brd4 knockout Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Santa Cruz Biotechnology brd4 knockout ko
    I-BET726 inhibits <t>BRD4,</t> SphK1, and Akt signalings in human skin SCC cells. A431 cells or the primary human skin SCC cell (“C1/C2”) were treated with I-BET726 (5–100 n m ), cells were further cultured for 24 h, expression of listed proteins in total cell lysates were tested by western blotting a , h ; relative SphK1 activities d and ceramide levels e were tested. Expression of BRD4 and Tubulin in the stable A431 cells with CRISPR/Cas9 BRD4-KO plasmid (“BRD4-KO-sL1/2”) or Cas9 control construct (“Cas9-C”) was shown b ; Relative SphK1 activities ( f , the left panel) and ceramide levels g , the left panel were tested. Cas9-C cells or the BRD4-KO-sL1/2 cells were treated with or without I-BET726 (50 n m ) for 72 h, cell viability was tested by MTT assay c . A431 cells were treated with I-BET726 (50 n m ), CPI203 (500 n m ), JQ1 (500 n m ) or AZD5153 (“AZD”, 100 n m ) for 24 h, the SphK1 activities ( f , the right panel) and ceramide levels ( g , the right panel) were tested. Stable A431 cells with the constitutively active S473D mutant Akt1 (“caAkt1”) construct or the empty vector (“Vector”) were treated with or without I-BET726 (50 n m ) for applied time periods, expression of listed proteins were shown i . Cell viability (MTT viability, j and apoptosis activation (Annexin V-FACS/TUNEL staining, k and l were tested, and results were quantified. Expression of listed proteins was quantified and normalized to the loading control ( a , h and i ). * p
    Brd4 Knockout Ko, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/brd4 knockout ko/product/Santa Cruz Biotechnology
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    brd4 knockout ko - by Bioz Stars, 2021-09
    93/100 stars
      Buy from Supplier

    92
    Addgene inc brd4 knockout
    Genetic Inhibition of <t>BRD4</t> Overcomes MPNST Cell Resistance to Diverse BET Inhibitors. (A-B) (A) mMPNST and (B) S462 MPNST cells were treated BET inhibitors CPI-203, JQ1, or OTX 015 at the indicated concentrations for 3 days followed by cell viability analysis via ATP CellTiter-Glo assay. (C) mMPNST cells were treated with vehicle or BET inhibitors CPI-203, JQ1, or OTX 015 at the indicated concentrations for 4 days, followed by flow cytometry for Annexin V (+) apoptotic cells. (D) mMPNST cells with or without Brd4 depletion were treatment with vehicle or 1 μM of the indicated BET inhibitors followed by flow cytometry for Annexin V (+) apoptotic cells after 4 days (Inset: Western blot validation of shRNA mediated Brd4 depletion in mMPNST cells). (E-F) Comparative analysis of pan-BET inhibitors JQ1 and CPI-0610 on mMPNST cell viability. shControl and sh Brd4 cells were treated with doxycycline and JQ1 or CPI-0610 for 3 days followed by ATP CellTiter-Glo assay. Data are plotted (E) as multipoint dose response curves relative to vehicle (DMSO) and (F) as individual treatment points relative to vehicle (DMSO). All error bars and statistics are represented as the mean +/− SEM (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001).
    Brd4 Knockout, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/brd4 knockout/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    brd4 knockout - by Bioz Stars, 2021-09
    92/100 stars
      Buy from Supplier

    Image Search Results


    I-BET726 inhibits BRD4, SphK1, and Akt signalings in human skin SCC cells. A431 cells or the primary human skin SCC cell (“C1/C2”) were treated with I-BET726 (5–100 n m ), cells were further cultured for 24 h, expression of listed proteins in total cell lysates were tested by western blotting a , h ; relative SphK1 activities d and ceramide levels e were tested. Expression of BRD4 and Tubulin in the stable A431 cells with CRISPR/Cas9 BRD4-KO plasmid (“BRD4-KO-sL1/2”) or Cas9 control construct (“Cas9-C”) was shown b ; Relative SphK1 activities ( f , the left panel) and ceramide levels g , the left panel were tested. Cas9-C cells or the BRD4-KO-sL1/2 cells were treated with or without I-BET726 (50 n m ) for 72 h, cell viability was tested by MTT assay c . A431 cells were treated with I-BET726 (50 n m ), CPI203 (500 n m ), JQ1 (500 n m ) or AZD5153 (“AZD”, 100 n m ) for 24 h, the SphK1 activities ( f , the right panel) and ceramide levels ( g , the right panel) were tested. Stable A431 cells with the constitutively active S473D mutant Akt1 (“caAkt1”) construct or the empty vector (“Vector”) were treated with or without I-BET726 (50 n m ) for applied time periods, expression of listed proteins were shown i . Cell viability (MTT viability, j and apoptosis activation (Annexin V-FACS/TUNEL staining, k and l were tested, and results were quantified. Expression of listed proteins was quantified and normalized to the loading control ( a , h and i ). * p

    Journal: Cell Death & Disease

    Article Title: I-BET726 suppresses human skin squamous cell carcinoma cell growth in vitro and in vivo

    doi: 10.1038/s41419-020-2515-z

    Figure Lengend Snippet: I-BET726 inhibits BRD4, SphK1, and Akt signalings in human skin SCC cells. A431 cells or the primary human skin SCC cell (“C1/C2”) were treated with I-BET726 (5–100 n m ), cells were further cultured for 24 h, expression of listed proteins in total cell lysates were tested by western blotting a , h ; relative SphK1 activities d and ceramide levels e were tested. Expression of BRD4 and Tubulin in the stable A431 cells with CRISPR/Cas9 BRD4-KO plasmid (“BRD4-KO-sL1/2”) or Cas9 control construct (“Cas9-C”) was shown b ; Relative SphK1 activities ( f , the left panel) and ceramide levels g , the left panel were tested. Cas9-C cells or the BRD4-KO-sL1/2 cells were treated with or without I-BET726 (50 n m ) for 72 h, cell viability was tested by MTT assay c . A431 cells were treated with I-BET726 (50 n m ), CPI203 (500 n m ), JQ1 (500 n m ) or AZD5153 (“AZD”, 100 n m ) for 24 h, the SphK1 activities ( f , the right panel) and ceramide levels ( g , the right panel) were tested. Stable A431 cells with the constitutively active S473D mutant Akt1 (“caAkt1”) construct or the empty vector (“Vector”) were treated with or without I-BET726 (50 n m ) for applied time periods, expression of listed proteins were shown i . Cell viability (MTT viability, j and apoptosis activation (Annexin V-FACS/TUNEL staining, k and l were tested, and results were quantified. Expression of listed proteins was quantified and normalized to the loading control ( a , h and i ). * p

    Article Snippet: BRD4 knockout (KO) The CRISPR/Cas9 BRD4-KO plasmid (sc-400519-KO-2; Santa Cruz Biotechnology, Shanghai, China) was transfected to cultured A431 cells via the Lipofectamine 2000 protocol (Invitrogen, Shanghai, China).

    Techniques: Cell Culture, Expressing, Western Blot, CRISPR, Plasmid Preparation, Construct, MTT Assay, Mutagenesis, Activation Assay, FACS, TUNEL Assay, Staining

    BRD4 inhibition potentiates VS-5584-induced RCC cell death and apoptosis. The 786-O xenograft tumor-bearing nude mice were administrated with vehicle control or VS-5584 (20 mg/kg, oral administration, daily), at treatment Day-2 and Day-4, 4 h after the VS-5584 or vehicle administration, two tumors (“Set-1/Set-2”) of each group were isolated, expression of BRD4 and Tubulin in tumor lysates was shown ( A ). 786-O cells ( B ) and primary human RCC cells (“RCC1”, E ) were treated VS-5584 (or plus BRD4 inhibitors, B ) for 24 h, listed proteins in total cell lysates were tested by Western blotting. 786-O cells ( C , D ), RCC1 primary cancer cells ( F , G ) or HK-2 cells ( H , I ) were pretreated with JQ1 (500 nM) or CPI203 (500 nM) for 30 min, followed by VS-5584 (2/5 μM) treatment for 48/72 h, cell survival and apoptosis were tested by MTT ( C , F , H ) and ssDNA ELISA ( D , G , I ), respectively. The listed proteins were quantified ( B , E ). Data were presented as mean ± standard deviation (SD, n=5). * p

    Journal: Aging (Albany NY)

    Article Title: BRD4 inhibition sensitizes renal cell carcinoma cells to the PI3K/mTOR dual inhibitor VS-5584

    doi: 10.18632/aging.103723

    Figure Lengend Snippet: BRD4 inhibition potentiates VS-5584-induced RCC cell death and apoptosis. The 786-O xenograft tumor-bearing nude mice were administrated with vehicle control or VS-5584 (20 mg/kg, oral administration, daily), at treatment Day-2 and Day-4, 4 h after the VS-5584 or vehicle administration, two tumors (“Set-1/Set-2”) of each group were isolated, expression of BRD4 and Tubulin in tumor lysates was shown ( A ). 786-O cells ( B ) and primary human RCC cells (“RCC1”, E ) were treated VS-5584 (or plus BRD4 inhibitors, B ) for 24 h, listed proteins in total cell lysates were tested by Western blotting. 786-O cells ( C , D ), RCC1 primary cancer cells ( F , G ) or HK-2 cells ( H , I ) were pretreated with JQ1 (500 nM) or CPI203 (500 nM) for 30 min, followed by VS-5584 (2/5 μM) treatment for 48/72 h, cell survival and apoptosis were tested by MTT ( C , F , H ) and ssDNA ELISA ( D , G , I ), respectively. The listed proteins were quantified ( B , E ). Data were presented as mean ± standard deviation (SD, n=5). * p

    Article Snippet: BRD4 knockout (KO)The CRISPR/Cas9 BRD4 KO plasmid (sc-400519-KO-2; Santa Cruz Biotechnology) was transfected to 786-O cells using Lipofectamine 2000 reagent (Invitrogen, Shanghai, China), and selected with puromycin after 4-5 passages.

    Techniques: Inhibition, Mouse Assay, Isolation, Expressing, Western Blot, MTT Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation

    BRD4 is the primary resistance factor of VS-5584 in RCC 786-O cells. In VS-5584-treated stable 786-O cells with BRD4 shRNA (“sh-BRD4-S1/S2”, A – C ), CRISPR-Cas9-BRD4-KO plasmid ( D – F ) or BRD4-expression vector (“BRD4-GFP”, G – I ), BRD4, c-Myc and tubulin expression was shown ( A , D , G ). Cell survival and apoptosis were tested by MTT (after 72 h, B , E , H ) and ssDNA ELISA (after 48 h, C , F , I ), respectively. The listed proteins were quantified ( A , D , G ). Data were presented as mean ± standard deviation (SD, n=5). *p

    Journal: Aging (Albany NY)

    Article Title: BRD4 inhibition sensitizes renal cell carcinoma cells to the PI3K/mTOR dual inhibitor VS-5584

    doi: 10.18632/aging.103723

    Figure Lengend Snippet: BRD4 is the primary resistance factor of VS-5584 in RCC 786-O cells. In VS-5584-treated stable 786-O cells with BRD4 shRNA (“sh-BRD4-S1/S2”, A – C ), CRISPR-Cas9-BRD4-KO plasmid ( D – F ) or BRD4-expression vector (“BRD4-GFP”, G – I ), BRD4, c-Myc and tubulin expression was shown ( A , D , G ). Cell survival and apoptosis were tested by MTT (after 72 h, B , E , H ) and ssDNA ELISA (after 48 h, C , F , I ), respectively. The listed proteins were quantified ( A , D , G ). Data were presented as mean ± standard deviation (SD, n=5). *p

    Article Snippet: BRD4 knockout (KO)The CRISPR/Cas9 BRD4 KO plasmid (sc-400519-KO-2; Santa Cruz Biotechnology) was transfected to 786-O cells using Lipofectamine 2000 reagent (Invitrogen, Shanghai, China), and selected with puromycin after 4-5 passages.

    Techniques: shRNA, CRISPR, Plasmid Preparation, Expressing, MTT Assay, Enzyme-linked Immunosorbent Assay, Standard Deviation

    Genetic Inhibition of BRD4 Overcomes MPNST Cell Resistance to Diverse BET Inhibitors. (A-B) (A) mMPNST and (B) S462 MPNST cells were treated BET inhibitors CPI-203, JQ1, or OTX 015 at the indicated concentrations for 3 days followed by cell viability analysis via ATP CellTiter-Glo assay. (C) mMPNST cells were treated with vehicle or BET inhibitors CPI-203, JQ1, or OTX 015 at the indicated concentrations for 4 days, followed by flow cytometry for Annexin V (+) apoptotic cells. (D) mMPNST cells with or without Brd4 depletion were treatment with vehicle or 1 μM of the indicated BET inhibitors followed by flow cytometry for Annexin V (+) apoptotic cells after 4 days (Inset: Western blot validation of shRNA mediated Brd4 depletion in mMPNST cells). (E-F) Comparative analysis of pan-BET inhibitors JQ1 and CPI-0610 on mMPNST cell viability. shControl and sh Brd4 cells were treated with doxycycline and JQ1 or CPI-0610 for 3 days followed by ATP CellTiter-Glo assay. Data are plotted (E) as multipoint dose response curves relative to vehicle (DMSO) and (F) as individual treatment points relative to vehicle (DMSO). All error bars and statistics are represented as the mean +/− SEM (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001).

    Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

    Article Title: Overcoming BET inhibitor resistance in malignant peripheral nerve sheath tumors

    doi: 10.1158/1078-0432.CCR-18-2437

    Figure Lengend Snippet: Genetic Inhibition of BRD4 Overcomes MPNST Cell Resistance to Diverse BET Inhibitors. (A-B) (A) mMPNST and (B) S462 MPNST cells were treated BET inhibitors CPI-203, JQ1, or OTX 015 at the indicated concentrations for 3 days followed by cell viability analysis via ATP CellTiter-Glo assay. (C) mMPNST cells were treated with vehicle or BET inhibitors CPI-203, JQ1, or OTX 015 at the indicated concentrations for 4 days, followed by flow cytometry for Annexin V (+) apoptotic cells. (D) mMPNST cells with or without Brd4 depletion were treatment with vehicle or 1 μM of the indicated BET inhibitors followed by flow cytometry for Annexin V (+) apoptotic cells after 4 days (Inset: Western blot validation of shRNA mediated Brd4 depletion in mMPNST cells). (E-F) Comparative analysis of pan-BET inhibitors JQ1 and CPI-0610 on mMPNST cell viability. shControl and sh Brd4 cells were treated with doxycycline and JQ1 or CPI-0610 for 3 days followed by ATP CellTiter-Glo assay. Data are plotted (E) as multipoint dose response curves relative to vehicle (DMSO) and (F) as individual treatment points relative to vehicle (DMSO). All error bars and statistics are represented as the mean +/− SEM (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001).

    Article Snippet: Brd4 Knockout By CRISPR/Cas9 Genomic editing Doxycycline inducible Cas9 cDNA lentiviral vector (Addgene plasmid #50061 = pCW-Cas9) and additional lentivector constitutively expressing AAVS1-targeting sgRNA (sgCON) (Addgene plasmid #50662 = pLX-sgRNA) or sgBRD4.1 lentivector (pLX-sgRNA vector with AAVS1-sgRNA+PAM_sequence replaced with the following Brd4 -targeting sgRNA+PAM_sequence: GTTCAGCTTGACGGCATCCA) were packaged into lentiviral particles that were used to infect, and select for transduced cells.

    Techniques: Inhibition, Glo Assay, Flow Cytometry, Western Blot, shRNA

    Genetic Inhibition of BRD4 Improves BET Inhibitor Therapeutic Efficacy against MPNST Tumors In Vivo . (A) Flowchart diagram illustrating experimental outline for genetic and pharmacological inhibition of BRD4 in mMPNST allograft tumors in vivo . (B) Tumor growth curves of raw bioluminescence values from luciferase-expressing mMPNST allograft tumors in vivo . (C) Tumor growth curves of mMPNST allograft tumor volume (mm 3 ). (D) Tumor growth or regression assessed by percent change in bioluminescence of luciferase-expressing mMPNST allograft tumors. (E) Waterfall plot of final percent change (at 15 days post-treatment) in bioluminescence of each luciferase-expressing mMPNST allograft tumor per treatment group. (F) Photographs of mMPNST tumors isolated from mice treated with the indicated treatment regimen for 20 days (left panel), and average final weight of tumors from each treatment group (right panel). All error bars and statistics are represented as the mean +/− SEM (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001).

    Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

    Article Title: Overcoming BET inhibitor resistance in malignant peripheral nerve sheath tumors

    doi: 10.1158/1078-0432.CCR-18-2437

    Figure Lengend Snippet: Genetic Inhibition of BRD4 Improves BET Inhibitor Therapeutic Efficacy against MPNST Tumors In Vivo . (A) Flowchart diagram illustrating experimental outline for genetic and pharmacological inhibition of BRD4 in mMPNST allograft tumors in vivo . (B) Tumor growth curves of raw bioluminescence values from luciferase-expressing mMPNST allograft tumors in vivo . (C) Tumor growth curves of mMPNST allograft tumor volume (mm 3 ). (D) Tumor growth or regression assessed by percent change in bioluminescence of luciferase-expressing mMPNST allograft tumors. (E) Waterfall plot of final percent change (at 15 days post-treatment) in bioluminescence of each luciferase-expressing mMPNST allograft tumor per treatment group. (F) Photographs of mMPNST tumors isolated from mice treated with the indicated treatment regimen for 20 days (left panel), and average final weight of tumors from each treatment group (right panel). All error bars and statistics are represented as the mean +/− SEM (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001).

    Article Snippet: Brd4 Knockout By CRISPR/Cas9 Genomic editing Doxycycline inducible Cas9 cDNA lentiviral vector (Addgene plasmid #50061 = pCW-Cas9) and additional lentivector constitutively expressing AAVS1-targeting sgRNA (sgCON) (Addgene plasmid #50662 = pLX-sgRNA) or sgBRD4.1 lentivector (pLX-sgRNA vector with AAVS1-sgRNA+PAM_sequence replaced with the following Brd4 -targeting sgRNA+PAM_sequence: GTTCAGCTTGACGGCATCCA) were packaged into lentiviral particles that were used to infect, and select for transduced cells.

    Techniques: Inhibition, In Vivo, Luciferase, Expressing, Isolation, Mouse Assay

    BRD4 Depletion Overcomes Resistance to BET Inhibitor-Induced Cell Death in MPNST (A) Diagram illustrating the generation of mouse MPNST cells (mMPNST) with Brd4 knockout via CRISPR-Cas9-based genomic editing. (B) Western blot analysis of BRD4 protein expression in mMPNST cell clones isolated after induction of CRISPR-Cas9 genomic editing with sgRNAs (sgCONTROL or sgBRD4.1) relative to parental mMPNST cells. (C) mMPNST cells with or without Brd4 knockout were treated with vehicle or 1 μM JQ1 followed by cell viability analysis via ATP CellTiter-Glo assay at the indicated time points. (D) mMPNST cells with or without Brd4 knockout were treated with vehicle or 1 μM JQ1 for 4 days followed by flow cytometry analysis for Annexin V (+) apoptotic cells. (E) Western blot validation of doxycycline (Dox)-inducible shRNA-mediated knockdown of BRD4 in mMPNST cells (3 days after Dox treatment). (F) mMPNST cells were treated with doxycycline (to induce shCONTROL or shBrd4.552) in tandem with vehicle or 1 μM JQ1 for 3 days followed by flow cytometry analysis for Annexin V (+) apoptotic cells. (G) mMPNST cells were treated with or without doxycycline (to induce shBrd4.552) in tandem with vehicle or JQ1 at the indicated doses followed by cell viability analysis via phase contrast microscopy after 6 days. (H) Validation of BRD4 knockdown in human S462 MPNST cells by qRT-PCR. (I) Western blot validation of constitutive BRD4 protein knockdown in S462 MPNST cells with shRNAs as listed. (J) S462 MPNST cells with or without constitutive BRD4 knockdown were treated with vehicle or 1 μM JQ1 for 4 days followed by flow cytometry analysis for Annexin V (+) apoptotic cells. All error bars and statistics are represented as the mean +/− SEM (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001).

    Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

    Article Title: Overcoming BET inhibitor resistance in malignant peripheral nerve sheath tumors

    doi: 10.1158/1078-0432.CCR-18-2437

    Figure Lengend Snippet: BRD4 Depletion Overcomes Resistance to BET Inhibitor-Induced Cell Death in MPNST (A) Diagram illustrating the generation of mouse MPNST cells (mMPNST) with Brd4 knockout via CRISPR-Cas9-based genomic editing. (B) Western blot analysis of BRD4 protein expression in mMPNST cell clones isolated after induction of CRISPR-Cas9 genomic editing with sgRNAs (sgCONTROL or sgBRD4.1) relative to parental mMPNST cells. (C) mMPNST cells with or without Brd4 knockout were treated with vehicle or 1 μM JQ1 followed by cell viability analysis via ATP CellTiter-Glo assay at the indicated time points. (D) mMPNST cells with or without Brd4 knockout were treated with vehicle or 1 μM JQ1 for 4 days followed by flow cytometry analysis for Annexin V (+) apoptotic cells. (E) Western blot validation of doxycycline (Dox)-inducible shRNA-mediated knockdown of BRD4 in mMPNST cells (3 days after Dox treatment). (F) mMPNST cells were treated with doxycycline (to induce shCONTROL or shBrd4.552) in tandem with vehicle or 1 μM JQ1 for 3 days followed by flow cytometry analysis for Annexin V (+) apoptotic cells. (G) mMPNST cells were treated with or without doxycycline (to induce shBrd4.552) in tandem with vehicle or JQ1 at the indicated doses followed by cell viability analysis via phase contrast microscopy after 6 days. (H) Validation of BRD4 knockdown in human S462 MPNST cells by qRT-PCR. (I) Western blot validation of constitutive BRD4 protein knockdown in S462 MPNST cells with shRNAs as listed. (J) S462 MPNST cells with or without constitutive BRD4 knockdown were treated with vehicle or 1 μM JQ1 for 4 days followed by flow cytometry analysis for Annexin V (+) apoptotic cells. All error bars and statistics are represented as the mean +/− SEM (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001).

    Article Snippet: Brd4 Knockout By CRISPR/Cas9 Genomic editing Doxycycline inducible Cas9 cDNA lentiviral vector (Addgene plasmid #50061 = pCW-Cas9) and additional lentivector constitutively expressing AAVS1-targeting sgRNA (sgCON) (Addgene plasmid #50662 = pLX-sgRNA) or sgBRD4.1 lentivector (pLX-sgRNA vector with AAVS1-sgRNA+PAM_sequence replaced with the following Brd4 -targeting sgRNA+PAM_sequence: GTTCAGCTTGACGGCATCCA) were packaged into lentiviral particles that were used to infect, and select for transduced cells.

    Techniques: Knock-Out, CRISPR, Western Blot, Expressing, Clone Assay, Isolation, Glo Assay, Flow Cytometry, shRNA, Microscopy, Quantitative RT-PCR

    PROTAC-Mediated BRD4 Depletion Can Bypass BRD4-High Leukemia Cell Resistance to BET Inhibitors. (A) Western blot analysis of relative baseline BRD4 protein expression in leukemia cell lines. Densitometry percentages for BRD4 (BRD4/GAPDH) were calculated via ImageJ and are listed relative to K-562 cells. (B) Leukemia cell lines were treated with vehicle or 1 μM JQ1 for 4 days followed by flow cytometry analysis for Annexin V (+) apoptotic cells. (C) Leukemia cell lines were treated with vehicle or JQ1 at the indicated concentrations for 4 days followed by cell viability analysis via ATP CellTiter-Glo assay. (D-E) Effect of PROTAC-mediated BRD4 depletion versus BET inhibitor treatment on apoptosis induction in K-562 (D) or Kasumi-1 (E) leukemia cells, as assessed by flow cytometry for Annexin V (+) cells (n=3 per treatment) and by western blotting for BRD4 expression (3 days after treatment). Densitometry percentages for BRD4 (BRD4/a,b-Tubulin) were calculated via ImageJ and are listed relative to vehicle (DMSO). (F) Comparative analysis of BET inhibitor or PROTAC treatment on Kasumi-1 cell viability. shControl Kasumi-1 cells were treated with compounds as listed for 3 days followed by ATP CellTiter-Glo assay. Data are plotted as multipoint dose response curves (n=3 per concentration) normalized to the lowest treated dose (1 pM). All error bars and statistics are represented as the mean +/− SEM (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001).

    Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

    Article Title: Overcoming BET inhibitor resistance in malignant peripheral nerve sheath tumors

    doi: 10.1158/1078-0432.CCR-18-2437

    Figure Lengend Snippet: PROTAC-Mediated BRD4 Depletion Can Bypass BRD4-High Leukemia Cell Resistance to BET Inhibitors. (A) Western blot analysis of relative baseline BRD4 protein expression in leukemia cell lines. Densitometry percentages for BRD4 (BRD4/GAPDH) were calculated via ImageJ and are listed relative to K-562 cells. (B) Leukemia cell lines were treated with vehicle or 1 μM JQ1 for 4 days followed by flow cytometry analysis for Annexin V (+) apoptotic cells. (C) Leukemia cell lines were treated with vehicle or JQ1 at the indicated concentrations for 4 days followed by cell viability analysis via ATP CellTiter-Glo assay. (D-E) Effect of PROTAC-mediated BRD4 depletion versus BET inhibitor treatment on apoptosis induction in K-562 (D) or Kasumi-1 (E) leukemia cells, as assessed by flow cytometry for Annexin V (+) cells (n=3 per treatment) and by western blotting for BRD4 expression (3 days after treatment). Densitometry percentages for BRD4 (BRD4/a,b-Tubulin) were calculated via ImageJ and are listed relative to vehicle (DMSO). (F) Comparative analysis of BET inhibitor or PROTAC treatment on Kasumi-1 cell viability. shControl Kasumi-1 cells were treated with compounds as listed for 3 days followed by ATP CellTiter-Glo assay. Data are plotted as multipoint dose response curves (n=3 per concentration) normalized to the lowest treated dose (1 pM). All error bars and statistics are represented as the mean +/− SEM (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001).

    Article Snippet: Brd4 Knockout By CRISPR/Cas9 Genomic editing Doxycycline inducible Cas9 cDNA lentiviral vector (Addgene plasmid #50061 = pCW-Cas9) and additional lentivector constitutively expressing AAVS1-targeting sgRNA (sgCON) (Addgene plasmid #50662 = pLX-sgRNA) or sgBRD4.1 lentivector (pLX-sgRNA vector with AAVS1-sgRNA+PAM_sequence replaced with the following Brd4 -targeting sgRNA+PAM_sequence: GTTCAGCTTGACGGCATCCA) were packaged into lentiviral particles that were used to infect, and select for transduced cells.

    Techniques: Western Blot, Expressing, Flow Cytometry, Glo Assay, Concentration Assay