cdna amplification Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher cdna ends
    Morphological Phenotypes of Transgenic Plants Expressing Wild-Type or Mutant <t>PHS1</t> Transgenes. Seedlings were grown for 7 d on a vertically placed agar plate with or without 3 μM propyzamide in the medium. Root epidermal cells are shown on the right side of each seedling picture. Bar in seedling view = 1 cm; bar in magnified root view = 100 μm. (A) phs1-1 seedlings transformed with a wild-type genomic clone of PHS1 . (B) Wild-type seedlings transformed with a PHS1 genomic clone containing the R64C mutation. (C) Wild-type seedlings transformed with the R64C mutant PHS1 <t>cDNA</t> under the control of the CaMV35S promoter.
    Cdna Ends, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 11621 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna ends/product/Thermo Fisher
    Average 99 stars, based on 11621 article reviews
    Price from $9.99 to $1999.99
    cdna ends - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    99
    TaKaRa marathon cdna amplification kit
    Expression of CK metabolic and response genes during tomato fruit development. Real-time <t>PCR</t> was performed with <t>cDNA</t> prepared from pollinated ovaries (Poll.) at 1, 3, 5, 10, 15, and 20 days after anthesis (black bars), and unpollinated ovaries (Unpoll.) at –2, 0, 1, and 3 days after anthesis (grey bars). Expression levels are normalized to SAND expression levels. Values are mean ± SE ( n = 3).
    Marathon Cdna Amplification Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 2589 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/marathon cdna amplification kit/product/TaKaRa
    Average 99 stars, based on 2589 article reviews
    Price from $9.99 to $1999.99
    marathon cdna amplification kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    Becton Dickinson smart race cdna amplification kit
    Gene expression analysis by <t>cDNA</t> microarray comparing P. monodon transcripts between testis (TT) and ovary (OV) in individual juvenile (Ji), pooled juvenile (Jp) and individual wild-caught broodstock (WBi) . TT was labeled with Cy5 fluorescent dye (red) and OV with Cy3 fluorescent dye (green). (A) Hierarchical clustering analysis of the transcripts present in at least 8 of 9 slides and whose expression differences were at least equal to median value ± 1SD in at least 1 slide. (B) Clusters I and II of transcripts with higher expression levels in testis than ovary and vice versa with at least 3-fold difference in at least 6 of 9 slides. (C) Examples of differentially expressed transcripts with putative functions in reproductive development. Transcripts in blue letters are those which were not found in any EST libraries of other tissues. Saposin and Dmc1 (in red) were further characterized by <t>RACE-PCR.</t> (D) Library distributions of transcripts expressed higher in ovary than in testis (244 transcripts) and (E) those expressed higher in testis than in ovary (239 transcripts).
    Smart Race Cdna Amplification Kit, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 92/100, based on 1548 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/smart race cdna amplification kit/product/Becton Dickinson
    Average 92 stars, based on 1548 article reviews
    Price from $9.99 to $1999.99
    smart race cdna amplification kit - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    99
    TaKaRa smart race cdna amplification kit
    Intron retention and abundance of unspliced viral transcripts. (A) A diagram of MmuPV1 genome (a bracket line in the middle) with original assigned ORFs and a long control region (LCR), along with the identified splice sites, mapped viral promoters (P), polyadenylation CS sites (pA CS) and the position and orientation of primers used in the primer-walking study. Each primer was named by a number representing the position of the primer’s 5’end in the MmuPV1 genome. (B-C) The primer walking RT-PCRs were performed in the presence (+) or absence (-) of RT on total RNA isolated from the muzzle wart tissues of animal #2 and the obtained products were gel-purified and sequenced. PCR results in (B) were from 35 cycles and in (C) from 25 cycles and were all amplified from the same <t>cDNA.</t> (D) RT-PCR detection for intron retention and abundance of unspliced MmuPV1 RNA on total RNA isolated from the ear wart tissues of animal #3. GAPDH RNA served as a sample loading control. PCR results were from 25 cycles. (E) The <t>3’RACE</t> performed with intron-based E1-specific Pr1263 on cDNA from the muzzle tissues of animal #2. The predicted 3’ RACE product for E1 transcripts is ~2.6 kb when polyadenylated at nt 3864 position.
    Smart Race Cdna Amplification Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 9386 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/smart race cdna amplification kit/product/TaKaRa
    Average 99 stars, based on 9386 article reviews
    Price from $9.99 to $1999.99
    smart race cdna amplification kit - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    92
    fluidigm pre amplified cdna
    Heterogeneous FAPs population consists of distinct subpopulations of cells. a Experimental workflow for single cell gene expression analysis. Hindlimb muscles of C57Bl/10 mice were isolated, minced, and enzymatically digested. FAPs were isolated by FACS and loaded on the C1 System (Fluidigm) to extract RNA, reverse transcribe RNA to <t>cDNA</t> and pre-amplify cDNA from each single cell. Real-time qPCR analysis of single cell-derived cDNA was performed on the <t>Biomark</t> platform (Fluidigm) for 87 genes. b Principal component analysis (PCA) of single cell gene expression values of FAPs isolated from WT, WT notexin-injured day 3 (WT-inj d3) and dystrophic MDX mice. c Self organizing maps (SOM) representation of gene expression in clusters of single FAP cells. Each circle is a cluster of single cells and the fill color represents the level of expression for each gene shown. The expression scale is shown on the left for each gene individually. Expression is measured as Log 2 Ex (Log 2 Ex = Ct (LOD) -Ct (gene) ) with LOD = 24 (limit of detection) and Ct = cycle threshold. d Correlation matrix of single cell gene expression across all cells. Orange color marks high positive correlation, green color marks high negative correlation. Groups of genes outlined in blue are positively correlated, while the genes outlined in green are negatively correlated. e Expression scatterplot of Tek and Vcam1 gene expression. Cutoff is set at 7 Log 2 Ex for both genes based on the SOM graph ( c ). Tek and Vcam1 expression levels define the predicted subpopulations, marked as Tek(Tie2)+/Vcam− (Tek+) in dark blue, Vcam1+/Tek(Tie2)− (Vcam1+) in brown, double positive (DP) in light blue and double negative (DN) in gold. f The same PCA as in Fig. 1a but with cells color coded based on the FAPs subpopulations predicted in Fig. 1e. g Distribution of subpopulations in each experimental condition ( n = 2)
    Pre Amplified Cdna, supplied by fluidigm, used in various techniques. Bioz Stars score: 92/100, based on 429 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pre amplified cdna/product/fluidigm
    Average 92 stars, based on 429 article reviews
    Price from $9.99 to $1999.99
    pre amplified cdna - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Illumina Inc cdna amplification
    Heterogeneous FAPs population consists of distinct subpopulations of cells. a Experimental workflow for single cell gene expression analysis. Hindlimb muscles of C57Bl/10 mice were isolated, minced, and enzymatically digested. FAPs were isolated by FACS and loaded on the C1 System (Fluidigm) to extract RNA, reverse transcribe RNA to <t>cDNA</t> and pre-amplify cDNA from each single cell. Real-time qPCR analysis of single cell-derived cDNA was performed on the <t>Biomark</t> platform (Fluidigm) for 87 genes. b Principal component analysis (PCA) of single cell gene expression values of FAPs isolated from WT, WT notexin-injured day 3 (WT-inj d3) and dystrophic MDX mice. c Self organizing maps (SOM) representation of gene expression in clusters of single FAP cells. Each circle is a cluster of single cells and the fill color represents the level of expression for each gene shown. The expression scale is shown on the left for each gene individually. Expression is measured as Log 2 Ex (Log 2 Ex = Ct (LOD) -Ct (gene) ) with LOD = 24 (limit of detection) and Ct = cycle threshold. d Correlation matrix of single cell gene expression across all cells. Orange color marks high positive correlation, green color marks high negative correlation. Groups of genes outlined in blue are positively correlated, while the genes outlined in green are negatively correlated. e Expression scatterplot of Tek and Vcam1 gene expression. Cutoff is set at 7 Log 2 Ex for both genes based on the SOM graph ( c ). Tek and Vcam1 expression levels define the predicted subpopulations, marked as Tek(Tie2)+/Vcam− (Tek+) in dark blue, Vcam1+/Tek(Tie2)− (Vcam1+) in brown, double positive (DP) in light blue and double negative (DN) in gold. f The same PCA as in Fig. 1a but with cells color coded based on the FAPs subpopulations predicted in Fig. 1e. g Distribution of subpopulations in each experimental condition ( n = 2)
    Cdna Amplification, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 426 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna amplification/product/Illumina Inc
    Average 92 stars, based on 426 article reviews
    Price from $9.99 to $1999.99
    cdna amplification - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Nugen cdna amplification
    Heterogeneous FAPs population consists of distinct subpopulations of cells. a Experimental workflow for single cell gene expression analysis. Hindlimb muscles of C57Bl/10 mice were isolated, minced, and enzymatically digested. FAPs were isolated by FACS and loaded on the C1 System (Fluidigm) to extract RNA, reverse transcribe RNA to <t>cDNA</t> and pre-amplify cDNA from each single cell. Real-time qPCR analysis of single cell-derived cDNA was performed on the <t>Biomark</t> platform (Fluidigm) for 87 genes. b Principal component analysis (PCA) of single cell gene expression values of FAPs isolated from WT, WT notexin-injured day 3 (WT-inj d3) and dystrophic MDX mice. c Self organizing maps (SOM) representation of gene expression in clusters of single FAP cells. Each circle is a cluster of single cells and the fill color represents the level of expression for each gene shown. The expression scale is shown on the left for each gene individually. Expression is measured as Log 2 Ex (Log 2 Ex = Ct (LOD) -Ct (gene) ) with LOD = 24 (limit of detection) and Ct = cycle threshold. d Correlation matrix of single cell gene expression across all cells. Orange color marks high positive correlation, green color marks high negative correlation. Groups of genes outlined in blue are positively correlated, while the genes outlined in green are negatively correlated. e Expression scatterplot of Tek and Vcam1 gene expression. Cutoff is set at 7 Log 2 Ex for both genes based on the SOM graph ( c ). Tek and Vcam1 expression levels define the predicted subpopulations, marked as Tek(Tie2)+/Vcam− (Tek+) in dark blue, Vcam1+/Tek(Tie2)− (Vcam1+) in brown, double positive (DP) in light blue and double negative (DN) in gold. f The same PCA as in Fig. 1a but with cells color coded based on the FAPs subpopulations predicted in Fig. 1e. g Distribution of subpopulations in each experimental condition ( n = 2)
    Cdna Amplification, supplied by Nugen, used in various techniques. Bioz Stars score: 92/100, based on 313 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna amplification/product/Nugen
    Average 92 stars, based on 313 article reviews
    Price from $9.99 to $1999.99
    cdna amplification - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Becton Dickinson marathon cdna amplification kit
    Expression pattern of the cpk transcript and characterization of the predicted protein product. ( a ) The tissue distribution of the 2.2-kb cpk transcript is shown in adult mouse tissues. The size of the polyadenylated transcript is consistent with the 1,856-bp full-length <t>cDNA.</t> The size markers are indicated on the left and expressed as kilobases. ( b ) Northern blot analysis of mouse fetal poly(A + ) RNA revealed a 2.2-kb transcript in the fetal kidney. ( c ) Northern blot analysis of human fetal poly(A + ) RNA revealed a 2.4-kb transcript in the fetal kidney. ( d ) The relative expression of the 2.2-kb cpk transcript is shown in kidney and liver poly(A + ) RNA from 2-week-old B6-WT ( n = 5 mice) and B6- cpk/cpk ( n = 5 mice) (top panel). Rehybridization with Gapdh cDNA served as a loading control (middle panel). <t>RT-PCR</t> was performed using the deletion-flanking primer pairs on the same poly(A + ) RNAs (bottom panel). ( e ) Amino acid sequence of the predicted 145-AA protein product. Two potential myristoylation sites (residues 2–7, 43–48, indicated by asterisks) are predicted, the first of which is coupled to a polybasic domain (underlined).
    Marathon Cdna Amplification Kit, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 92/100, based on 260 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/marathon cdna amplification kit/product/Becton Dickinson
    Average 92 stars, based on 260 article reviews
    Price from $9.99 to $1999.99
    marathon cdna amplification kit - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    99
    Thermo Fisher cdna amplification
    icM 2 reveals structured elements in the hyperconserved Csde1 <t>5’UTR</t> A) Schematic of localized perturbation patterns that may be observed in M 2 data. Here, the mutant does not disrupt the overall structure and “releases” its base pairing partner. This results in an increase of chemical accessibility signal at the interacting nucleotide. Systematic profiling of accessibilities by M 2 results in an array of such mutant accessibility data into an approximate contact map. B) Schematic of global rearrangement patterns that may be observed in M 2 data. Here, multiple conformations of the RNA molecule are present together in an ensemble at non-negligible relative proportions. Mutations can shift this balance, such that one structural state is favored over the other. In this case, M 2 reveals large-scale accessibility perturbations across a longer stretch of the RNA molecule. Multiple mutations often impact the relative proportions in similar ways, which manifests as correlated arrays accessibility changes in M 2 data matrix. C) Schematic of the icM 2 method. Mutagenesis library of the target RNA of interest is first generated using error-prone PCR followed by cloning into an expression vector. The cells are transfected with the library and treated with DMS. Total RNAs are extracted. Read-through reverse transcription encodes DMS-modified nucleotides as mutations on the <t>cDNA,</t> which are read out by high-throughput sequencing. Correlated mutations in sequencing reads are then quantified and the resultant covariation matrix is analyzed for signature perturbation patterns. D) Heatmap of icM 2 accessibility matrix for Csde1 5’UTR from position 190 to 386. For each row, the chemical mapping profile of a single-nucleotide variant of the RNA is plotted across the columns, where the colors indicate z-scaled accessibility change values from the wild-type RNA. 1D data from each mutant are vertically stacked to display a 2D matrix. White boxes mark the two regions (A: positions 334-363 and B: positions 215-315) that display strong perturbation signals that reveal their structures. E) A structure model (structure W) of region A. Bases colored in red indicate mutations with accessibility changes observed in icM 2 data that are consistent with the model. F) Scatter plot showing correlations of per-nucleotide accessibilities between each mutant versus the “wild-type” (wild-type accessibilities are not directly measured, but mean accessibilities of 10 lowest variable mutants are used as a close approximation) on the y-axis and nucleotide positions along the x-axis. p indicates Wilcoxon rank sum test p-value for the difference in distributions of correlations between region B versus other nucleotides. G) Multiple species alignment for Csde1 5’UTR from position 125 to 548. For each row, the sequence alignment of a species is plotted across the columns, where the colors indicate match/substitution/insertion/deletion at each nucleotide. The alignment positions are relative to the mouse sequence. The top row is the mouse alignment, colored separately from other rows as a reference to indicate the identity of the bases in each position in the multiple species alignment.
    Cdna Amplification, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2496 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna amplification/product/Thermo Fisher
    Average 99 stars, based on 2496 article reviews
    Price from $9.99 to $1999.99
    cdna amplification - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    89
    Becton Dickinson bd smart race cdna amplification kit
    Nucleotide sequence of the medaka boule <t>cDNA.</t> O bol and its deduced protein OBol: shown in bold are the translation start codon, stop codon and putative poly-adenylation signal. Highlighted are RRM motif (Turquoise) and DAZ motif (light grey). Underlined are primer sequences for 5′ <t>RACE</t> (dash) and RT-PCR (solid, fragment for RNA probe) with arrows depicting their extension directions.
    Bd Smart Race Cdna Amplification Kit, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 89/100, based on 118 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bd smart race cdna amplification kit/product/Becton Dickinson
    Average 89 stars, based on 118 article reviews
    Price from $9.99 to $1999.99
    bd smart race cdna amplification kit - by Bioz Stars, 2020-09
    89/100 stars
      Buy from Supplier

    93
    10X Genomics cdna amplification
    Nucleotide sequence of the medaka boule <t>cDNA.</t> O bol and its deduced protein OBol: shown in bold are the translation start codon, stop codon and putative poly-adenylation signal. Highlighted are RRM motif (Turquoise) and DAZ motif (light grey). Underlined are primer sequences for 5′ <t>RACE</t> (dash) and RT-PCR (solid, fragment for RNA probe) with arrows depicting their extension directions.
    Cdna Amplification, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 93/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna amplification/product/10X Genomics
    Average 93 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    cdna amplification - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    92
    fluidigm cdna amplification
    Nucleotide sequence of the medaka boule <t>cDNA.</t> O bol and its deduced protein OBol: shown in bold are the translation start codon, stop codon and putative poly-adenylation signal. Highlighted are RRM motif (Turquoise) and DAZ motif (light grey). Underlined are primer sequences for 5′ <t>RACE</t> (dash) and RT-PCR (solid, fragment for RNA probe) with arrows depicting their extension directions.
    Cdna Amplification, supplied by fluidigm, used in various techniques. Bioz Stars score: 92/100, based on 76 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna amplification/product/fluidigm
    Average 92 stars, based on 76 article reviews
    Price from $9.99 to $1999.99
    cdna amplification - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    88
    Thermo Fisher genechip expression 3 amplification reagents one cycle cdna synthesis kit
    Nucleotide sequence of the medaka boule <t>cDNA.</t> O bol and its deduced protein OBol: shown in bold are the translation start codon, stop codon and putative poly-adenylation signal. Highlighted are RRM motif (Turquoise) and DAZ motif (light grey). Underlined are primer sequences for 5′ <t>RACE</t> (dash) and RT-PCR (solid, fragment for RNA probe) with arrows depicting their extension directions.
    Genechip Expression 3 Amplification Reagents One Cycle Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 97 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genechip expression 3 amplification reagents one cycle cdna synthesis kit/product/Thermo Fisher
    Average 88 stars, based on 97 article reviews
    Price from $9.99 to $1999.99
    genechip expression 3 amplification reagents one cycle cdna synthesis kit - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    Image Search Results


    Morphological Phenotypes of Transgenic Plants Expressing Wild-Type or Mutant PHS1 Transgenes. Seedlings were grown for 7 d on a vertically placed agar plate with or without 3 μM propyzamide in the medium. Root epidermal cells are shown on the right side of each seedling picture. Bar in seedling view = 1 cm; bar in magnified root view = 100 μm. (A) phs1-1 seedlings transformed with a wild-type genomic clone of PHS1 . (B) Wild-type seedlings transformed with a PHS1 genomic clone containing the R64C mutation. (C) Wild-type seedlings transformed with the R64C mutant PHS1 cDNA under the control of the CaMV35S promoter.

    Journal: The Plant Cell

    Article Title: A Semidominant Mutation in an Arabidopsis Mitogen-Activated Protein Kinase Phosphatase-Like Gene Compromises Cortical Microtubule Organization W⃞

    doi: 10.1105/tpc.021865

    Figure Lengend Snippet: Morphological Phenotypes of Transgenic Plants Expressing Wild-Type or Mutant PHS1 Transgenes. Seedlings were grown for 7 d on a vertically placed agar plate with or without 3 μM propyzamide in the medium. Root epidermal cells are shown on the right side of each seedling picture. Bar in seedling view = 1 cm; bar in magnified root view = 100 μm. (A) phs1-1 seedlings transformed with a wild-type genomic clone of PHS1 . (B) Wild-type seedlings transformed with a PHS1 genomic clone containing the R64C mutation. (C) Wild-type seedlings transformed with the R64C mutant PHS1 cDNA under the control of the CaMV35S promoter.

    Article Snippet: Because publicly available cDNA clones lacked a part of the 5′ region, the missing N-terminal part of PHS1 was obtained by the method of 5′-rapid amplification of cDNA ends (5′-RACE) using the 5′-RACE system, version 2.0 (Gibco BRL, Cleveland, OH).

    Techniques: Transgenic Assay, Expressing, Mutagenesis, Transformation Assay

    Nucleotide sequence of 3’ UTR of BCMV (A) and PMMoV (B) of 3’ RACE-PCR amplified products.

    Journal: bioRxiv

    Article Title: Presence of polyadenylated 3’ tail in RNA of Pepper mild mottle virus allows the Oligo(dT)18 in Priming cDNA Synthesis of its genomic RNA template

    doi: 10.1101/2020.04.13.039180

    Figure Lengend Snippet: Nucleotide sequence of 3’ UTR of BCMV (A) and PMMoV (B) of 3’ RACE-PCR amplified products.

    Article Snippet: To determine the nature of 3’ end of both viruses, 3’-RACE-PCR was performed as per the instructions of SMARTer™ RACE-cDNA Amplification Kit User Manual ( ) using primers given in .

    Techniques: Sequencing, Polymerase Chain Reaction, Amplification

    anc-1b is the major isoform in hyp7 nuclear anchorage. (A) Schematic gene structure of anc-1a, b and c isoforms (modified from the J-Brower in Wormbase). Domains are color-coded. The target regions of RNAi constructs are labeled. Premature stop mutations are indicated using the numbering the anc-1a isoform. (B) Quantification of nuclear anchorage defects in anc-1 mutant and RNAi animals. Means with 95%CI are shown in the graph. Unpaired student two-tail t -test was used for statistical analysis. ns, not significant, p > 0.05; ***, P ≤ 0.001. n ≥ 20 for each strain. (C) An agarose gel showing the 5’-RACE products on the right lane. (D) Partial sequence of the 5’-RACE product. An SL1 sequence (orange) adjacent to the 5’ end of the anc-1b transcript was identified. The predicted start codon is in light green. (E) Lateral view of a worm showing the expression of nls::GFP driven by anc-1b promoter. Yellow arrows mark hyp7 nuclei, the red arrows mark seam cell nuclei and the bright, unmarked nuclei are in muscle cells. Scale bar is 10 µm.

    Journal: bioRxiv

    Article Title: The Nesprin-1/-2 ortholog ANC-1 regulates organelle positioning in C. elegans without its KASH or actin-binding domains

    doi: 10.1101/2020.07.14.202838

    Figure Lengend Snippet: anc-1b is the major isoform in hyp7 nuclear anchorage. (A) Schematic gene structure of anc-1a, b and c isoforms (modified from the J-Brower in Wormbase). Domains are color-coded. The target regions of RNAi constructs are labeled. Premature stop mutations are indicated using the numbering the anc-1a isoform. (B) Quantification of nuclear anchorage defects in anc-1 mutant and RNAi animals. Means with 95%CI are shown in the graph. Unpaired student two-tail t -test was used for statistical analysis. ns, not significant, p > 0.05; ***, P ≤ 0.001. n ≥ 20 for each strain. (C) An agarose gel showing the 5’-RACE products on the right lane. (D) Partial sequence of the 5’-RACE product. An SL1 sequence (orange) adjacent to the 5’ end of the anc-1b transcript was identified. The predicted start codon is in light green. (E) Lateral view of a worm showing the expression of nls::GFP driven by anc-1b promoter. Yellow arrows mark hyp7 nuclei, the red arrows mark seam cell nuclei and the bright, unmarked nuclei are in muscle cells. Scale bar is 10 µm.

    Article Snippet: Purification and TdT tailing of the first-strand cDNA were performed by the 5’ RACE System for Rapid Amplification of cDNA Ends, version 2.0 (Invitrogen, Cat. No. 18374058).

    Techniques: Modification, Construct, Labeling, Mutagenesis, Agarose Gel Electrophoresis, Sequencing, Expressing

    5'RLM-RACE procedure in DU-145 and LNCaP prostate cancer cell lines . A) Two forward primers used for the two rounds of RACE-PCR recognizing the adapter sequence, and two reverse primers, against the fifth and third exon of SHBG, are shown. B) In the DU-145 5' RACE, one major band (asterisk) was obtained. TAP+ samples include total RNAs treated with Tobacco Acid Pyrophosphatase, and TAP-samples are negative controls that include RNAs that did not incorporate the RNA Adapter oligonucleotide. Ctrl-: Negative controls performed using water instead of cDNA. C) Two cloned products were obtained from the major band: RACEfrag 1 and RACEfrag 2. The empty vector (E.V.) provided an amplification product of 200 nucleotides, corresponding to the M13 flanking sequence. D) In the LNCaP 5' RACE, one major band (asterisk) was obtained. E) The cloning of the major band generated RACEfrag 3 and RACEfrag 4 products. Insert and M13 flanking sequence size are indicated in the four RACEfrags.

    Journal: BMC Molecular Biology

    Article Title: Identification, characterization and expression of novel Sex Hormone Binding Globulin alternative first exons in the human prostate

    doi: 10.1186/1471-2199-10-59

    Figure Lengend Snippet: 5'RLM-RACE procedure in DU-145 and LNCaP prostate cancer cell lines . A) Two forward primers used for the two rounds of RACE-PCR recognizing the adapter sequence, and two reverse primers, against the fifth and third exon of SHBG, are shown. B) In the DU-145 5' RACE, one major band (asterisk) was obtained. TAP+ samples include total RNAs treated with Tobacco Acid Pyrophosphatase, and TAP-samples are negative controls that include RNAs that did not incorporate the RNA Adapter oligonucleotide. Ctrl-: Negative controls performed using water instead of cDNA. C) Two cloned products were obtained from the major band: RACEfrag 1 and RACEfrag 2. The empty vector (E.V.) provided an amplification product of 200 nucleotides, corresponding to the M13 flanking sequence. D) In the LNCaP 5' RACE, one major band (asterisk) was obtained. E) The cloning of the major band generated RACEfrag 3 and RACEfrag 4 products. Insert and M13 flanking sequence size are indicated in the four RACEfrags.

    Article Snippet: 5' Rapid Amplification of cDNA Ends (RACE) 5'RACE was performed using the FirstChoice® RLM (RNA Ligase Mediated)-RACE Kit (Ambion, Austin, TX) with 10 μg of total RNA from DU-145 and LNCaP cells as template, and reverse primers complementary to the fifth (5' TGAGATCTCGGCCTGTTTGTC 3') and third (5' AGGCCTGCCGTCTCGAAGTCCC 3' for nested PCR) exon of SHBG gene.

    Techniques: Polymerase Chain Reaction, Sequencing, Clone Assay, Plasmid Preparation, Amplification, Generated

    Fixation and storage introduces major gene-to-gene variations in qRT-PCR. Aliquots of a human liver sample were cryopreserved or fixed in formalin and paraffin embedded. (A) RNA was extracted from samples at different timepoints including technical replicates. (B) Comparison of qRT-PCR data for 92 genes from cryopreserved and FFPE human liver samples reveals an average difference of the ct values ranging from 4 cycles (6 months) to 8 cycles (1 year) increasing with storage time at room temperature. Extraction from the FFPE sample which had been stored for one year was done in duplicates. cDNA generation was performed in duplicates from the same RNA, and qRT-PCR was performed twice from the same cDNA. Data was generated with the TaqMan “Human Molecular Mechanisms of Cancer” assay, individual ct values are shown.

    Journal: PLoS ONE

    Article Title: Quality Control of RNA Preservation and Extraction from Paraffin-Embedded Tissue: Implications for RT-PCR and Microarray Analysis

    doi: 10.1371/journal.pone.0070714

    Figure Lengend Snippet: Fixation and storage introduces major gene-to-gene variations in qRT-PCR. Aliquots of a human liver sample were cryopreserved or fixed in formalin and paraffin embedded. (A) RNA was extracted from samples at different timepoints including technical replicates. (B) Comparison of qRT-PCR data for 92 genes from cryopreserved and FFPE human liver samples reveals an average difference of the ct values ranging from 4 cycles (6 months) to 8 cycles (1 year) increasing with storage time at room temperature. Extraction from the FFPE sample which had been stored for one year was done in duplicates. cDNA generation was performed in duplicates from the same RNA, and qRT-PCR was performed twice from the same cDNA. Data was generated with the TaqMan “Human Molecular Mechanisms of Cancer” assay, individual ct values are shown.

    Article Snippet: RNA was extracted twice from the one year FFPE sample to assess the impact of the extraction, cDNA generation of this RNA was done in duplicates to see variability introduced by fixation on reverse transcription, and the whole assay was performed twice from one cDNA sample as a technical replicate establishing the analytical variability of this qRT-PCR platform ( ).

    Techniques: Quantitative RT-PCR, Formalin-fixed Paraffin-Embedded, Generated

    Impact of fixation on cDNA synthesis efficiency. (A) cDNA generation from RNA extracted from cryopreserved and TFPE human liver tissue is in direct correlation to the amount of template RNA. RNA extracted from FFPE tissue produces only small amounts of cDNA even when more template RNA is provided. cDNA from (A) was tested in the amplicon length qRT-PCR assay. (B) Ct values from the cryopreserved sample are in the range of 22–25cts. Ct values of TFPE samples are shifted by approximately 4 cycles but the appearance of the curve remains similar to that obtained from cryopreserved samples. In FFPE tissue the longer amplicons are not amplified, and even for the short amplicons the ct values are very high (31–36ct). Error bars in A depict standard deviation of the median qRT-PCR result in three individual cDNA preparations, or in B the standard deviation of three qRT-PCR analyses. RIN values and 260/280 ratios obtained from different samples: CRYO RIN: 7,7; 260/280: 1,97; TFPE RIN: 2,5; 260/280: 1,98; FFPE RIN: 2,7; 260/280: 2,01.

    Journal: PLoS ONE

    Article Title: Quality Control of RNA Preservation and Extraction from Paraffin-Embedded Tissue: Implications for RT-PCR and Microarray Analysis

    doi: 10.1371/journal.pone.0070714

    Figure Lengend Snippet: Impact of fixation on cDNA synthesis efficiency. (A) cDNA generation from RNA extracted from cryopreserved and TFPE human liver tissue is in direct correlation to the amount of template RNA. RNA extracted from FFPE tissue produces only small amounts of cDNA even when more template RNA is provided. cDNA from (A) was tested in the amplicon length qRT-PCR assay. (B) Ct values from the cryopreserved sample are in the range of 22–25cts. Ct values of TFPE samples are shifted by approximately 4 cycles but the appearance of the curve remains similar to that obtained from cryopreserved samples. In FFPE tissue the longer amplicons are not amplified, and even for the short amplicons the ct values are very high (31–36ct). Error bars in A depict standard deviation of the median qRT-PCR result in three individual cDNA preparations, or in B the standard deviation of three qRT-PCR analyses. RIN values and 260/280 ratios obtained from different samples: CRYO RIN: 7,7; 260/280: 1,97; TFPE RIN: 2,5; 260/280: 1,98; FFPE RIN: 2,7; 260/280: 2,01.

    Article Snippet: RNA was extracted twice from the one year FFPE sample to assess the impact of the extraction, cDNA generation of this RNA was done in duplicates to see variability introduced by fixation on reverse transcription, and the whole assay was performed twice from one cDNA sample as a technical replicate establishing the analytical variability of this qRT-PCR platform ( ).

    Techniques: Formalin-fixed Paraffin-Embedded, Amplification, Quantitative RT-PCR, Standard Deviation

    Assay for evaluation of RNA performance in qRT-PCR. qRT-of six amplicons of different length (71, 153, 200, 277, 323, 530 bp amplicon size) the gene GAPDH performed using cDNA derived from FFPE, TFPE and cryopreserved samples of different organs. (A) Gel images of GAPDH amplicons in three different CRYO, FFPE and TFPE tissues. All size fragments can be amplified from CRYO samples, most larger amplicons are missing in FFPE samples, all amplicons are present in TFPE samples but the 530 bp band is weak. (B) Direct comparison of ct values obtained from CRYO, FFPE and TFPE liver tissue. In FFPE samples the 323 and 530 bp bands could not be detected or were unspecific, and ct values of smaller amplicons were shifted by up to 9 cycles. The slope of the regression line through the data points was greater in FFPE (2.14) than in TFPE (0.55) and the cryopreserved (0.34) liver samples. Error bars depict standard deviation of PCR triplicates (too small to be visible in CRYO and TFPE samples).

    Journal: PLoS ONE

    Article Title: Quality Control of RNA Preservation and Extraction from Paraffin-Embedded Tissue: Implications for RT-PCR and Microarray Analysis

    doi: 10.1371/journal.pone.0070714

    Figure Lengend Snippet: Assay for evaluation of RNA performance in qRT-PCR. qRT-of six amplicons of different length (71, 153, 200, 277, 323, 530 bp amplicon size) the gene GAPDH performed using cDNA derived from FFPE, TFPE and cryopreserved samples of different organs. (A) Gel images of GAPDH amplicons in three different CRYO, FFPE and TFPE tissues. All size fragments can be amplified from CRYO samples, most larger amplicons are missing in FFPE samples, all amplicons are present in TFPE samples but the 530 bp band is weak. (B) Direct comparison of ct values obtained from CRYO, FFPE and TFPE liver tissue. In FFPE samples the 323 and 530 bp bands could not be detected or were unspecific, and ct values of smaller amplicons were shifted by up to 9 cycles. The slope of the regression line through the data points was greater in FFPE (2.14) than in TFPE (0.55) and the cryopreserved (0.34) liver samples. Error bars depict standard deviation of PCR triplicates (too small to be visible in CRYO and TFPE samples).

    Article Snippet: RNA was extracted twice from the one year FFPE sample to assess the impact of the extraction, cDNA generation of this RNA was done in duplicates to see variability introduced by fixation on reverse transcription, and the whole assay was performed twice from one cDNA sample as a technical replicate establishing the analytical variability of this qRT-PCR platform ( ).

    Techniques: Quantitative RT-PCR, Amplification, Derivative Assay, Formalin-fixed Paraffin-Embedded, Standard Deviation, Polymerase Chain Reaction

    Expression of CK metabolic and response genes during tomato fruit development. Real-time PCR was performed with cDNA prepared from pollinated ovaries (Poll.) at 1, 3, 5, 10, 15, and 20 days after anthesis (black bars), and unpollinated ovaries (Unpoll.) at –2, 0, 1, and 3 days after anthesis (grey bars). Expression levels are normalized to SAND expression levels. Values are mean ± SE ( n = 3).

    Journal: Journal of Experimental Botany

    Article Title: Roles and regulation of cytokinins in tomato fruit development

    doi: 10.1093/jxb/ers207

    Figure Lengend Snippet: Expression of CK metabolic and response genes during tomato fruit development. Real-time PCR was performed with cDNA prepared from pollinated ovaries (Poll.) at 1, 3, 5, 10, 15, and 20 days after anthesis (black bars), and unpollinated ovaries (Unpoll.) at –2, 0, 1, and 3 days after anthesis (grey bars). Expression levels are normalized to SAND expression levels. Values are mean ± SE ( n = 3).

    Article Snippet: RACE (Rapid Amplification of cDNA Ends) was performed to identify the sequences of 5’ and 3’ regions of the genes using a Marathon cDNA amplification kit and an Advantage 2 PCR kit (Clontech).

    Techniques: Expressing, Real-time Polymerase Chain Reaction

    Gene expression analysis by cDNA microarray comparing P. monodon transcripts between testis (TT) and ovary (OV) in individual juvenile (Ji), pooled juvenile (Jp) and individual wild-caught broodstock (WBi) . TT was labeled with Cy5 fluorescent dye (red) and OV with Cy3 fluorescent dye (green). (A) Hierarchical clustering analysis of the transcripts present in at least 8 of 9 slides and whose expression differences were at least equal to median value ± 1SD in at least 1 slide. (B) Clusters I and II of transcripts with higher expression levels in testis than ovary and vice versa with at least 3-fold difference in at least 6 of 9 slides. (C) Examples of differentially expressed transcripts with putative functions in reproductive development. Transcripts in blue letters are those which were not found in any EST libraries of other tissues. Saposin and Dmc1 (in red) were further characterized by RACE-PCR. (D) Library distributions of transcripts expressed higher in ovary than in testis (244 transcripts) and (E) those expressed higher in testis than in ovary (239 transcripts).

    Journal: BMC Molecular Biology

    Article Title: Identification of testis-relevant genes using in silico analysis from testis ESTs and cDNA microarray in the black tiger shrimp (Penaeus monodon)

    doi: 10.1186/1471-2199-11-55

    Figure Lengend Snippet: Gene expression analysis by cDNA microarray comparing P. monodon transcripts between testis (TT) and ovary (OV) in individual juvenile (Ji), pooled juvenile (Jp) and individual wild-caught broodstock (WBi) . TT was labeled with Cy5 fluorescent dye (red) and OV with Cy3 fluorescent dye (green). (A) Hierarchical clustering analysis of the transcripts present in at least 8 of 9 slides and whose expression differences were at least equal to median value ± 1SD in at least 1 slide. (B) Clusters I and II of transcripts with higher expression levels in testis than ovary and vice versa with at least 3-fold difference in at least 6 of 9 slides. (C) Examples of differentially expressed transcripts with putative functions in reproductive development. Transcripts in blue letters are those which were not found in any EST libraries of other tissues. Saposin and Dmc1 (in red) were further characterized by RACE-PCR. (D) Library distributions of transcripts expressed higher in ovary than in testis (244 transcripts) and (E) those expressed higher in testis than in ovary (239 transcripts).

    Article Snippet: RACE-PCRs of Saposin and Dmc1 were carried out using a BD SMART RACE cDNA Amplification Kit following the protocol recommended by the manufacturer (BD Biosciences Clontech).

    Techniques: Expressing, Microarray, Labeling, Polymerase Chain Reaction

    Intron retention and abundance of unspliced viral transcripts. (A) A diagram of MmuPV1 genome (a bracket line in the middle) with original assigned ORFs and a long control region (LCR), along with the identified splice sites, mapped viral promoters (P), polyadenylation CS sites (pA CS) and the position and orientation of primers used in the primer-walking study. Each primer was named by a number representing the position of the primer’s 5’end in the MmuPV1 genome. (B-C) The primer walking RT-PCRs were performed in the presence (+) or absence (-) of RT on total RNA isolated from the muzzle wart tissues of animal #2 and the obtained products were gel-purified and sequenced. PCR results in (B) were from 35 cycles and in (C) from 25 cycles and were all amplified from the same cDNA. (D) RT-PCR detection for intron retention and abundance of unspliced MmuPV1 RNA on total RNA isolated from the ear wart tissues of animal #3. GAPDH RNA served as a sample loading control. PCR results were from 25 cycles. (E) The 3’RACE performed with intron-based E1-specific Pr1263 on cDNA from the muzzle tissues of animal #2. The predicted 3’ RACE product for E1 transcripts is ~2.6 kb when polyadenylated at nt 3864 position.

    Journal: PLoS Pathogens

    Article Title: The full transcription map of mouse papillomavirus type 1 (MmuPV1) in mouse wart tissues

    doi: 10.1371/journal.ppat.1006715

    Figure Lengend Snippet: Intron retention and abundance of unspliced viral transcripts. (A) A diagram of MmuPV1 genome (a bracket line in the middle) with original assigned ORFs and a long control region (LCR), along with the identified splice sites, mapped viral promoters (P), polyadenylation CS sites (pA CS) and the position and orientation of primers used in the primer-walking study. Each primer was named by a number representing the position of the primer’s 5’end in the MmuPV1 genome. (B-C) The primer walking RT-PCRs were performed in the presence (+) or absence (-) of RT on total RNA isolated from the muzzle wart tissues of animal #2 and the obtained products were gel-purified and sequenced. PCR results in (B) were from 35 cycles and in (C) from 25 cycles and were all amplified from the same cDNA. (D) RT-PCR detection for intron retention and abundance of unspliced MmuPV1 RNA on total RNA isolated from the ear wart tissues of animal #3. GAPDH RNA served as a sample loading control. PCR results were from 25 cycles. (E) The 3’RACE performed with intron-based E1-specific Pr1263 on cDNA from the muzzle tissues of animal #2. The predicted 3’ RACE product for E1 transcripts is ~2.6 kb when polyadenylated at nt 3864 position.

    Article Snippet: Rapid amplification of cDNA ends (RACE) and PacBio Iso-seq sequencing The 5′ and 3′ RACE assays were carried out using a Smart RACE cDNA amplification kit (Clontech, Mountain View, CA, #634858) according to the manufacturer’s instructions using 1 μg/reaction of total RNA as template [ ].

    Techniques: Chromosome Walking, Isolation, Purification, Polymerase Chain Reaction, Amplification, Reverse Transcription Polymerase Chain Reaction

    Mapping of polyadenylation cleavage sites for MmuPV1 transcripts. (A) The diagram depicting MmuPV1 genome with the position of primers used in 3’RACE analysis and three predicted canonical polyadenylation signals (PAS). The associated number represents the nt position in the MmuPV1 genome. (B-C) Mapping of MmuPV1 polyadenylation cleavage sites by 3′RACE was conducted on total RNA isolated from MmuPV1-infected wart tissues using MmuPV1-specific primer Pr3277 for viral early (B) or Pr6846 for viral late transcripts (C). The obtained RACE products (arrows) were gel purified, cloned, and sequenced. Sequence readings on the right show frequency and positon of all mapped cleavage sites for early (B) or late (C) viral pA sites. Canonical PAS sequences are bolded and underlined and the putative UGUA motifs (TGTA in cDNA) are underlined. Below is chromatograph of representative sequence showing the position of PAS (underlined) and cleavage site (arrow).

    Journal: PLoS Pathogens

    Article Title: The full transcription map of mouse papillomavirus type 1 (MmuPV1) in mouse wart tissues

    doi: 10.1371/journal.ppat.1006715

    Figure Lengend Snippet: Mapping of polyadenylation cleavage sites for MmuPV1 transcripts. (A) The diagram depicting MmuPV1 genome with the position of primers used in 3’RACE analysis and three predicted canonical polyadenylation signals (PAS). The associated number represents the nt position in the MmuPV1 genome. (B-C) Mapping of MmuPV1 polyadenylation cleavage sites by 3′RACE was conducted on total RNA isolated from MmuPV1-infected wart tissues using MmuPV1-specific primer Pr3277 for viral early (B) or Pr6846 for viral late transcripts (C). The obtained RACE products (arrows) were gel purified, cloned, and sequenced. Sequence readings on the right show frequency and positon of all mapped cleavage sites for early (B) or late (C) viral pA sites. Canonical PAS sequences are bolded and underlined and the putative UGUA motifs (TGTA in cDNA) are underlined. Below is chromatograph of representative sequence showing the position of PAS (underlined) and cleavage site (arrow).

    Article Snippet: Rapid amplification of cDNA ends (RACE) and PacBio Iso-seq sequencing The 5′ and 3′ RACE assays were carried out using a Smart RACE cDNA amplification kit (Clontech, Mountain View, CA, #634858) according to the manufacturer’s instructions using 1 μg/reaction of total RNA as template [ ].

    Techniques: Isolation, Infection, Purification, Clone Assay, Sequencing

    Heterogeneous FAPs population consists of distinct subpopulations of cells. a Experimental workflow for single cell gene expression analysis. Hindlimb muscles of C57Bl/10 mice were isolated, minced, and enzymatically digested. FAPs were isolated by FACS and loaded on the C1 System (Fluidigm) to extract RNA, reverse transcribe RNA to cDNA and pre-amplify cDNA from each single cell. Real-time qPCR analysis of single cell-derived cDNA was performed on the Biomark platform (Fluidigm) for 87 genes. b Principal component analysis (PCA) of single cell gene expression values of FAPs isolated from WT, WT notexin-injured day 3 (WT-inj d3) and dystrophic MDX mice. c Self organizing maps (SOM) representation of gene expression in clusters of single FAP cells. Each circle is a cluster of single cells and the fill color represents the level of expression for each gene shown. The expression scale is shown on the left for each gene individually. Expression is measured as Log 2 Ex (Log 2 Ex = Ct (LOD) -Ct (gene) ) with LOD = 24 (limit of detection) and Ct = cycle threshold. d Correlation matrix of single cell gene expression across all cells. Orange color marks high positive correlation, green color marks high negative correlation. Groups of genes outlined in blue are positively correlated, while the genes outlined in green are negatively correlated. e Expression scatterplot of Tek and Vcam1 gene expression. Cutoff is set at 7 Log 2 Ex for both genes based on the SOM graph ( c ). Tek and Vcam1 expression levels define the predicted subpopulations, marked as Tek(Tie2)+/Vcam− (Tek+) in dark blue, Vcam1+/Tek(Tie2)− (Vcam1+) in brown, double positive (DP) in light blue and double negative (DN) in gold. f The same PCA as in Fig. 1a but with cells color coded based on the FAPs subpopulations predicted in Fig. 1e. g Distribution of subpopulations in each experimental condition ( n = 2)

    Journal: Nature Communications

    Article Title: Dynamics of cellular states of fibro-adipogenic progenitors during myogenesis and muscular dystrophy

    doi: 10.1038/s41467-018-06068-6

    Figure Lengend Snippet: Heterogeneous FAPs population consists of distinct subpopulations of cells. a Experimental workflow for single cell gene expression analysis. Hindlimb muscles of C57Bl/10 mice were isolated, minced, and enzymatically digested. FAPs were isolated by FACS and loaded on the C1 System (Fluidigm) to extract RNA, reverse transcribe RNA to cDNA and pre-amplify cDNA from each single cell. Real-time qPCR analysis of single cell-derived cDNA was performed on the Biomark platform (Fluidigm) for 87 genes. b Principal component analysis (PCA) of single cell gene expression values of FAPs isolated from WT, WT notexin-injured day 3 (WT-inj d3) and dystrophic MDX mice. c Self organizing maps (SOM) representation of gene expression in clusters of single FAP cells. Each circle is a cluster of single cells and the fill color represents the level of expression for each gene shown. The expression scale is shown on the left for each gene individually. Expression is measured as Log 2 Ex (Log 2 Ex = Ct (LOD) -Ct (gene) ) with LOD = 24 (limit of detection) and Ct = cycle threshold. d Correlation matrix of single cell gene expression across all cells. Orange color marks high positive correlation, green color marks high negative correlation. Groups of genes outlined in blue are positively correlated, while the genes outlined in green are negatively correlated. e Expression scatterplot of Tek and Vcam1 gene expression. Cutoff is set at 7 Log 2 Ex for both genes based on the SOM graph ( c ). Tek and Vcam1 expression levels define the predicted subpopulations, marked as Tek(Tie2)+/Vcam− (Tek+) in dark blue, Vcam1+/Tek(Tie2)− (Vcam1+) in brown, double positive (DP) in light blue and double negative (DN) in gold. f The same PCA as in Fig. 1a but with cells color coded based on the FAPs subpopulations predicted in Fig. 1e. g Distribution of subpopulations in each experimental condition ( n = 2)

    Article Snippet: BioMark real-time PCR on single cell cDNA Collected pre-amplified cDNA was analysed by real-time PCR using Fast Gene Expression Analysis protocol with EvaGreen® on the BioMark HD System with 87 selected gene-specific assays (Supplementary Table ) (protocol #68000088, Fluidigm), skipping the exonuclease I treatment of C1 collected cDNA .

    Techniques: Expressing, Mouse Assay, Isolation, FACS, Real-time Polymerase Chain Reaction, Derivative Assay

    Expression pattern of the cpk transcript and characterization of the predicted protein product. ( a ) The tissue distribution of the 2.2-kb cpk transcript is shown in adult mouse tissues. The size of the polyadenylated transcript is consistent with the 1,856-bp full-length cDNA. The size markers are indicated on the left and expressed as kilobases. ( b ) Northern blot analysis of mouse fetal poly(A + ) RNA revealed a 2.2-kb transcript in the fetal kidney. ( c ) Northern blot analysis of human fetal poly(A + ) RNA revealed a 2.4-kb transcript in the fetal kidney. ( d ) The relative expression of the 2.2-kb cpk transcript is shown in kidney and liver poly(A + ) RNA from 2-week-old B6-WT ( n = 5 mice) and B6- cpk/cpk ( n = 5 mice) (top panel). Rehybridization with Gapdh cDNA served as a loading control (middle panel). RT-PCR was performed using the deletion-flanking primer pairs on the same poly(A + ) RNAs (bottom panel). ( e ) Amino acid sequence of the predicted 145-AA protein product. Two potential myristoylation sites (residues 2–7, 43–48, indicated by asterisks) are predicted, the first of which is coupled to a polybasic domain (underlined).

    Journal: The Journal of Clinical Investigation

    Article Title: Cystin, a novel cilia-associated protein, is disrupted in the cpk mouse model of polycystic kidney disease

    doi: 10.1172/JCI14099

    Figure Lengend Snippet: Expression pattern of the cpk transcript and characterization of the predicted protein product. ( a ) The tissue distribution of the 2.2-kb cpk transcript is shown in adult mouse tissues. The size of the polyadenylated transcript is consistent with the 1,856-bp full-length cDNA. The size markers are indicated on the left and expressed as kilobases. ( b ) Northern blot analysis of mouse fetal poly(A + ) RNA revealed a 2.2-kb transcript in the fetal kidney. ( c ) Northern blot analysis of human fetal poly(A + ) RNA revealed a 2.4-kb transcript in the fetal kidney. ( d ) The relative expression of the 2.2-kb cpk transcript is shown in kidney and liver poly(A + ) RNA from 2-week-old B6-WT ( n = 5 mice) and B6- cpk/cpk ( n = 5 mice) (top panel). Rehybridization with Gapdh cDNA served as a loading control (middle panel). RT-PCR was performed using the deletion-flanking primer pairs on the same poly(A + ) RNAs (bottom panel). ( e ) Amino acid sequence of the predicted 145-AA protein product. Two potential myristoylation sites (residues 2–7, 43–48, indicated by asterisks) are predicted, the first of which is coupled to a polybasic domain (underlined).

    Article Snippet: To obtain the 5′ end of the cDNA sequence, we amplified cDNA from mouse kidney by 5′ rapid amplification of cDNA ends–PCR (RACE-PCR) using the Marathon cDNA Amplification kit (BD Biosciences Clontech, Palo Alto, California, USA).

    Techniques: Expressing, Northern Blot, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Sequencing

    icM 2 reveals structured elements in the hyperconserved Csde1 5’UTR A) Schematic of localized perturbation patterns that may be observed in M 2 data. Here, the mutant does not disrupt the overall structure and “releases” its base pairing partner. This results in an increase of chemical accessibility signal at the interacting nucleotide. Systematic profiling of accessibilities by M 2 results in an array of such mutant accessibility data into an approximate contact map. B) Schematic of global rearrangement patterns that may be observed in M 2 data. Here, multiple conformations of the RNA molecule are present together in an ensemble at non-negligible relative proportions. Mutations can shift this balance, such that one structural state is favored over the other. In this case, M 2 reveals large-scale accessibility perturbations across a longer stretch of the RNA molecule. Multiple mutations often impact the relative proportions in similar ways, which manifests as correlated arrays accessibility changes in M 2 data matrix. C) Schematic of the icM 2 method. Mutagenesis library of the target RNA of interest is first generated using error-prone PCR followed by cloning into an expression vector. The cells are transfected with the library and treated with DMS. Total RNAs are extracted. Read-through reverse transcription encodes DMS-modified nucleotides as mutations on the cDNA, which are read out by high-throughput sequencing. Correlated mutations in sequencing reads are then quantified and the resultant covariation matrix is analyzed for signature perturbation patterns. D) Heatmap of icM 2 accessibility matrix for Csde1 5’UTR from position 190 to 386. For each row, the chemical mapping profile of a single-nucleotide variant of the RNA is plotted across the columns, where the colors indicate z-scaled accessibility change values from the wild-type RNA. 1D data from each mutant are vertically stacked to display a 2D matrix. White boxes mark the two regions (A: positions 334-363 and B: positions 215-315) that display strong perturbation signals that reveal their structures. E) A structure model (structure W) of region A. Bases colored in red indicate mutations with accessibility changes observed in icM 2 data that are consistent with the model. F) Scatter plot showing correlations of per-nucleotide accessibilities between each mutant versus the “wild-type” (wild-type accessibilities are not directly measured, but mean accessibilities of 10 lowest variable mutants are used as a close approximation) on the y-axis and nucleotide positions along the x-axis. p indicates Wilcoxon rank sum test p-value for the difference in distributions of correlations between region B versus other nucleotides. G) Multiple species alignment for Csde1 5’UTR from position 125 to 548. For each row, the sequence alignment of a species is plotted across the columns, where the colors indicate match/substitution/insertion/deletion at each nucleotide. The alignment positions are relative to the mouse sequence. The top row is the mouse alignment, colored separately from other rows as a reference to indicate the identity of the bases in each position in the multiple species alignment.

    Journal: bioRxiv

    Article Title: Functional and structural basis of extreme non-coding conservation in vertebrate mRNAs

    doi: 10.1101/2020.06.29.165878

    Figure Lengend Snippet: icM 2 reveals structured elements in the hyperconserved Csde1 5’UTR A) Schematic of localized perturbation patterns that may be observed in M 2 data. Here, the mutant does not disrupt the overall structure and “releases” its base pairing partner. This results in an increase of chemical accessibility signal at the interacting nucleotide. Systematic profiling of accessibilities by M 2 results in an array of such mutant accessibility data into an approximate contact map. B) Schematic of global rearrangement patterns that may be observed in M 2 data. Here, multiple conformations of the RNA molecule are present together in an ensemble at non-negligible relative proportions. Mutations can shift this balance, such that one structural state is favored over the other. In this case, M 2 reveals large-scale accessibility perturbations across a longer stretch of the RNA molecule. Multiple mutations often impact the relative proportions in similar ways, which manifests as correlated arrays accessibility changes in M 2 data matrix. C) Schematic of the icM 2 method. Mutagenesis library of the target RNA of interest is first generated using error-prone PCR followed by cloning into an expression vector. The cells are transfected with the library and treated with DMS. Total RNAs are extracted. Read-through reverse transcription encodes DMS-modified nucleotides as mutations on the cDNA, which are read out by high-throughput sequencing. Correlated mutations in sequencing reads are then quantified and the resultant covariation matrix is analyzed for signature perturbation patterns. D) Heatmap of icM 2 accessibility matrix for Csde1 5’UTR from position 190 to 386. For each row, the chemical mapping profile of a single-nucleotide variant of the RNA is plotted across the columns, where the colors indicate z-scaled accessibility change values from the wild-type RNA. 1D data from each mutant are vertically stacked to display a 2D matrix. White boxes mark the two regions (A: positions 334-363 and B: positions 215-315) that display strong perturbation signals that reveal their structures. E) A structure model (structure W) of region A. Bases colored in red indicate mutations with accessibility changes observed in icM 2 data that are consistent with the model. F) Scatter plot showing correlations of per-nucleotide accessibilities between each mutant versus the “wild-type” (wild-type accessibilities are not directly measured, but mean accessibilities of 10 lowest variable mutants are used as a close approximation) on the y-axis and nucleotide positions along the x-axis. p indicates Wilcoxon rank sum test p-value for the difference in distributions of correlations between region B versus other nucleotides. G) Multiple species alignment for Csde1 5’UTR from position 125 to 548. For each row, the sequence alignment of a species is plotted across the columns, where the colors indicate match/substitution/insertion/deletion at each nucleotide. The alignment positions are relative to the mouse sequence. The top row is the mouse alignment, colored separately from other rows as a reference to indicate the identity of the bases in each position in the multiple species alignment.

    Article Snippet: The final construct has a flanking primer region for cDNA amplification upstream of the mutagenized 5’UTR and EGFP open reading frame downstream.

    Techniques: Mutagenesis, Generated, Polymerase Chain Reaction, Clone Assay, Expressing, Plasmid Preparation, Transfection, Modification, Next-Generation Sequencing, Sequencing, Variant Assay

    Nucleotide sequence of the medaka boule cDNA. O bol and its deduced protein OBol: shown in bold are the translation start codon, stop codon and putative poly-adenylation signal. Highlighted are RRM motif (Turquoise) and DAZ motif (light grey). Underlined are primer sequences for 5′ RACE (dash) and RT-PCR (solid, fragment for RNA probe) with arrows depicting their extension directions.

    Journal: PLoS ONE

    Article Title: Boule Is Present in Fish and Bisexually Expressed in Adult and Embryonic Germ Cells of Medaka

    doi: 10.1371/journal.pone.0006097

    Figure Lengend Snippet: Nucleotide sequence of the medaka boule cDNA. O bol and its deduced protein OBol: shown in bold are the translation start codon, stop codon and putative poly-adenylation signal. Highlighted are RRM motif (Turquoise) and DAZ motif (light grey). Underlined are primer sequences for 5′ RACE (dash) and RT-PCR (solid, fragment for RNA probe) with arrows depicting their extension directions.

    Article Snippet: SMART cDNA libraries were synthesized by using the RACE cDNA Amplification Kit according to the manufacturers' instructions (BD BioSciences).

    Techniques: Sequencing, Reverse Transcription Polymerase Chain Reaction