bsai-digested promoter fragment Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs bsai
    Cloning strategy. The vector contains two appropriately oriented <t>BsaI</t> sites (A) upon digestion with BsaI linearized vector is obtained with ends having 4-base 5′-overhangs (B) shown in red. The recognition sequence of restriction enzyme BsaI are underlined and the cleavage site is marked. The Gene Of Interest (GOI) is amplified using two gene-specific primers with 7-base long additional sequence at the 5′ end (C) shown in bold. Treatment of PCR product with T4 <t>DNA</t> polymerase and dTTP produces two different four-base overhangs that are complementary to two ends of the linearized vector shown in red (D). The ligation results in direction cloning of the insert into the vector (E).
    Bsai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1269 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsai/product/New England Biolabs
    Average 99 stars, based on 1269 article reviews
    Price from $9.99 to $1999.99
    bsai - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher t4 ligase enzyme
    Cloning strategy. The vector contains two appropriately oriented <t>BsaI</t> sites (A) upon digestion with BsaI linearized vector is obtained with ends having 4-base 5′-overhangs (B) shown in red. The recognition sequence of restriction enzyme BsaI are underlined and the cleavage site is marked. The Gene Of Interest (GOI) is amplified using two gene-specific primers with 7-base long additional sequence at the 5′ end (C) shown in bold. Treatment of PCR product with T4 <t>DNA</t> polymerase and dTTP produces two different four-base overhangs that are complementary to two ends of the linearized vector shown in red (D). The ligation results in direction cloning of the insert into the vector (E).
    T4 Ligase Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 41 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 ligase enzyme/product/Thermo Fisher
    Average 99 stars, based on 41 article reviews
    Price from $9.99 to $1999.99
    t4 ligase enzyme - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    TaKaRa pegfp n1
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    Pegfp N1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 14657 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pegfp n1/product/TaKaRa
    Average 99 stars, based on 14657 article reviews
    Price from $9.99 to $1999.99
    pegfp n1 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs t4 dna ligase
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    T4 Dna Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 38631 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/New England Biolabs
    Average 99 stars, based on 38631 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    96
    Millipore expression vector pet28a
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    Expression Vector Pet28a, supplied by Millipore, used in various techniques. Bioz Stars score: 96/100, based on 2358 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expression vector pet28a/product/Millipore
    Average 96 stars, based on 2358 article reviews
    Price from $9.99 to $1999.99
    expression vector pet28a - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    99
    New England Biolabs q5 high fidelity dna polymerase
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    Q5 High Fidelity Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 7444 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 high fidelity dna polymerase/product/New England Biolabs
    Average 99 stars, based on 7444 article reviews
    Price from $9.99 to $1999.99
    q5 high fidelity dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    ptad  (TaKaRa)
    87
    TaKaRa ptad
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    Ptad, supplied by TaKaRa, used in various techniques. Bioz Stars score: 87/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ptad/product/TaKaRa
    Average 87 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    ptad - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    94
    GenScript puc57 kan vector
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    Puc57 Kan Vector, supplied by GenScript, used in various techniques. Bioz Stars score: 94/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/puc57 kan vector/product/GenScript
    Average 94 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    puc57 kan vector - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    90
    New England Biolabs q5 mutagenesis
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    Q5 Mutagenesis, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 199 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/q5 mutagenesis/product/New England Biolabs
    Average 90 stars, based on 199 article reviews
    Price from $9.99 to $1999.99
    q5 mutagenesis - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    97
    Thermo Fisher bsai
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    Bsai, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 163 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsai/product/Thermo Fisher
    Average 97 stars, based on 163 article reviews
    Price from $9.99 to $1999.99
    bsai - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    85
    TaKaRa pebfp n1 plasmid
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    Pebfp N1 Plasmid, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pebfp n1 plasmid/product/TaKaRa
    Average 85 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    pebfp n1 plasmid - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    99
    Addgene inc cas9
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 99/100, based on 2515 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cas9/product/Addgene inc
    Average 99 stars, based on 2515 article reviews
    Price from $9.99 to $1999.99
    cas9 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher eco 31i
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    Eco 31i, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 50 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/eco 31i/product/Thermo Fisher
    Average 99 stars, based on 50 article reviews
    Price from $9.99 to $1999.99
    eco 31i - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs dna polymerase
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 3856 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase/product/New England Biolabs
    Average 99 stars, based on 3856 article reviews
    Price from $9.99 to $1999.99
    dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    TaKaRa hindiii
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    Hindiii, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 2831 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hindiii/product/TaKaRa
    Average 99 stars, based on 2831 article reviews
    Price from $9.99 to $1999.99
    hindiii - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    92
    Addgene inc pcs2tal3dd
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    Pcs2tal3dd, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcs2tal3dd/product/Addgene inc
    Average 92 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    pcs2tal3dd - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    97
    Millipore e coli strain rosetta 2
    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with <t>pEGFP-N1,</t> using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p
    E Coli Strain Rosetta 2, supplied by Millipore, used in various techniques. Bioz Stars score: 97/100, based on 309 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli strain rosetta 2/product/Millipore
    Average 97 stars, based on 309 article reviews
    Price from $9.99 to $1999.99
    e coli strain rosetta 2 - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    91
    GenScript grna scaffold
    <t>gRNA</t> expressed from the <t>U6T7</t> hybrid promoter creates INDELs in mouse 3T3 cells. Expression vectors containing the pU6T7 hybrid promoter as well as vectors containing only a T7 promoter (pDR274) or hU6 promoter (pX330) were transfected into NIH-3T3 cells. Vectors containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24, pX330-C24 G, pX330-C24 GG. Vectors serving as controls lack the C24 sequence (pU6T7, pU6T7G, pDR274, and pX330). The pU6T7 and pDR274 vectors were cotransfected with a CAS9 plasmid whereas the pX330 vector contains its own CAS9 gene expressed via the CMV promoter. The CAS9 expression vector used for co-transfections is the hCAS9 plasmid. M, 100 bp ladder marker (NEB). + and–indicate the presence and absence of the components in each plasmid vector, respectively,. Boxed indicators represent 3T3 cells with INDELs detected at the ROSA26 locus. Arrows indicate T7 endonuclease cleavage products. Non-transfected cells were also assayed for INDELs (Lane 16).
    Grna Scaffold, supplied by GenScript, used in various techniques. Bioz Stars score: 91/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/grna scaffold/product/GenScript
    Average 91 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    grna scaffold - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    99
    Thermo Fisher multisite gatewaytm system
    <t>gRNA</t> expressed from the <t>U6T7</t> hybrid promoter creates INDELs in mouse 3T3 cells. Expression vectors containing the pU6T7 hybrid promoter as well as vectors containing only a T7 promoter (pDR274) or hU6 promoter (pX330) were transfected into NIH-3T3 cells. Vectors containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24, pX330-C24 G, pX330-C24 GG. Vectors serving as controls lack the C24 sequence (pU6T7, pU6T7G, pDR274, and pX330). The pU6T7 and pDR274 vectors were cotransfected with a CAS9 plasmid whereas the pX330 vector contains its own CAS9 gene expressed via the CMV promoter. The CAS9 expression vector used for co-transfections is the hCAS9 plasmid. M, 100 bp ladder marker (NEB). + and–indicate the presence and absence of the components in each plasmid vector, respectively,. Boxed indicators represent 3T3 cells with INDELs detected at the ROSA26 locus. Arrows indicate T7 endonuclease cleavage products. Non-transfected cells were also assayed for INDELs (Lane 16).
    Multisite Gatewaytm System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/multisite gatewaytm system/product/Thermo Fisher
    Average 99 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    multisite gatewaytm system - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    TaKaRa bsrgi
    <t>gRNA</t> expressed from the <t>U6T7</t> hybrid promoter creates INDELs in mouse 3T3 cells. Expression vectors containing the pU6T7 hybrid promoter as well as vectors containing only a T7 promoter (pDR274) or hU6 promoter (pX330) were transfected into NIH-3T3 cells. Vectors containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24, pX330-C24 G, pX330-C24 GG. Vectors serving as controls lack the C24 sequence (pU6T7, pU6T7G, pDR274, and pX330). The pU6T7 and pDR274 vectors were cotransfected with a CAS9 plasmid whereas the pX330 vector contains its own CAS9 gene expressed via the CMV promoter. The CAS9 expression vector used for co-transfections is the hCAS9 plasmid. M, 100 bp ladder marker (NEB). + and–indicate the presence and absence of the components in each plasmid vector, respectively,. Boxed indicators represent 3T3 cells with INDELs detected at the ROSA26 locus. Arrows indicate T7 endonuclease cleavage products. Non-transfected cells were also assayed for INDELs (Lane 16).
    Bsrgi, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 160 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsrgi/product/TaKaRa
    Average 94 stars, based on 160 article reviews
    Price from $9.99 to $1999.99
    bsrgi - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    93
    TaKaRa in fusion advantage pcr cloning kits
    <t>gRNA</t> expressed from the <t>U6T7</t> hybrid promoter creates INDELs in mouse 3T3 cells. Expression vectors containing the pU6T7 hybrid promoter as well as vectors containing only a T7 promoter (pDR274) or hU6 promoter (pX330) were transfected into NIH-3T3 cells. Vectors containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24, pX330-C24 G, pX330-C24 GG. Vectors serving as controls lack the C24 sequence (pU6T7, pU6T7G, pDR274, and pX330). The pU6T7 and pDR274 vectors were cotransfected with a CAS9 plasmid whereas the pX330 vector contains its own CAS9 gene expressed via the CMV promoter. The CAS9 expression vector used for co-transfections is the hCAS9 plasmid. M, 100 bp ladder marker (NEB). + and–indicate the presence and absence of the components in each plasmid vector, respectively,. Boxed indicators represent 3T3 cells with INDELs detected at the ROSA26 locus. Arrows indicate T7 endonuclease cleavage products. Non-transfected cells were also assayed for INDELs (Lane 16).
    In Fusion Advantage Pcr Cloning Kits, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 90 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/in fusion advantage pcr cloning kits/product/TaKaRa
    Average 93 stars, based on 90 article reviews
    Price from $9.99 to $1999.99
    in fusion advantage pcr cloning kits - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    99
    Millipore bamhi
    <t>gRNA</t> expressed from the <t>U6T7</t> hybrid promoter creates INDELs in mouse 3T3 cells. Expression vectors containing the pU6T7 hybrid promoter as well as vectors containing only a T7 promoter (pDR274) or hU6 promoter (pX330) were transfected into NIH-3T3 cells. Vectors containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24, pX330-C24 G, pX330-C24 GG. Vectors serving as controls lack the C24 sequence (pU6T7, pU6T7G, pDR274, and pX330). The pU6T7 and pDR274 vectors were cotransfected with a CAS9 plasmid whereas the pX330 vector contains its own CAS9 gene expressed via the CMV promoter. The CAS9 expression vector used for co-transfections is the hCAS9 plasmid. M, 100 bp ladder marker (NEB). + and–indicate the presence and absence of the components in each plasmid vector, respectively,. Boxed indicators represent 3T3 cells with INDELs detected at the ROSA26 locus. Arrows indicate T7 endonuclease cleavage products. Non-transfected cells were also assayed for INDELs (Lane 16).
    Bamhi, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 5283 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bamhi/product/Millipore
    Average 99 stars, based on 5283 article reviews
    Price from $9.99 to $1999.99
    bamhi - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore ndei
    <t>gRNA</t> expressed from the <t>U6T7</t> hybrid promoter creates INDELs in mouse 3T3 cells. Expression vectors containing the pU6T7 hybrid promoter as well as vectors containing only a T7 promoter (pDR274) or hU6 promoter (pX330) were transfected into NIH-3T3 cells. Vectors containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24, pX330-C24 G, pX330-C24 GG. Vectors serving as controls lack the C24 sequence (pU6T7, pU6T7G, pDR274, and pX330). The pU6T7 and pDR274 vectors were cotransfected with a CAS9 plasmid whereas the pX330 vector contains its own CAS9 gene expressed via the CMV promoter. The CAS9 expression vector used for co-transfections is the hCAS9 plasmid. M, 100 bp ladder marker (NEB). + and–indicate the presence and absence of the components in each plasmid vector, respectively,. Boxed indicators represent 3T3 cells with INDELs detected at the ROSA26 locus. Arrows indicate T7 endonuclease cleavage products. Non-transfected cells were also assayed for INDELs (Lane 16).
    Ndei, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 11569 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ndei/product/Millipore
    Average 99 stars, based on 11569 article reviews
    Price from $9.99 to $1999.99
    ndei - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    IBA GmbH pask iba33plus
    <t>gRNA</t> expressed from the <t>U6T7</t> hybrid promoter creates INDELs in mouse 3T3 cells. Expression vectors containing the pU6T7 hybrid promoter as well as vectors containing only a T7 promoter (pDR274) or hU6 promoter (pX330) were transfected into NIH-3T3 cells. Vectors containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24, pX330-C24 G, pX330-C24 GG. Vectors serving as controls lack the C24 sequence (pU6T7, pU6T7G, pDR274, and pX330). The pU6T7 and pDR274 vectors were cotransfected with a CAS9 plasmid whereas the pX330 vector contains its own CAS9 gene expressed via the CMV promoter. The CAS9 expression vector used for co-transfections is the hCAS9 plasmid. M, 100 bp ladder marker (NEB). + and–indicate the presence and absence of the components in each plasmid vector, respectively,. Boxed indicators represent 3T3 cells with INDELs detected at the ROSA26 locus. Arrows indicate T7 endonuclease cleavage products. Non-transfected cells were also assayed for INDELs (Lane 16).
    Pask Iba33plus, supplied by IBA GmbH, used in various techniques. Bioz Stars score: 86/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pask iba33plus/product/IBA GmbH
    Average 86 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    pask iba33plus - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    90
    New England Biolabs large klenow fragment
    <t>gRNA</t> expressed from the <t>U6T7</t> hybrid promoter creates INDELs in mouse 3T3 cells. Expression vectors containing the pU6T7 hybrid promoter as well as vectors containing only a T7 promoter (pDR274) or hU6 promoter (pX330) were transfected into NIH-3T3 cells. Vectors containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24, pX330-C24 G, pX330-C24 GG. Vectors serving as controls lack the C24 sequence (pU6T7, pU6T7G, pDR274, and pX330). The pU6T7 and pDR274 vectors were cotransfected with a CAS9 plasmid whereas the pX330 vector contains its own CAS9 gene expressed via the CMV promoter. The CAS9 expression vector used for co-transfections is the hCAS9 plasmid. M, 100 bp ladder marker (NEB). + and–indicate the presence and absence of the components in each plasmid vector, respectively,. Boxed indicators represent 3T3 cells with INDELs detected at the ROSA26 locus. Arrows indicate T7 endonuclease cleavage products. Non-transfected cells were also assayed for INDELs (Lane 16).
    Large Klenow Fragment, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 933 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/large klenow fragment/product/New England Biolabs
    Average 90 stars, based on 933 article reviews
    Price from $9.99 to $1999.99
    large klenow fragment - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    98
    Millipore pet24a
    <t>gRNA</t> expressed from the <t>U6T7</t> hybrid promoter creates INDELs in mouse 3T3 cells. Expression vectors containing the pU6T7 hybrid promoter as well as vectors containing only a T7 promoter (pDR274) or hU6 promoter (pX330) were transfected into NIH-3T3 cells. Vectors containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24, pX330-C24 G, pX330-C24 GG. Vectors serving as controls lack the C24 sequence (pU6T7, pU6T7G, pDR274, and pX330). The pU6T7 and pDR274 vectors were cotransfected with a CAS9 plasmid whereas the pX330 vector contains its own CAS9 gene expressed via the CMV promoter. The CAS9 expression vector used for co-transfections is the hCAS9 plasmid. M, 100 bp ladder marker (NEB). + and–indicate the presence and absence of the components in each plasmid vector, respectively,. Boxed indicators represent 3T3 cells with INDELs detected at the ROSA26 locus. Arrows indicate T7 endonuclease cleavage products. Non-transfected cells were also assayed for INDELs (Lane 16).
    Pet24a, supplied by Millipore, used in various techniques. Bioz Stars score: 98/100, based on 1009 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pet24a/product/Millipore
    Average 98 stars, based on 1009 article reviews
    Price from $9.99 to $1999.99
    pet24a - by Bioz Stars, 2020-04
    98/100 stars
      Buy from Supplier

    93
    Zymo Research competent zymo 5a cells
    <t>gRNA</t> expressed from the <t>U6T7</t> hybrid promoter creates INDELs in mouse 3T3 cells. Expression vectors containing the pU6T7 hybrid promoter as well as vectors containing only a T7 promoter (pDR274) or hU6 promoter (pX330) were transfected into NIH-3T3 cells. Vectors containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24, pX330-C24 G, pX330-C24 GG. Vectors serving as controls lack the C24 sequence (pU6T7, pU6T7G, pDR274, and pX330). The pU6T7 and pDR274 vectors were cotransfected with a CAS9 plasmid whereas the pX330 vector contains its own CAS9 gene expressed via the CMV promoter. The CAS9 expression vector used for co-transfections is the hCAS9 plasmid. M, 100 bp ladder marker (NEB). + and–indicate the presence and absence of the components in each plasmid vector, respectively,. Boxed indicators represent 3T3 cells with INDELs detected at the ROSA26 locus. Arrows indicate T7 endonuclease cleavage products. Non-transfected cells were also assayed for INDELs (Lane 16).
    Competent Zymo 5a Cells, supplied by Zymo Research, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/competent zymo 5a cells/product/Zymo Research
    Average 93 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    competent zymo 5a cells - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    94
    New England Biolabs bbsi restriction enzyme
    <t>gRNA</t> expressed from the <t>U6T7</t> hybrid promoter creates INDELs in mouse 3T3 cells. Expression vectors containing the pU6T7 hybrid promoter as well as vectors containing only a T7 promoter (pDR274) or hU6 promoter (pX330) were transfected into NIH-3T3 cells. Vectors containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24, pX330-C24 G, pX330-C24 GG. Vectors serving as controls lack the C24 sequence (pU6T7, pU6T7G, pDR274, and pX330). The pU6T7 and pDR274 vectors were cotransfected with a CAS9 plasmid whereas the pX330 vector contains its own CAS9 gene expressed via the CMV promoter. The CAS9 expression vector used for co-transfections is the hCAS9 plasmid. M, 100 bp ladder marker (NEB). + and–indicate the presence and absence of the components in each plasmid vector, respectively,. Boxed indicators represent 3T3 cells with INDELs detected at the ROSA26 locus. Arrows indicate T7 endonuclease cleavage products. Non-transfected cells were also assayed for INDELs (Lane 16).
    Bbsi Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 59 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bbsi restriction enzyme/product/New England Biolabs
    Average 94 stars, based on 59 article reviews
    Price from $9.99 to $1999.99
    bbsi restriction enzyme - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    Cloning strategy. The vector contains two appropriately oriented BsaI sites (A) upon digestion with BsaI linearized vector is obtained with ends having 4-base 5′-overhangs (B) shown in red. The recognition sequence of restriction enzyme BsaI are underlined and the cleavage site is marked. The Gene Of Interest (GOI) is amplified using two gene-specific primers with 7-base long additional sequence at the 5′ end (C) shown in bold. Treatment of PCR product with T4 DNA polymerase and dTTP produces two different four-base overhangs that are complementary to two ends of the linearized vector shown in red (D). The ligation results in direction cloning of the insert into the vector (E).

    Journal: PLoS ONE

    Article Title: Rapid Restriction Enzyme-Free Cloning of PCR Products: A High-Throughput Method Applicable for Library Construction

    doi: 10.1371/journal.pone.0111538

    Figure Lengend Snippet: Cloning strategy. The vector contains two appropriately oriented BsaI sites (A) upon digestion with BsaI linearized vector is obtained with ends having 4-base 5′-overhangs (B) shown in red. The recognition sequence of restriction enzyme BsaI are underlined and the cleavage site is marked. The Gene Of Interest (GOI) is amplified using two gene-specific primers with 7-base long additional sequence at the 5′ end (C) shown in bold. Treatment of PCR product with T4 DNA polymerase and dTTP produces two different four-base overhangs that are complementary to two ends of the linearized vector shown in red (D). The ligation results in direction cloning of the insert into the vector (E).

    Article Snippet: The vector for cloning was prepared by digesting 10 µg plasmid DNA in a total volume of 400 µl with 400 units of BsaI (New England Biolabs, Ipswich, MA, USA) added in four aliquots during the 4 h incubation at 50°C.

    Techniques: Clone Assay, Plasmid Preparation, Sequencing, Amplification, Polymerase Chain Reaction, Ligation

    Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with pEGFP-N1, using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p

    Journal: Cytotechnology

    Article Title: Optimizing the generation of stable neuronal cell lines via pre-transfection restriction enzyme digestion of plasmid DNA

    doi: 10.1007/s10616-010-9273-1

    Figure Lengend Snippet: Transient transfection efficiency of Neuro2a and HT22 neuronal cells. A 24 h after transfection with pEGFP-N1, using Lipofectamine-LTX, cells were visualized and GFP-positive cells identified. (* p

    Article Snippet: BsaI digests pEGFP-N1 immediately prior to the mammalian eGFP promoter, in the pUC bacterial origin, while SspI linearizes the vector by cutting at two sites between eGFP and the antibiotic resistance gene, in the f1 bacterial origin, giving rise to a small 550 bp secondary fragment.

    Techniques: Transfection

    Stable integration efficiency of uncut and digested pEGFP-N1. 1.2 × 10 6 HT22 cells were transfected using Lipofectamine-LTX. Stable colonies were counted after 13 days of selection with G418 antibiotic. Values are represented

    Journal: Cytotechnology

    Article Title: Optimizing the generation of stable neuronal cell lines via pre-transfection restriction enzyme digestion of plasmid DNA

    doi: 10.1007/s10616-010-9273-1

    Figure Lengend Snippet: Stable integration efficiency of uncut and digested pEGFP-N1. 1.2 × 10 6 HT22 cells were transfected using Lipofectamine-LTX. Stable colonies were counted after 13 days of selection with G418 antibiotic. Values are represented

    Article Snippet: BsaI digests pEGFP-N1 immediately prior to the mammalian eGFP promoter, in the pUC bacterial origin, while SspI linearizes the vector by cutting at two sites between eGFP and the antibiotic resistance gene, in the f1 bacterial origin, giving rise to a small 550 bp secondary fragment.

    Techniques: Transfection, Selection

    Restriction enzyme digestion sites of pEGFP-N1. Bsa I linearizes pEGFP-N1 by a single digestion at 3,746 bp at the terminal end of the poly A-tail of the Neomycin resistance gene. Ssp I linearizes by removal of a small fragment from 1,665 to 2,218 bp,

    Journal: Cytotechnology

    Article Title: Optimizing the generation of stable neuronal cell lines via pre-transfection restriction enzyme digestion of plasmid DNA

    doi: 10.1007/s10616-010-9273-1

    Figure Lengend Snippet: Restriction enzyme digestion sites of pEGFP-N1. Bsa I linearizes pEGFP-N1 by a single digestion at 3,746 bp at the terminal end of the poly A-tail of the Neomycin resistance gene. Ssp I linearizes by removal of a small fragment from 1,665 to 2,218 bp,

    Article Snippet: BsaI digests pEGFP-N1 immediately prior to the mammalian eGFP promoter, in the pUC bacterial origin, while SspI linearizes the vector by cutting at two sites between eGFP and the antibiotic resistance gene, in the f1 bacterial origin, giving rise to a small 550 bp secondary fragment.

    Techniques:

    Stable transfection efficiency of pEGFP-N1 in HT22 neurons. 1.2 × 10 6 HT22 cells were transfected using Lipofectamine-LTX. Stable colonies were counted after 13 days of selection with G418 antibiotic (* p

    Journal: Cytotechnology

    Article Title: Optimizing the generation of stable neuronal cell lines via pre-transfection restriction enzyme digestion of plasmid DNA

    doi: 10.1007/s10616-010-9273-1

    Figure Lengend Snippet: Stable transfection efficiency of pEGFP-N1 in HT22 neurons. 1.2 × 10 6 HT22 cells were transfected using Lipofectamine-LTX. Stable colonies were counted after 13 days of selection with G418 antibiotic (* p

    Article Snippet: BsaI digests pEGFP-N1 immediately prior to the mammalian eGFP promoter, in the pUC bacterial origin, while SspI linearizes the vector by cutting at two sites between eGFP and the antibiotic resistance gene, in the f1 bacterial origin, giving rise to a small 550 bp secondary fragment.

    Techniques: Stable Transfection, Transfection, Selection

    gRNA expressed from the U6T7 hybrid promoter creates INDELs in mouse 3T3 cells. Expression vectors containing the pU6T7 hybrid promoter as well as vectors containing only a T7 promoter (pDR274) or hU6 promoter (pX330) were transfected into NIH-3T3 cells. Vectors containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24, pX330-C24 G, pX330-C24 GG. Vectors serving as controls lack the C24 sequence (pU6T7, pU6T7G, pDR274, and pX330). The pU6T7 and pDR274 vectors were cotransfected with a CAS9 plasmid whereas the pX330 vector contains its own CAS9 gene expressed via the CMV promoter. The CAS9 expression vector used for co-transfections is the hCAS9 plasmid. M, 100 bp ladder marker (NEB). + and–indicate the presence and absence of the components in each plasmid vector, respectively,. Boxed indicators represent 3T3 cells with INDELs detected at the ROSA26 locus. Arrows indicate T7 endonuclease cleavage products. Non-transfected cells were also assayed for INDELs (Lane 16).

    Journal: PLoS ONE

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs

    doi: 10.1371/journal.pone.0148362

    Figure Lengend Snippet: gRNA expressed from the U6T7 hybrid promoter creates INDELs in mouse 3T3 cells. Expression vectors containing the pU6T7 hybrid promoter as well as vectors containing only a T7 promoter (pDR274) or hU6 promoter (pX330) were transfected into NIH-3T3 cells. Vectors containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24, pX330-C24 G, pX330-C24 GG. Vectors serving as controls lack the C24 sequence (pU6T7, pU6T7G, pDR274, and pX330). The pU6T7 and pDR274 vectors were cotransfected with a CAS9 plasmid whereas the pX330 vector contains its own CAS9 gene expressed via the CMV promoter. The CAS9 expression vector used for co-transfections is the hCAS9 plasmid. M, 100 bp ladder marker (NEB). + and–indicate the presence and absence of the components in each plasmid vector, respectively,. Boxed indicators represent 3T3 cells with INDELs detected at the ROSA26 locus. Arrows indicate T7 endonuclease cleavage products. Non-transfected cells were also assayed for INDELs (Lane 16).

    Article Snippet: Construction of the U6T7 hybrid promoter The U6T7 hybrid promoter together with a gRNA scaffold was synthesized as a 373 bp product (Genscript) with the following sequence: AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGCTAATACGACTCACTA TAGG AGAGACCGAGAGAGGGTCTCA GTTT TAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT TTTAAA The fusion fragment was placed into the pUC57-Kan vector (Genscript) at the XbaI cloning site and the plasmid was designated pU6T7.

    Techniques: Expressing, Transfection, Sequencing, Plasmid Preparation, Marker

    gRNA produced by in vitro transcription from the U6T7 hybrid promoter directs cleavage of target DNA. gRNA were produced by in vitro transcription from the T7 promoter in the pU6T7 or the pDR274 vectors. The gRNAs, in the presence of CAS9 protein (NEB), cleaves the ROSA26 target site in vitro . The DNA template provided to test for CRISPR activity is a PCR product obtained from amplification of the ROSA26 gene locus. As a control, the mouse Fos gene amplicon was used as a template. Expression vectors with gRNAs containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24. Expression vectors lacking the ROSA26 template sequence are: pU6T7, pU6T7G, pDR274. Lanes 7 and 15 are the PCR amplicons containing ROSA26 and Fos gene target sequences, respectively. M, DNA size marker (NEB). Boxed vectors identify the transcribed gRNAs that produced INDELs at the target site after incubation with CAS9 protein. Arrows indicate the T7 endonuclease assay products.

    Journal: PLoS ONE

    Article Title: A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs

    doi: 10.1371/journal.pone.0148362

    Figure Lengend Snippet: gRNA produced by in vitro transcription from the U6T7 hybrid promoter directs cleavage of target DNA. gRNA were produced by in vitro transcription from the T7 promoter in the pU6T7 or the pDR274 vectors. The gRNAs, in the presence of CAS9 protein (NEB), cleaves the ROSA26 target site in vitro . The DNA template provided to test for CRISPR activity is a PCR product obtained from amplification of the ROSA26 gene locus. As a control, the mouse Fos gene amplicon was used as a template. Expression vectors with gRNAs containing the ROSA26 target sequence are: pU6T7-C24, pU6T7G-C24, pDR274-C24. Expression vectors lacking the ROSA26 template sequence are: pU6T7, pU6T7G, pDR274. Lanes 7 and 15 are the PCR amplicons containing ROSA26 and Fos gene target sequences, respectively. M, DNA size marker (NEB). Boxed vectors identify the transcribed gRNAs that produced INDELs at the target site after incubation with CAS9 protein. Arrows indicate the T7 endonuclease assay products.

    Article Snippet: Construction of the U6T7 hybrid promoter The U6T7 hybrid promoter together with a gRNA scaffold was synthesized as a 373 bp product (Genscript) with the following sequence: AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGCTAATACGACTCACTA TAGG AGAGACCGAGAGAGGGTCTCA GTTT TAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT TTTAAA The fusion fragment was placed into the pUC57-Kan vector (Genscript) at the XbaI cloning site and the plasmid was designated pU6T7.

    Techniques: Produced, In Vitro, CRISPR, Activity Assay, Polymerase Chain Reaction, Amplification, Expressing, Sequencing, Marker, Incubation