|
New England Biolabs
bgl ii Bgl Ii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bglii/pmc07721343-1132-40-77?v=New+England+Biolabs Average 97 stars, based on 1 article reviews
bgl ii - by Bioz Stars,
2026-08
97/100 stars
|
Buy from Supplier |
|
Jena Bioscience
dddyrk1afor atggatagatctgcaaaatcaagaaatgatgcacc bglii dddyrk1arev gttgttaagcttattgctttttttttgctttggcagtg Dddyrk1afor Atggatagatctgcaaaatcaagaaatgatgcacc Bglii Dddyrk1arev Gttgttaagcttattgctttttttttgctttggcagtg, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bglii/pmc04910162__srep28241___s1-26-53-89?v=Jena+Bioscience Average 91 stars, based on 1 article reviews
dddyrk1afor atggatagatctgcaaaatcaagaaatgatgcacc bglii dddyrk1arev gttgttaagcttattgctttttttttgctttggcagtg - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Beyotime
restriction sites Restriction Sites, supplied by Beyotime, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bglii/pm40076781-351-13-34?v=Beyotime Average 99 stars, based on 1 article reviews
restriction sites - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Addgene inc
136546 anxa2 ![]() 136546 Anxa2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bglii/pm32442400-188-19-29?v=Addgene+inc Average 90 stars, based on 1 article reviews
136546 anxa2 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Addgene inc
paper addgene id ![]() Paper Addgene Id, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bglii/pm32442400-188-28-29?v=Addgene+inc Average 90 stars, based on 1 article reviews
paper addgene id - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
New England Biolabs
restriction enzymes bglii ![]() Restriction Enzymes Bglii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bglii/pm37392922-104-21-26?v=New+England+Biolabs Average 97 stars, based on 1 article reviews
restriction enzymes bglii - by Bioz Stars,
2026-08
97/100 stars
|
Buy from Supplier |
|
Promega
bglii ![]() Bglii, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bglii/10__1074_slash_jbc__m111224200-50-15-30?v=Promega Average 90 stars, based on 1 article reviews
bglii - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Promega
restriction enzyme bglii ![]() Restriction Enzyme Bglii, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bglii/pm19329137-113-10-22?v=Promega Average 90 stars, based on 1 article reviews
restriction enzyme bglii - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Promega
1324 bp bglii and hindiii fragment of the human hspa7 promoter re-cloned from p2500-cat vector ![]() 1324 Bp Bglii And Hindiii Fragment Of The Human Hspa7 Promoter Re Cloned From P2500 Cat Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bglii/pmc07308270-94-19-29?v=Promega Average 90 stars, based on 1 article reviews
1324 bp bglii and hindiii fragment of the human hspa7 promoter re-cloned from p2500-cat vector - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Carl Roth GmbH
bglii ![]() Bglii, supplied by Carl Roth GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bglii/pm21447051-241-7-23?v=Carl+Roth+GmbH Average 90 stars, based on 1 article reviews
bglii - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Promega
restriction enzymes spei and bglii ![]() Restriction Enzymes Spei And Bglii, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bglii/us09441248-316-22-25?v=Promega Average 90 stars, based on 1 article reviews
restriction enzymes spei and bglii - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Promega
saci and bglii ![]() Saci And Bglii, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/bglii/pmc03302474-49-28-8?v=Promega Average 90 stars, based on 1 article reviews
saci and bglii - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Structure (London, England : 1993)
Article Title: Structure Determination of the Transactivation Domain of p53 in Complex with S100A4 Using Annexin A2 as a Crystallization Chaperone.
doi: 10.1016/j.str.2020.05.001
Figure Lengend Snippet: Figure 2. Schematic Representation of the ANXA2 Fusion Constructs Used for the Crys- tallographic Studies (A) The target protein is fused to the C-NTD (23–33) of ANXA2. Here the additional interactions between C-NTD and CTD (34–339) (red lines) stabilize the structure of ANXA2. (B) Almost the whole NTD (2–28) is removed and the target protein is fused directly to the first a helix of ANXA2 core domain (29–339) with a short linker. (C) In the present work the p53 TAD1756 (orange) was fused to the scS100A4D8 (I and II represent the subunits), which is fused to ANXA229339. Dashed lines indicate the GS linkers. Brown dots represent calcium ions.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA ANXA223-339 in modified pET15b vector (pANXA223-339) This paper Addgene ID: 136543 and
Techniques: Construct
Journal: Structure (London, England : 1993)
Article Title: Structure Determination of the Transactivation Domain of p53 in Complex with S100A4 Using Annexin A2 as a Crystallization Chaperone.
doi: 10.1016/j.str.2020.05.001
Figure Lengend Snippet: Figure 4. Crystal Screening of Different wtMBP and ANXA2 Constructs (A and B) (A) ANXA229339 and (B) PDZ-ANXA223339 crystals were formed under numerous JCSG+ (blue) and Morpheus (red) crystallization conditions at 250 mM concentration. (C–F) (C) In the case of the larger scS100A4D8-ANXA229339 construct, crystal formation significantly dropped. Crystal formation of (D) wtMBP, (E) wtMBP-PDZ, and (F) wtMBP-scS100A4D8 at 2 mM concentration is also presented. Crystal growth was monitored for a month.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA ANXA223-339 in modified pET15b vector (pANXA223-339) This paper Addgene ID: 136543 and
Techniques: Construct, Crystallization Assay, Concentration Assay
Journal: Structure (London, England : 1993)
Article Title: Structure Determination of the Transactivation Domain of p53 in Complex with S100A4 Using Annexin A2 as a Crystallization Chaperone.
doi: 10.1016/j.str.2020.05.001
Figure Lengend Snippet: Figure 5. Crystallization of ANXA2 Constructs and wtMBP at Different Concentrations Using the Best Conditions Found in the Screening Experiments Formation of (A) ANXA229339 (black), PDZ-ANXA223339 (gray), and scS100A4D8-ANXA229339 (horizontal lines) crystals were monitored at different protein concentrations for a month. (B) MBP crystals (vertical lines) formed only at higher than 500 mM concentration (~20.5 mg/mL). No MBP fused constructs were tested since no hit was found during screening. (C–E) (C) PDZ-ANXA223339, (D) ANXA229339, and (E) wtMBP crystals when samples were used at 250 mM (2 mM), 62.5 mM (1 mM), and 7 mM concentrations (0.5 mM) from left to right (wtMBP concentrations are in parenthesis). Small crystals are highlighted in white boxes. White bars represent 0.5 mm.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA ANXA223-339 in modified pET15b vector (pANXA223-339) This paper Addgene ID: 136543 and
Techniques: Crystallization Assay, Construct, Concentration Assay
Journal: Structure (London, England : 1993)
Article Title: Structure Determination of the Transactivation Domain of p53 in Complex with S100A4 Using Annexin A2 as a Crystallization Chaperone.
doi: 10.1016/j.str.2020.05.001
Figure Lengend Snippet: Figure 6. Crystal Packing of ANXA2 in Structures Found in the PDB (A–C) (A) ANXA2 in Ca2+-bound form (PDB: 1XJL, light and dark gray) (Rosengarth and Luecke, 2004) produces elongated crystal lattices (same in PDB: 5LPX, 5LQ0, 2HYW, 4X9P, and 5LQ2 structures) (Ecse´ di et al., 2017; Shao et al., 2006; Raddum et al., 2015). Structures of previously solved (B) PDZ-ANXA223339
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA ANXA223-339 in modified pET15b vector (pANXA223-339) This paper Addgene ID: 136543 and
Techniques:
Journal: Structure (London, England : 1993)
Article Title: Structure Determination of the Transactivation Domain of p53 in Complex with S100A4 Using Annexin A2 as a Crystallization Chaperone.
doi: 10.1016/j.str.2020.05.001
Figure Lengend Snippet: Figure 7. Crystal Contacts of Two ANXA2 Molecules (A) The aligned ANXA2 structures (PDB: 5LPX, 5LQ0, 5LPU, 1XJL, 2HYW, 4X9P, and 5LQ2) (Ecse´ di et al., 2017; Rosengarth and Luecke, 2004; Raddum et al., 2015; Shao et al., 2006) show the conservative crystal contacts. The additional segments of the crystal lattice (light gray ANXA2s are in identical position) defines the solution channel (green ellipse) formed in ANXA2 crystals. (B) S234 of light gray (molecule B) ANXA2 helps the coordination of Ca2+ (brown sphere) connecting to dark gray ANXA2 (molecule A). (C and D) (C) Besides Ca2+ coordination, residues of the nearby a helices form ionic, while (D) two tyrosines form hydrophobic interactions, further stabilizing the assembly. Residues of molecule B are underlined.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA ANXA223-339 in modified pET15b vector (pANXA223-339) This paper Addgene ID: 136543 and
Techniques: