental validation of M. oryzae circRNAs. Divergent primers successfully amplified circRNAs in cDNA but failed in genomic DNA. Amplification for sequence of actin gene was used as a control. The gels were cropped from the same gel, and the full-length gel was supported in Fig. S2 .

    Journal: Scientific Reports

    Article Title: Genome-wide Identification and characterization of circular RNAs in the rice blast fungus Magnaporthe oryzae

    doi: 10.1038/s41598-018-25242-w

    Figure Lengend Snippet: Sequence features and validation of circRNAs in M. oryzae . ( a ) Venn diagram showing the number of tissue-preferentially expressed circRNAs in mycelium and conidium of M.oryzae . ( b ) Distribution of circRNAs in genome region of M. oryzae . ( c ) Length distribution of circRNAs. ( d ) An example of M. oryzae circRNAs (mor_circ_04492) shows the validation strategy. Divergent and convergent primers were designed to detect circular RNAs. Sanger sequencing was performed to confirm head-to-tail backsplicing. ( e ) Experimental validation of M. oryzae circRNAs. Divergent primers successfully amplified circRNAs in cDNA but failed in genomic DNA. Amplification for sequence of actin gene was used as a control. The gels were cropped from the same gel, and the full-length gel was supported in Fig. S2 .

    Article Snippet: By using an mRNA-Seq sample preparation kit (Illumina, San Diego, USA), the remaining RNAs were used to construct cDNA libraries, which were subsequently used to perform circRNA sequencing by an Illumina Hiseq2500 platform.

    Techniques: Sequencing, Amplification

    Effect of SMG6 or UPF1 depletion on the concentration of the full-length TCRβ68 transcript and its 3′-terminal SMG6 cleavage product. HeLa cells that expressed a TCRβ68 transcript harboring a PTC at codon 68 (TCRβ68) or a wild-type TCRβ transcript lacking a PTC (TCRβwt) were transfected with siRNAs directed against XRN1, SMG6 or UPF1, or with siGL2 (negative control). Total RNA extracted from these cells was used to prepare PARE libraries. (A) Detection of both a full-length transcript (TCRβ68 FL) and a 3′-terminal decay intermediate (TCRβ68 3′) by northern blot analysis. As a control, some cells were transfected with an siRNA-resistant SMG6 gene (SMG6 R ) or a catalytically inactive variant thereof (SMG6 R -mut). In each case, the concentration of the full-length transcript relative to that in mock-transfected cells was calculated after normalization to GAPDH mRNA (internal standard). (B) D-plots for the TCRβ68 reporter identifying monophosphorylated 5′ ends detected by PARE in cells transfected with siXRN1 and either siGL2, siSMG6 or siUPF1. A map of the TCRβ68 transcript is shown above the D-plots. Alternating gray and white zones indicate exons. AUG, translation initiation codon; PTC, premature termination codon; TC, natural termination codon. Because the 5′-terminal portion of the reporter was derived from the human β-actin gene, TCRβ68-derived PARE sequences there cannot be distinguished from those originating from the endogenous β-actin transcript. Transcript positions represent the distance from the first nucleotide unique to the TCRβ68 reporter. (C) High-resolution D-plot identifying 5′ ends detected by PARE in RNA from cells transfected with siGL2 and siXRN1. Gray rectangle, PTC.

    Journal: Nucleic Acids Research

    Article Title: Identification of SMG6 cleavage sites and a preferred RNA cleavage motif by global analysis of endogenous NMD targets in human cells

    doi: 10.1093/nar/gku1258

    Figure Lengend Snippet: Effect of SMG6 or UPF1 depletion on the concentration of the full-length TCRβ68 transcript and its 3′-terminal SMG6 cleavage product. HeLa cells that expressed a TCRβ68 transcript harboring a PTC at codon 68 (TCRβ68) or a wild-type TCRβ transcript lacking a PTC (TCRβwt) were transfected with siRNAs directed against XRN1, SMG6 or UPF1, or with siGL2 (negative control). Total RNA extracted from these cells was used to prepare PARE libraries. (A) Detection of both a full-length transcript (TCRβ68 FL) and a 3′-terminal decay intermediate (TCRβ68 3′) by northern blot analysis. As a control, some cells were transfected with an siRNA-resistant SMG6 gene (SMG6 R ) or a catalytically inactive variant thereof (SMG6 R -mut). In each case, the concentration of the full-length transcript relative to that in mock-transfected cells was calculated after normalization to GAPDH mRNA (internal standard). (B) D-plots for the TCRβ68 reporter identifying monophosphorylated 5′ ends detected by PARE in cells transfected with siXRN1 and either siGL2, siSMG6 or siUPF1. A map of the TCRβ68 transcript is shown above the D-plots. Alternating gray and white zones indicate exons. AUG, translation initiation codon; PTC, premature termination codon; TC, natural termination codon. Because the 5′-terminal portion of the reporter was derived from the human β-actin gene, TCRβ68-derived PARE sequences there cannot be distinguished from those originating from the endogenous β-actin transcript. Transcript positions represent the distance from the first nucleotide unique to the TCRβ68 reporter. (C) High-resolution D-plot identifying 5′ ends detected by PARE in RNA from cells transfected with siGL2 and siXRN1. Gray rectangle, PTC.

    Article Snippet: Construction of PARE, C-PARE, SPARE and RNA-Seq libraries PARE libraries were constructed as previously described ( , ) modified for the Illumina HiSeq platform ( ).

    Techniques: Concentration Assay, Transfection, Negative Control, Northern Blot, Variant Assay, Derivative Assay

    Schematic diagrams for PARE, C-PARE and SPARE library construction. (A) PARE, (B) C-PARE and (C) SPARE libraries were constructed from poly(A) + RNA in multiple steps (red, green or blue arrows). The procedures used to construct all of the libraries are shown in bold lettering, while those used to construct specific libraries are shown in regular lettering. 5′ m7 Gppp, capped 5′ end; 5′ P monophosphorylated 5′ end; 5′ OH, hydroxylated 5′ end; (A) n , polyadenylated 3′ end.

    Journal: Nucleic Acids Research

    Article Title: Identification of SMG6 cleavage sites and a preferred RNA cleavage motif by global analysis of endogenous NMD targets in human cells

    doi: 10.1093/nar/gku1258

    Figure Lengend Snippet: Schematic diagrams for PARE, C-PARE and SPARE library construction. (A) PARE, (B) C-PARE and (C) SPARE libraries were constructed from poly(A) + RNA in multiple steps (red, green or blue arrows). The procedures used to construct all of the libraries are shown in bold lettering, while those used to construct specific libraries are shown in regular lettering. 5′ m7 Gppp, capped 5′ end; 5′ P monophosphorylated 5′ end; 5′ OH, hydroxylated 5′ end; (A) n , polyadenylated 3′ end.

    Article Snippet: Construction of PARE, C-PARE, SPARE and RNA-Seq libraries PARE libraries were constructed as previously described ( , ) modified for the Illumina HiSeq platform ( ).

    Techniques: Construct

    Recurrent LACTB2 - NCOA2 fusion in colorectal cancer (CRC). ( a ) Structural variations (SVs) in the tumor tissue of a CRC case were illustrated as a Circos plot with red and blue lines indicating inter-chromosomal and intra-chromosomal SVs, respectively. ( b ) The DNA and RNA structures of the LACTB2 - NCOA2 fusion were illustrated. RT–PCR (M: size marker; N: normal cDNA; T: CRC cDNA) and Sanger sequencing confirmed the tumor-specific occurrence of LACTB2 - NCOA2 fusion. ( c ) The LACTB2 - NCOA2 fusion transcript with the same breakpoints was present in 6 out of 99 (6.1%) CRC cDNA samples as confirmed by RT–PCR and Sanger sequencing (chromatogram).

    Journal: Oncogene

    Article Title: Disruption of NCOA2 by recurrent fusion with LACTB2 in colorectal cancer

    doi: 10.1038/onc.2015.72

    Figure Lengend Snippet: Recurrent LACTB2 - NCOA2 fusion in colorectal cancer (CRC). ( a ) Structural variations (SVs) in the tumor tissue of a CRC case were illustrated as a Circos plot with red and blue lines indicating inter-chromosomal and intra-chromosomal SVs, respectively. ( b ) The DNA and RNA structures of the LACTB2 - NCOA2 fusion were illustrated. RT–PCR (M: size marker; N: normal cDNA; T: CRC cDNA) and Sanger sequencing confirmed the tumor-specific occurrence of LACTB2 - NCOA2 fusion. ( c ) The LACTB2 - NCOA2 fusion transcript with the same breakpoints was present in 6 out of 99 (6.1%) CRC cDNA samples as confirmed by RT–PCR and Sanger sequencing (chromatogram).

    Article Snippet: Poly-A-containing mRNA purification, double-stranded cDNA synthesis, end repair, 3' end adenylation, adapter ligation and enrichment of DNA fragments for RNA-Seq library construction were performed using the reagents provided in the Illumina TruSeq RNA Sample Preparation Kit (Illumina, San Diego, CA, USA).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Marker, Sequencing

    Mitochondrial BER deficient mice do not accumulate point mutations of mtRNA even in the presence of increased oxidative stress. ( A ) Mutation load of mtRNA from Sod2 loxP x Ckmm cre mice from heart. Illumina sequencing was carried out from total RNA considering only the reads that map to mtDNA for variant calling. Data is quality filtered. For the unique mutation load each specific mutation is counted only once, reflecting how many times a mutation has occurred. For the total mutation load each mutation is counted as many times as it is seen, reflecting the clonal expansion of mutations. Mutation profile of mtRNA from Sod2 loxP x Ckmm cre mice from heart. White circles indicate samples from controls (+p n = 1 pp n = 2, 10–11 week old) and gray circles indicate samples from Sod2 loxP x Ckmm cre mice (pp, cre n = 3, 10–11 week old). ( B ) Mutation load of mtRNA from Sod2 loxP x Ckmm cre x Ogg1 dMTS mice from heart. Illumina sequencing was carried out from total RNA considering only the reads that map to mtDNA for variant calling. Data is quality filtered. Mutation profile of mtRNA from Sod2 loxP x Ckmm cre x Ogg1 dMTS mice from heart. White circles indicate samples from Sod2 loxP x Ogg1 dMTS mice (pp dd n = 4, 9–10 week old) and gray circles indicate samples from Sod2 loxP x Ckmm cre x Ogg1 dMTS mice (pp, cre dd, n = 4, 9–10 week old). * P

    Journal: Nucleic Acids Research

    Article Title: Base-excision repair deficiency alone or combined with increased oxidative stress does not increase mtDNA point mutations in mice

    doi: 10.1093/nar/gky456

    Figure Lengend Snippet: Mitochondrial BER deficient mice do not accumulate point mutations of mtRNA even in the presence of increased oxidative stress. ( A ) Mutation load of mtRNA from Sod2 loxP x Ckmm cre mice from heart. Illumina sequencing was carried out from total RNA considering only the reads that map to mtDNA for variant calling. Data is quality filtered. For the unique mutation load each specific mutation is counted only once, reflecting how many times a mutation has occurred. For the total mutation load each mutation is counted as many times as it is seen, reflecting the clonal expansion of mutations. Mutation profile of mtRNA from Sod2 loxP x Ckmm cre mice from heart. White circles indicate samples from controls (+p n = 1 pp n = 2, 10–11 week old) and gray circles indicate samples from Sod2 loxP x Ckmm cre mice (pp, cre n = 3, 10–11 week old). ( B ) Mutation load of mtRNA from Sod2 loxP x Ckmm cre x Ogg1 dMTS mice from heart. Illumina sequencing was carried out from total RNA considering only the reads that map to mtDNA for variant calling. Data is quality filtered. Mutation profile of mtRNA from Sod2 loxP x Ckmm cre x Ogg1 dMTS mice from heart. White circles indicate samples from Sod2 loxP x Ogg1 dMTS mice (pp dd n = 4, 9–10 week old) and gray circles indicate samples from Sod2 loxP x Ckmm cre x Ogg1 dMTS mice (pp, cre dd, n = 4, 9–10 week old). * P

    Article Snippet: DNA and RNA library construction and Illumina sequencing were performed at the Max Plank-Genome-centre Cologne.

    Techniques: Mouse Assay, Mutagenesis, Sequencing, Variant Assay

    The expression of GAPDH in the four adipose tissues detected by RT-qPCR and RNA-seq. Note: ATFB: adipose tissues of fetal bovines; ATAB: adipose tissues of adult bulls; ATAS: adipose tissues of adult steers; ATAH: adipose tissues of adult heifers. *: P

    Journal: PLoS ONE

    Article Title: Characterization of Transcriptional Complexity during Adipose Tissue Development in Bovines of Different Ages and Sexes

    doi: 10.1371/journal.pone.0101261

    Figure Lengend Snippet: The expression of GAPDH in the four adipose tissues detected by RT-qPCR and RNA-seq. Note: ATFB: adipose tissues of fetal bovines; ATAB: adipose tissues of adult bulls; ATAS: adipose tissues of adult steers; ATAH: adipose tissues of adult heifers. *: P

    Article Snippet: RNA sequencing of bovine subcutaneous adipose tissues To obtain a global view of the bovine adipose tissue transcriptome, total RNA from the subcutaneous adipose tissues of fetal bovines, adult bulls, adult heifers and adult steers (ATFB, ATAB, ATAH and ATAS) were used to construct RNA libraries for Illumina sequencing.

    Techniques: Expressing, Quantitative RT-PCR, RNA Sequencing Assay

    Improved comparability across degradation effects and library preparation methods. ( a ) Correlation of unnormalized reads from normally processed iPSC RNA (HICL) and in-process degraded iPSC RNA (HICL_D). Reads for 51,552 loci over the read cutoff of 40 were plotted. ( b ) Correlation of SNV-normalized reads from the HICL and HICL_D samples. ( c ) Agreement of estimates for gene expression in HICL and HICL_D samples estimated by unnormalized reads and SNV-normalized reads. ( d ) Correlation of unnormalized reads generated by TruSeq method (HICL) and NexTera method (HICL_N). Reads for 53,585 loci were plotted. ( e ) Correlation of SNV-normalized reads from the HICL and HICL_N samples. ( f ) Agreement of estimates for gene expression in HICL and HICL_N samples estimated by unnormalized reads and SNV-normalized reads.

    Journal: Scientific Reports

    Article Title: Normalization of human RNA-seq experiments using chimpanzee RNA as a spike-in standard

    doi: 10.1038/srep31923

    Figure Lengend Snippet: Improved comparability across degradation effects and library preparation methods. ( a ) Correlation of unnormalized reads from normally processed iPSC RNA (HICL) and in-process degraded iPSC RNA (HICL_D). Reads for 51,552 loci over the read cutoff of 40 were plotted. ( b ) Correlation of SNV-normalized reads from the HICL and HICL_D samples. ( c ) Agreement of estimates for gene expression in HICL and HICL_D samples estimated by unnormalized reads and SNV-normalized reads. ( d ) Correlation of unnormalized reads generated by TruSeq method (HICL) and NexTera method (HICL_N). Reads for 53,585 loci were plotted. ( e ) Correlation of SNV-normalized reads from the HICL and HICL_N samples. ( f ) Agreement of estimates for gene expression in HICL and HICL_N samples estimated by unnormalized reads and SNV-normalized reads.

    Article Snippet: Preparation of NGS library Normal NGS library was constructed using TruSeq RNA Sample Preparation Kit v2 (Illumina) following the manufacturer’s instruction starting from 2 μg of total RNA.

    Techniques: Expressing, Generated

    Hierarchical clustering of expression levels, based on the rank of the count of exon per million mapped reads (CPM). Dendrogram represents Spearman correlation coefficients between pairs of samples. NEB: NEBNext® Ultra™, NuG: NuGEN Ovation®, SMTer: SMARTer® Stranded; Tru4: TruSeq using 4 ng of RNA; Tru70: TruSe q using 70 ng of RNA. SMTseq4: SMART-Seq® v4 using 4 ng of RNA; SMTseq0.25: SMART-Seq® v4 using 250 pg of RNA. Yellow and orange: SMTseq samples; Red: SMTer samples; Black: NEB samples; Blue: NuGEN samples; Green and grey: TruSeq samples.. Color scale: Spearman correlation coefficients

    Journal: BMC Genomics

    Article Title: A comparative analysis of library prep approaches for sequencing low input translatome samples

    doi: 10.1186/s12864-018-5066-2

    Figure Lengend Snippet: Hierarchical clustering of expression levels, based on the rank of the count of exon per million mapped reads (CPM). Dendrogram represents Spearman correlation coefficients between pairs of samples. NEB: NEBNext® Ultra™, NuG: NuGEN Ovation®, SMTer: SMARTer® Stranded; Tru4: TruSeq using 4 ng of RNA; Tru70: TruSe q using 70 ng of RNA. SMTseq4: SMART-Seq® v4 using 4 ng of RNA; SMTseq0.25: SMART-Seq® v4 using 250 pg of RNA. Yellow and orange: SMTseq samples; Red: SMTer samples; Black: NEB samples; Blue: NuGEN samples; Green and grey: TruSeq samples.. Color scale: Spearman correlation coefficients

    Article Snippet: We performed a hybrid library preparation by using Ovation® RNA-Seq System V2 (NuGEN, San Carlos, CA, USA) to synthesize cDNA and the TruSeq RNA Library Preparation Kit v2 to construct the sequencing library (Illumina, San Diego, CA, USA), consistent with the NuGEN manufacturer protocol (See Additional file : Table S1).

    Techniques: Expressing

    Hierarchical clustering based on the rank of IP/input value. Dendrogram represents Spearman correlation coefficients between pairs of samples. NEB: NEBNext® Ultra™, NuG: NuGEN Ovation®, SMTer: SMARTer® Stranded; Tru4: TruSeq using 4 ng of RNA; Tru70: TruSeq using 70 ng of RNA. SMTseq4: SMART-Seq® v4 using 4 ng of RNA; SMTseq0.25: SMART-Seq® v4 using 250 pg of RNA. Yellow and orange: SMTseq samples; Red: SMTer samples; Black: NEB samples; Blue: NuGEN samples; Green and grey: TruSeq samples

    Journal: BMC Genomics

    Article Title: A comparative analysis of library prep approaches for sequencing low input translatome samples

    doi: 10.1186/s12864-018-5066-2

    Figure Lengend Snippet: Hierarchical clustering based on the rank of IP/input value. Dendrogram represents Spearman correlation coefficients between pairs of samples. NEB: NEBNext® Ultra™, NuG: NuGEN Ovation®, SMTer: SMARTer® Stranded; Tru4: TruSeq using 4 ng of RNA; Tru70: TruSeq using 70 ng of RNA. SMTseq4: SMART-Seq® v4 using 4 ng of RNA; SMTseq0.25: SMART-Seq® v4 using 250 pg of RNA. Yellow and orange: SMTseq samples; Red: SMTer samples; Black: NEB samples; Blue: NuGEN samples; Green and grey: TruSeq samples

    Article Snippet: We performed a hybrid library preparation by using Ovation® RNA-Seq System V2 (NuGEN, San Carlos, CA, USA) to synthesize cDNA and the TruSeq RNA Library Preparation Kit v2 to construct the sequencing library (Illumina, San Diego, CA, USA), consistent with the NuGEN manufacturer protocol (See Additional file : Table S1).

    Techniques:

    Descriptive characteristic of enrichment or depletion profiles as generated by the different library preparation kits. Genes which have at least 20 raw reads in the input samples and a ratio of IP/Input ≥2 or Input/IP ≥2 were used to generate the plots. a Total number of transcripts enriched or depleted. b Percentage of enriched or depleted transcripts grouped into different bins. X-axis: log2(IP/input), Y-axis: percentage of genes in each bin over whole population. NEB: NEBNext® Ultra™, NuG: NuGEN Ovation®, SMTer: SMARTer® Stranded; Tru4: TruSeq using 4 ng of RNA; Tru70: TruSeq using 70 ng of RNA. SMTseq4: SMART-Seq® v4 using 4 ng of RNA; SMTseq0.25: SMART-Seq® v4 using 250 pg of RNA. Yellow and orange: SMTseq samples; Red: SMTer samples; Black: NEB samples; Blue: NuGEN samples; Green and grey: TruSeq samples

    Journal: BMC Genomics

    Article Title: A comparative analysis of library prep approaches for sequencing low input translatome samples

    doi: 10.1186/s12864-018-5066-2

    Figure Lengend Snippet: Descriptive characteristic of enrichment or depletion profiles as generated by the different library preparation kits. Genes which have at least 20 raw reads in the input samples and a ratio of IP/Input ≥2 or Input/IP ≥2 were used to generate the plots. a Total number of transcripts enriched or depleted. b Percentage of enriched or depleted transcripts grouped into different bins. X-axis: log2(IP/input), Y-axis: percentage of genes in each bin over whole population. NEB: NEBNext® Ultra™, NuG: NuGEN Ovation®, SMTer: SMARTer® Stranded; Tru4: TruSeq using 4 ng of RNA; Tru70: TruSeq using 70 ng of RNA. SMTseq4: SMART-Seq® v4 using 4 ng of RNA; SMTseq0.25: SMART-Seq® v4 using 250 pg of RNA. Yellow and orange: SMTseq samples; Red: SMTer samples; Black: NEB samples; Blue: NuGEN samples; Green and grey: TruSeq samples

    Article Snippet: We performed a hybrid library preparation by using Ovation® RNA-Seq System V2 (NuGEN, San Carlos, CA, USA) to synthesize cDNA and the TruSeq RNA Library Preparation Kit v2 to construct the sequencing library (Illumina, San Diego, CA, USA), consistent with the NuGEN manufacturer protocol (See Additional file : Table S1).

    Techniques: Generated

    Enrichment profiles and top 50 enriched transcripts. a Enrichment factor of transcripts are sorted in decreasing order based on log2 (IP/input). X-axis:transcripts, Y-axis:log2 value of enrichment (IP/Input). b Boxplot of top 50 enriched transcripts. NEB: NEBNext® Ultra™, NuG: NuGEN Ovation®, SMTer: SMARTer® Stranded; Tru4: TruSeq using 4 ng of RNA; Tru70: TruSeq using 70 ng of RNA. SMTseq4: SMART-Seq® v4 using 4 ng of RNA; SMTseq0.25: SMART-Seq® v4 using 250 pg of RNA. Yellow and orange: SMTseq samples; Red: SMTer samples; Black: NEB samples; Blue: NuGEN samples; Green and grey: TruSeq samples

    Journal: BMC Genomics

    Article Title: A comparative analysis of library prep approaches for sequencing low input translatome samples

    doi: 10.1186/s12864-018-5066-2

    Figure Lengend Snippet: Enrichment profiles and top 50 enriched transcripts. a Enrichment factor of transcripts are sorted in decreasing order based on log2 (IP/input). X-axis:transcripts, Y-axis:log2 value of enrichment (IP/Input). b Boxplot of top 50 enriched transcripts. NEB: NEBNext® Ultra™, NuG: NuGEN Ovation®, SMTer: SMARTer® Stranded; Tru4: TruSeq using 4 ng of RNA; Tru70: TruSeq using 70 ng of RNA. SMTseq4: SMART-Seq® v4 using 4 ng of RNA; SMTseq0.25: SMART-Seq® v4 using 250 pg of RNA. Yellow and orange: SMTseq samples; Red: SMTer samples; Black: NEB samples; Blue: NuGEN samples; Green and grey: TruSeq samples

    Article Snippet: We performed a hybrid library preparation by using Ovation® RNA-Seq System V2 (NuGEN, San Carlos, CA, USA) to synthesize cDNA and the TruSeq RNA Library Preparation Kit v2 to construct the sequencing library (Illumina, San Diego, CA, USA), consistent with the NuGEN manufacturer protocol (See Additional file : Table S1).

    Techniques:

    Distribution of normalized mean expression of the first (last) 100 bases of transcripts (in 5′- > 3′-orientation). X axis represents the 5′-3′ normalized position; Y axis represents normalized coverage. NEB: NEBNext® Ultra™, NuG: NuGEN Ovation®, SMTer: SMARTer® Stranded; Tru4: TruSeq using 4 ng of RNA; Tru70: TruSeq using 70 ng of RNA. SMTseq4: SMART-Seq® v4 using 4 ng of RNA; SMTseq0.25: SMART-Seq® v4 using 250 pg of RNA. Yellow and orange: SMTseq samples; Red: SMTer samples; Black: NEB samples; Blue: NuG samples; Green and grey: TruSeq samples. Solid: Input samples. Dotted: Ribo-IP samples

    Journal: BMC Genomics

    Article Title: A comparative analysis of library prep approaches for sequencing low input translatome samples

    doi: 10.1186/s12864-018-5066-2

    Figure Lengend Snippet: Distribution of normalized mean expression of the first (last) 100 bases of transcripts (in 5′- > 3′-orientation). X axis represents the 5′-3′ normalized position; Y axis represents normalized coverage. NEB: NEBNext® Ultra™, NuG: NuGEN Ovation®, SMTer: SMARTer® Stranded; Tru4: TruSeq using 4 ng of RNA; Tru70: TruSeq using 70 ng of RNA. SMTseq4: SMART-Seq® v4 using 4 ng of RNA; SMTseq0.25: SMART-Seq® v4 using 250 pg of RNA. Yellow and orange: SMTseq samples; Red: SMTer samples; Black: NEB samples; Blue: NuG samples; Green and grey: TruSeq samples. Solid: Input samples. Dotted: Ribo-IP samples

    Article Snippet: We performed a hybrid library preparation by using Ovation® RNA-Seq System V2 (NuGEN, San Carlos, CA, USA) to synthesize cDNA and the TruSeq RNA Library Preparation Kit v2 to construct the sequencing library (Illumina, San Diego, CA, USA), consistent with the NuGEN manufacturer protocol (See Additional file : Table S1).

    Techniques: Expressing

    Experimental pipeline of SUPeR-seq, and its sensitivity at the whole-transcriptome scale. a The schematic of SUPeR-seq analysis. A single cell is lysed to release RNAs. RNAs are then reverse transcribed into first-strand cDNAs using random primers with a fixed anchor sequence (AnchorX-T 15 N 6 ). Unreacted primers are then digested using ExoSAP-IT, followed by adding poly(A) tails to the 3′ ends of the first-strand cDNAs using dATP doped with 1 % ddATP to restrict the length of poly(A) tails. Second-strand cDNAs are synthesized using poly(T) primers with a different anchor sequence (AnchorY-T 24 ). Then the double-stranded cDNAs are evenly amplified by PCR using AnchorX-T 15 and AnchorY-T 24 primers. Finally the purified single cell cDNAs are used to prepare sequencing libraries following Illumina’s TruSeq DNA sample preparation protocols. b Detection sensitivity of SUPeR-seq on poly(A)- genes in individual cells. We identified 696 poly(A)- genes by bulk RNA sequencing, of which around 30 % could be recovered in a single cell by SUPeR-seq (for details, see Additional file 3 ). When merged the SUPeR-seq data of the seven single cell samples together, over 50 % of these 696 genes could be successfully recovered by SUPeR-seq in at least one cell. c The number of genes detected from individual and bulk HEK293T cells using different protocols. SUPeR-seq detected 10,911 genes on average from an individual cell with FPKM ≥1(Fragments Per Kilobase of exon model per Million mapped reads), 19.3 % more than the Tang2009 protocol did (9148 genes on average). For comparison, 14,931 genes were detected with FPKM ≥1 in the four rRNA-depleted total RNA samples from bulk HEK293T cells, and 15,535 genes were detected in the four oligo(dT)-enriched total RNA samples from bulk HEK293T cells

    Journal: Genome Biology

    Article Title: Single-cell RNA-seq transcriptome analysis of linear and circular RNAs in mouse preimplantation embryos

    doi: 10.1186/s13059-015-0706-1

    Figure Lengend Snippet: Experimental pipeline of SUPeR-seq, and its sensitivity at the whole-transcriptome scale. a The schematic of SUPeR-seq analysis. A single cell is lysed to release RNAs. RNAs are then reverse transcribed into first-strand cDNAs using random primers with a fixed anchor sequence (AnchorX-T 15 N 6 ). Unreacted primers are then digested using ExoSAP-IT, followed by adding poly(A) tails to the 3′ ends of the first-strand cDNAs using dATP doped with 1 % ddATP to restrict the length of poly(A) tails. Second-strand cDNAs are synthesized using poly(T) primers with a different anchor sequence (AnchorY-T 24 ). Then the double-stranded cDNAs are evenly amplified by PCR using AnchorX-T 15 and AnchorY-T 24 primers. Finally the purified single cell cDNAs are used to prepare sequencing libraries following Illumina’s TruSeq DNA sample preparation protocols. b Detection sensitivity of SUPeR-seq on poly(A)- genes in individual cells. We identified 696 poly(A)- genes by bulk RNA sequencing, of which around 30 % could be recovered in a single cell by SUPeR-seq (for details, see Additional file 3 ). When merged the SUPeR-seq data of the seven single cell samples together, over 50 % of these 696 genes could be successfully recovered by SUPeR-seq in at least one cell. c The number of genes detected from individual and bulk HEK293T cells using different protocols. SUPeR-seq detected 10,911 genes on average from an individual cell with FPKM ≥1(Fragments Per Kilobase of exon model per Million mapped reads), 19.3 % more than the Tang2009 protocol did (9148 genes on average). For comparison, 14,931 genes were detected with FPKM ≥1 in the four rRNA-depleted total RNA samples from bulk HEK293T cells, and 15,535 genes were detected in the four oligo(dT)-enriched total RNA samples from bulk HEK293T cells

    Article Snippet: Sequencing library generation for bulk amount of mouse ES cell RNA and HEK293T cell RNA Total RNA (1 μg) was used for deep-sequencing library construction following the instructions of the TruSeq RNA sample preparation kit (Illumina).

    Techniques: Sequencing, Synthesized, Amplification, Polymerase Chain Reaction, Purification, Sample Prep, RNA Sequencing Assay

    NGS-library preparation using the homemade Tn5 constructs. (A) Workflow of Tn5 loading, cDNA tagmentation, and subsequent NGS library preparation for duplex index (Illumina i5/i7) full-length cDNA sequencing. Tn5 molecules are shown as gray hexamers. The double-stranded part of the linker oligonucleotide, the mosaic element, is shown in gray with a yellow circle depicting the phosphorylated 3′ end. The 5′ overhangs as templates for the i5 or i7 index adapter primers are shown in red or blue, respectively. cDNA is shown as two parallel black lines with a 3′ poly(A) tail. The synthesis of the 5′ overhang complementary strand (gap-filling step during PCR amplification) is depicted as a dotted arrow. i5 index adapter primer is shown in dark blue, while i7 index adapter primer is shown in orange. Fragments that are lost during library preparation are transparent. (B) Bioanalyzer traces of NGS libraries processed with different concentrations of the in-house-produced Tn5 R27S,E54K,L372P using only homemade or inexpensive commercially available reagents for tagmentation and subsequent PCR reaction. Following the tagmentation protocol presented here, fragmentation of the cDNA works best when using Tn5 R27S,E54K,L372P at a concentration of 30 ng/μl. (C) Heat scatter plot showing the correlation of read counts between libraries processed with either in-house-produced Tn5 E54K,L372P or Tn5 R27S,E54K,L372P . Data of three technical replicates per condition were pooled for this analysis. (D) Heat scatter plot showing the correlation of gene counts between libraries processed using either in-house-produced Tn5 R27S,E54K,L372P and the protocol presented here or the Nextera XT DNA library preparation kit following the manufacturer’s instructions. Data of three technical replicates per condition were pooled for this analysis. (E) Pairwise correlation of read counts between three technical replicates (samples processed from the same cDNA on the same day) when using homemade Tn5 R27S,E54K,L372P and the tagmentation protocol presented here. The Pearson correlation of r = 0.99 between all samples demonstrates high reproducibility of both the enzyme and the protocol. (F) Heat map analysis of gene counts in technical replicates processed from the same cDNA but on different days. The color code indicates the Pearson correlation between samples (see legend on the right side). NGS, next-generation sequencing; PCR, polymerase chain reaction; SDS, sodium dodecyl sulfate.

    Journal: G3: Genes|Genomes|Genetics

    Article Title: Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol

    doi: 10.1534/g3.117.300257

    Figure Lengend Snippet: NGS-library preparation using the homemade Tn5 constructs. (A) Workflow of Tn5 loading, cDNA tagmentation, and subsequent NGS library preparation for duplex index (Illumina i5/i7) full-length cDNA sequencing. Tn5 molecules are shown as gray hexamers. The double-stranded part of the linker oligonucleotide, the mosaic element, is shown in gray with a yellow circle depicting the phosphorylated 3′ end. The 5′ overhangs as templates for the i5 or i7 index adapter primers are shown in red or blue, respectively. cDNA is shown as two parallel black lines with a 3′ poly(A) tail. The synthesis of the 5′ overhang complementary strand (gap-filling step during PCR amplification) is depicted as a dotted arrow. i5 index adapter primer is shown in dark blue, while i7 index adapter primer is shown in orange. Fragments that are lost during library preparation are transparent. (B) Bioanalyzer traces of NGS libraries processed with different concentrations of the in-house-produced Tn5 R27S,E54K,L372P using only homemade or inexpensive commercially available reagents for tagmentation and subsequent PCR reaction. Following the tagmentation protocol presented here, fragmentation of the cDNA works best when using Tn5 R27S,E54K,L372P at a concentration of 30 ng/μl. (C) Heat scatter plot showing the correlation of read counts between libraries processed with either in-house-produced Tn5 E54K,L372P or Tn5 R27S,E54K,L372P . Data of three technical replicates per condition were pooled for this analysis. (D) Heat scatter plot showing the correlation of gene counts between libraries processed using either in-house-produced Tn5 R27S,E54K,L372P and the protocol presented here or the Nextera XT DNA library preparation kit following the manufacturer’s instructions. Data of three technical replicates per condition were pooled for this analysis. (E) Pairwise correlation of read counts between three technical replicates (samples processed from the same cDNA on the same day) when using homemade Tn5 R27S,E54K,L372P and the tagmentation protocol presented here. The Pearson correlation of r = 0.99 between all samples demonstrates high reproducibility of both the enzyme and the protocol. (F) Heat map analysis of gene counts in technical replicates processed from the same cDNA but on different days. The color code indicates the Pearson correlation between samples (see legend on the right side). NGS, next-generation sequencing; PCR, polymerase chain reaction; SDS, sodium dodecyl sulfate.

    Article Snippet: We also compared the performance of our in-house Tn5 transposases with the Nextera XT DNA library preparation kit and found that NGS libraries using the same input cDNA processed with either the Tn5R27S,E54K,L372P or the commercially available kit correlated very well with a Pearson’s correlation coefficient of r = 0.99 ( and Figure S3B in File S1 ).

    Techniques: Next-Generation Sequencing, Construct, Sequencing, Polymerase Chain Reaction, Amplification, Produced, Concentration Assay

    Experimental pipeline of SUPeR-seq, and its sensitivity at the whole-transcriptome scale. a The schematic of SUPeR-seq analysis. A single cell is lysed to release RNAs. RNAs are then reverse transcribed into first-strand cDNAs using random primers with a fixed anchor sequence (AnchorX-T 15 N 6 ). Unreacted primers are then digested using ExoSAP-IT, followed by adding poly(A) tails to the 3′ ends of the first-strand cDNAs using dATP doped with 1 % ddATP to restrict the length of poly(A) tails. Second-strand cDNAs are synthesized using poly(T) primers with a different anchor sequence (AnchorY-T 24 ). Then the double-stranded cDNAs are evenly amplified by PCR using AnchorX-T 15 and AnchorY-T 24 primers. Finally the purified single cell cDNAs are used to prepare sequencing libraries following Illumina’s TruSeq DNA sample preparation protocols. b Detection sensitivity of SUPeR-seq on poly(A)- genes in individual cells. We identified 696 poly(A)- genes by bulk RNA sequencing, of which around 30 % could be recovered in a single cell by SUPeR-seq (for details, see Additional file 3 ). When merged the SUPeR-seq data of the seven single cell samples together, over 50 % of these 696 genes could be successfully recovered by SUPeR-seq in at least one cell. c The number of genes detected from individual and bulk HEK293T cells using different protocols. SUPeR-seq detected 10,911 genes on average from an individual cell with FPKM ≥1(Fragments Per Kilobase of exon model per Million mapped reads), 19.3 % more than the Tang2009 protocol did (9148 genes on average). For comparison, 14,931 genes were detected with FPKM ≥1 in the four rRNA-depleted total RNA samples from bulk HEK293T cells, and 15,535 genes were detected in the four oligo(dT)-enriched total RNA samples from bulk HEK293T cells

    Journal: Genome Biology

    Article Title: Single-cell RNA-seq transcriptome analysis of linear and circular RNAs in mouse preimplantation embryos

    doi: 10.1186/s13059-015-0706-1

    Figure Lengend Snippet: Experimental pipeline of SUPeR-seq, and its sensitivity at the whole-transcriptome scale. a The schematic of SUPeR-seq analysis. A single cell is lysed to release RNAs. RNAs are then reverse transcribed into first-strand cDNAs using random primers with a fixed anchor sequence (AnchorX-T 15 N 6 ). Unreacted primers are then digested using ExoSAP-IT, followed by adding poly(A) tails to the 3′ ends of the first-strand cDNAs using dATP doped with 1 % ddATP to restrict the length of poly(A) tails. Second-strand cDNAs are synthesized using poly(T) primers with a different anchor sequence (AnchorY-T 24 ). Then the double-stranded cDNAs are evenly amplified by PCR using AnchorX-T 15 and AnchorY-T 24 primers. Finally the purified single cell cDNAs are used to prepare sequencing libraries following Illumina’s TruSeq DNA sample preparation protocols. b Detection sensitivity of SUPeR-seq on poly(A)- genes in individual cells. We identified 696 poly(A)- genes by bulk RNA sequencing, of which around 30 % could be recovered in a single cell by SUPeR-seq (for details, see Additional file 3 ). When merged the SUPeR-seq data of the seven single cell samples together, over 50 % of these 696 genes could be successfully recovered by SUPeR-seq in at least one cell. c The number of genes detected from individual and bulk HEK293T cells using different protocols. SUPeR-seq detected 10,911 genes on average from an individual cell with FPKM ≥1(Fragments Per Kilobase of exon model per Million mapped reads), 19.3 % more than the Tang2009 protocol did (9148 genes on average). For comparison, 14,931 genes were detected with FPKM ≥1 in the four rRNA-depleted total RNA samples from bulk HEK293T cells, and 15,535 genes were detected in the four oligo(dT)-enriched total RNA samples from bulk HEK293T cells

    Article Snippet: The rRNA-depleted RNAs were then used for library construction using the Illumina TruSeq RNA sample preparation kit.

    Techniques: Sequencing, Synthesized, Amplification, Polymerase Chain Reaction, Purification, Sample Prep, RNA Sequencing Assay

    Transgenic position of epidermal growth factor ( EGF ) locus on the rice chromosome 4 and polymerase chain reaction (PCR) test to identify T-DNA junction sequence. (A) The EGF is inserted on the position 31,104,341 of the chromosome 4. (B) The bold with underline is T-DNA sequence of the vector 2,026-2,223 bp and the next bases is rice transgenic locus chromosome 4 (31107341-31107690) in the fragment amplified by PCR test primer1 (5' TACCTGCATGCTGCGGTGAAG 3') and primer2 (5'AGGGCTGTGTAGAAGTACTCGC 3').

    Journal: Genomics & Informatics

    Article Title: Efficiency to Discovery Transgenic Loci in GM Rice Using Next Generation Sequencing Whole Genome Re-sequencing

    doi: 10.5808/GI.2015.13.3.81

    Figure Lengend Snippet: Transgenic position of epidermal growth factor ( EGF ) locus on the rice chromosome 4 and polymerase chain reaction (PCR) test to identify T-DNA junction sequence. (A) The EGF is inserted on the position 31,104,341 of the chromosome 4. (B) The bold with underline is T-DNA sequence of the vector 2,026-2,223 bp and the next bases is rice transgenic locus chromosome 4 (31107341-31107690) in the fragment amplified by PCR test primer1 (5' TACCTGCATGCTGCGGTGAAG 3') and primer2 (5'AGGGCTGTGTAGAAGTACTCGC 3').

    Article Snippet: Truseq DNA PCR free Library Preparation Kit (Illumina Inc.) was used to construct the DNA library according to the manufacturer's protocol.

    Techniques: Transgenic Assay, Polymerase Chain Reaction, Sequencing, Plasmid Preparation, Amplification