barcoded reverse primer Illumina Inc Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Illumina Inc truseq barcode reverse primers
    Truseq Barcode Reverse Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/truseq barcode reverse primers/product/Illumina Inc
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    truseq barcode reverse primers - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    92
    Illumina Inc reverse primer
    Reverse Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 61 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse primer/product/Illumina Inc
    Average 92 stars, based on 61 article reviews
    Price from $9.99 to $1999.99
    reverse primer - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    94
    Illumina Inc primer
    Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 668 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer/product/Illumina Inc
    Average 94 stars, based on 668 article reviews
    Price from $9.99 to $1999.99
    primer - by Bioz Stars, 2020-05
    94/100 stars
      Buy from Supplier

    91
    Illumina Inc 806 r reverse primer
    806 R Reverse Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 91/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/806 r reverse primer/product/Illumina Inc
    Average 91 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    806 r reverse primer - by Bioz Stars, 2020-05
    91/100 stars
      Buy from Supplier

    88
    Illumina Inc barcoded illumina primers
    Barcoded Illumina Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 88/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/barcoded illumina primers/product/Illumina Inc
    Average 88 stars, based on 49 article reviews
    Price from $9.99 to $1999.99
    barcoded illumina primers - by Bioz Stars, 2020-05
    88/100 stars
      Buy from Supplier

    92
    Illumina Inc barcoded reverse illumina primer
    Barcoded Reverse Illumina Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/barcoded reverse illumina primer/product/Illumina Inc
    Average 92 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    barcoded reverse illumina primer - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    97
    Illumina Inc barcode
    Distribution of <t>barcodes</t> matching and mismatching. To assign an Illumina read to a particular sample, one examines both of the barcodes at each end of the sequence. In green, the two barcodes agree on which sample the read is coming from. In black, no barcodes are found on either end. In yellow, only one barcode is present. In orange, the two barcodes come from the same directional set and should not be found together (e.g. two forward barcodes). In red, the two barcodes each indicate a different sample. Overall, with this setup, about half of the raw data is discarded.
    Barcode, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 1341 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/barcode/product/Illumina Inc
    Average 97 stars, based on 1341 article reviews
    Price from $9.99 to $1999.99
    barcode - by Bioz Stars, 2020-05
    97/100 stars
      Buy from Supplier

    90
    Illumina Inc illumina adapter caagcagaagacggcatacgagat
    Distribution of <t>barcodes</t> matching and mismatching. To assign an Illumina read to a particular sample, one examines both of the barcodes at each end of the sequence. In green, the two barcodes agree on which sample the read is coming from. In black, no barcodes are found on either end. In yellow, only one barcode is present. In orange, the two barcodes come from the same directional set and should not be found together (e.g. two forward barcodes). In red, the two barcodes each indicate a different sample. Overall, with this setup, about half of the raw data is discarded.
    Illumina Adapter Caagcagaagacggcatacgagat, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina adapter caagcagaagacggcatacgagat/product/Illumina Inc
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    illumina adapter caagcagaagacggcatacgagat - by Bioz Stars, 2020-05
    90/100 stars
      Buy from Supplier

    88
    Illumina Inc unique illumina truseq barcodes
    Distribution of <t>barcodes</t> matching and mismatching. To assign an Illumina read to a particular sample, one examines both of the barcodes at each end of the sequence. In green, the two barcodes agree on which sample the read is coming from. In black, no barcodes are found on either end. In yellow, only one barcode is present. In orange, the two barcodes come from the same directional set and should not be found together (e.g. two forward barcodes). In red, the two barcodes each indicate a different sample. Overall, with this setup, about half of the raw data is discarded.
    Unique Illumina Truseq Barcodes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 88/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/unique illumina truseq barcodes/product/Illumina Inc
    Average 88 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    unique illumina truseq barcodes - by Bioz Stars, 2020-05
    88/100 stars
      Buy from Supplier

    86
    Illumina Inc reverse access array barcode primers
    Distribution of <t>barcodes</t> matching and mismatching. To assign an Illumina read to a particular sample, one examines both of the barcodes at each end of the sequence. In green, the two barcodes agree on which sample the read is coming from. In black, no barcodes are found on either end. In yellow, only one barcode is present. In orange, the two barcodes come from the same directional set and should not be found together (e.g. two forward barcodes). In red, the two barcodes each indicate a different sample. Overall, with this setup, about half of the raw data is discarded.
    Reverse Access Array Barcode Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 86/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse access array barcode primers/product/Illumina Inc
    Average 86 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    reverse access array barcode primers - by Bioz Stars, 2020-05
    86/100 stars
      Buy from Supplier

    95
    Illumina Inc illumina specific adapters
    ETNP OMZ bacterial community diversity revealed by 16S rRNA gene <t>Illumina</t> sequencing. The abundances of major bacterial divisions are shown as a percentage of total identifiable 16S rRNA gene sequences. ‘Other' includes 34 divisions, including unassigned sequences.
    Illumina Specific Adapters, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 95/100, based on 291 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina specific adapters/product/Illumina Inc
    Average 95 stars, based on 291 article reviews
    Price from $9.99 to $1999.99
    illumina specific adapters - by Bioz Stars, 2020-05
    95/100 stars
      Buy from Supplier

    90
    Illumina Inc compatible barcoded reverse pcr primers
    ETNP OMZ bacterial community diversity revealed by 16S rRNA gene <t>Illumina</t> sequencing. The abundances of major bacterial divisions are shown as a percentage of total identifiable 16S rRNA gene sequences. ‘Other' includes 34 divisions, including unassigned sequences.
    Compatible Barcoded Reverse Pcr Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/compatible barcoded reverse pcr primers/product/Illumina Inc
    Average 90 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    compatible barcoded reverse pcr primers - by Bioz Stars, 2020-05
    90/100 stars
      Buy from Supplier

    93
    Illumina Inc barcode sequence
    Library construction strategy. First, a partially randomized ribozyme library is transcribed in vitro from a DNA template. The cleaved and uncleaved ribozymes are reverse transcribed into cDNAs using a primer that contains a <t>barcode</t> and an adapter sequence. After removing the RNAs, the 3′ adapter is attached and amplified by PCR to obtain the sequencing library. The core ribozyme sequence is shown in black with the degenerate bases depicted in red. Other sequence elements: T7 promoter (purple), barcode (yellow), adapter sequences for sequencing (green and blue).
    Barcode Sequence, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 250 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/barcode sequence/product/Illumina Inc
    Average 93 stars, based on 250 article reviews
    Price from $9.99 to $1999.99
    barcode sequence - by Bioz Stars, 2020-05
    93/100 stars
      Buy from Supplier

    92
    Illumina Inc barcoded its2 reverse primers
    Library construction strategy. First, a partially randomized ribozyme library is transcribed in vitro from a DNA template. The cleaved and uncleaved ribozymes are reverse transcribed into cDNAs using a primer that contains a <t>barcode</t> and an adapter sequence. After removing the RNAs, the 3′ adapter is attached and amplified by PCR to obtain the sequencing library. The core ribozyme sequence is shown in black with the degenerate bases depicted in red. Other sequence elements: T7 promoter (purple), barcode (yellow), adapter sequences for sequencing (green and blue).
    Barcoded Its2 Reverse Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/barcoded its2 reverse primers/product/Illumina Inc
    Average 92 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    barcoded its2 reverse primers - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    93
    Illumina Inc illumina compatible adapter barcodes
    Library construction strategy. First, a partially randomized ribozyme library is transcribed in vitro from a DNA template. The cleaved and uncleaved ribozymes are reverse transcribed into cDNAs using a primer that contains a <t>barcode</t> and an adapter sequence. After removing the RNAs, the 3′ adapter is attached and amplified by PCR to obtain the sequencing library. The core ribozyme sequence is shown in black with the degenerate bases depicted in red. Other sequence elements: T7 promoter (purple), barcode (yellow), adapter sequences for sequencing (green and blue).
    Illumina Compatible Adapter Barcodes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina compatible adapter barcodes/product/Illumina Inc
    Average 93 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    illumina compatible adapter barcodes - by Bioz Stars, 2020-05
    93/100 stars
      Buy from Supplier

    91
    Illumina Inc its2 reverse primers
    Library construction strategy. First, a partially randomized ribozyme library is transcribed in vitro from a DNA template. The cleaved and uncleaved ribozymes are reverse transcribed into cDNAs using a primer that contains a <t>barcode</t> and an adapter sequence. After removing the RNAs, the 3′ adapter is attached and amplified by PCR to obtain the sequencing library. The core ribozyme sequence is shown in black with the degenerate bases depicted in red. Other sequence elements: T7 promoter (purple), barcode (yellow), adapter sequences for sequencing (green and blue).
    Its2 Reverse Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/its2 reverse primers/product/Illumina Inc
    Average 91 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    its2 reverse primers - by Bioz Stars, 2020-05
    91/100 stars
      Buy from Supplier

    94
    Illumina Inc bp barcode
    Library construction strategy. First, a partially randomized ribozyme library is transcribed in vitro from a DNA template. The cleaved and uncleaved ribozymes are reverse transcribed into cDNAs using a primer that contains a <t>barcode</t> and an adapter sequence. After removing the RNAs, the 3′ adapter is attached and amplified by PCR to obtain the sequencing library. The core ribozyme sequence is shown in black with the degenerate bases depicted in red. Other sequence elements: T7 promoter (purple), barcode (yellow), adapter sequences for sequencing (green and blue).
    Bp Barcode, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 107 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bp barcode/product/Illumina Inc
    Average 94 stars, based on 107 article reviews
    Price from $9.99 to $1999.99
    bp barcode - by Bioz Stars, 2020-05
    94/100 stars
      Buy from Supplier

    92
    Illumina Inc illumina barcoding primers
    Library construction strategy. First, a partially randomized ribozyme library is transcribed in vitro from a DNA template. The cleaved and uncleaved ribozymes are reverse transcribed into cDNAs using a primer that contains a <t>barcode</t> and an adapter sequence. After removing the RNAs, the 3′ adapter is attached and amplified by PCR to obtain the sequencing library. The core ribozyme sequence is shown in black with the degenerate bases depicted in red. Other sequence elements: T7 promoter (purple), barcode (yellow), adapter sequences for sequencing (green and blue).
    Illumina Barcoding Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illumina barcoding primers/product/Illumina Inc
    Average 92 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    illumina barcoding primers - by Bioz Stars, 2020-05
    92/100 stars
      Buy from Supplier

    96
    Illumina Inc pcr step
    Library construction strategy. First, a partially randomized ribozyme library is transcribed in vitro from a DNA template. The cleaved and uncleaved ribozymes are reverse transcribed into cDNAs using a primer that contains a <t>barcode</t> and an adapter sequence. After removing the RNAs, the 3′ adapter is attached and amplified by PCR to obtain the sequencing library. The core ribozyme sequence is shown in black with the degenerate bases depicted in red. Other sequence elements: T7 promoter (purple), barcode (yellow), adapter sequences for sequencing (green and blue).
    Pcr Step, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 542 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr step/product/Illumina Inc
    Average 96 stars, based on 542 article reviews
    Price from $9.99 to $1999.99
    pcr step - by Bioz Stars, 2020-05
    96/100 stars
      Buy from Supplier

    Image Search Results


    Distribution of barcodes matching and mismatching. To assign an Illumina read to a particular sample, one examines both of the barcodes at each end of the sequence. In green, the two barcodes agree on which sample the read is coming from. In black, no barcodes are found on either end. In yellow, only one barcode is present. In orange, the two barcodes come from the same directional set and should not be found together (e.g. two forward barcodes). In red, the two barcodes each indicate a different sample. Overall, with this setup, about half of the raw data is discarded.

    Journal: PLoS ONE

    Article Title: Microbial Community Composition and Diversity via 16S rRNA Gene Amplicons: Evaluating the Illumina Platform

    doi: 10.1371/journal.pone.0116955

    Figure Lengend Snippet: Distribution of barcodes matching and mismatching. To assign an Illumina read to a particular sample, one examines both of the barcodes at each end of the sequence. In green, the two barcodes agree on which sample the read is coming from. In black, no barcodes are found on either end. In yellow, only one barcode is present. In orange, the two barcodes come from the same directional set and should not be found together (e.g. two forward barcodes). In red, the two barcodes each indicate a different sample. Overall, with this setup, about half of the raw data is discarded.

    Article Snippet: Thus, reverse and forward primers need to be complemented with unique barcodes to avoid miss-assignment of reads to samples when employing the standard TruSeq library preparation protocol. (ii) Although, different clustering algorithms result in different numbers of OTUs, trends in alpha and beta diversity are conserved. (iii) For those switching sequencing technologies, 454 and Illumina sequence data can be combined provided the following conditions are respected: the same PCR primers and bioinformatic workflows must be applied and the variations between the methods must be quantified and accounted for in the interpretation of the results.

    Techniques: Sequencing

    Distribution of sequence lengths for matching barcodes. Once all the forward and reverse reads from the Illumina sequencer are joined one can see – in gray here – a pattern in the size of the fragments produced. Superposing in red the abundance of length variation found in the SILVAMOD database, one can see that the variation we uncovered follows closely the natural variation of the V3–V4 region of the 16S rRNA gene. As shown in Fig. 3 , each of the three peaks are composed of characteristic phyla.

    Journal: PLoS ONE

    Article Title: Microbial Community Composition and Diversity via 16S rRNA Gene Amplicons: Evaluating the Illumina Platform

    doi: 10.1371/journal.pone.0116955

    Figure Lengend Snippet: Distribution of sequence lengths for matching barcodes. Once all the forward and reverse reads from the Illumina sequencer are joined one can see – in gray here – a pattern in the size of the fragments produced. Superposing in red the abundance of length variation found in the SILVAMOD database, one can see that the variation we uncovered follows closely the natural variation of the V3–V4 region of the 16S rRNA gene. As shown in Fig. 3 , each of the three peaks are composed of characteristic phyla.

    Article Snippet: Thus, reverse and forward primers need to be complemented with unique barcodes to avoid miss-assignment of reads to samples when employing the standard TruSeq library preparation protocol. (ii) Although, different clustering algorithms result in different numbers of OTUs, trends in alpha and beta diversity are conserved. (iii) For those switching sequencing technologies, 454 and Illumina sequence data can be combined provided the following conditions are respected: the same PCR primers and bioinformatic workflows must be applied and the variations between the methods must be quantified and accounted for in the interpretation of the results.

    Techniques: Sequencing, Produced

    ETNP OMZ bacterial community diversity revealed by 16S rRNA gene Illumina sequencing. The abundances of major bacterial divisions are shown as a percentage of total identifiable 16S rRNA gene sequences. ‘Other' includes 34 divisions, including unassigned sequences.

    Journal: The ISME Journal

    Article Title: Size-fraction partitioning of community gene transcription and nitrogen metabolism in a marine oxygen minimum zone

    doi: 10.1038/ismej.2015.44

    Figure Lengend Snippet: ETNP OMZ bacterial community diversity revealed by 16S rRNA gene Illumina sequencing. The abundances of major bacterial divisions are shown as a percentage of total identifiable 16S rRNA gene sequences. ‘Other' includes 34 divisions, including unassigned sequences.

    Article Snippet: Both forward and reverse primers were barcoded and appended with Illumina-specific adapters according to .

    Techniques: Sequencing

    Library construction strategy. First, a partially randomized ribozyme library is transcribed in vitro from a DNA template. The cleaved and uncleaved ribozymes are reverse transcribed into cDNAs using a primer that contains a barcode and an adapter sequence. After removing the RNAs, the 3′ adapter is attached and amplified by PCR to obtain the sequencing library. The core ribozyme sequence is shown in black with the degenerate bases depicted in red. Other sequence elements: T7 promoter (purple), barcode (yellow), adapter sequences for sequencing (green and blue).

    Journal: Nucleic Acids Research

    Article Title: High-throughput assay and engineering of self-cleaving ribozymes by sequencing

    doi: 10.1093/nar/gkv265

    Figure Lengend Snippet: Library construction strategy. First, a partially randomized ribozyme library is transcribed in vitro from a DNA template. The cleaved and uncleaved ribozymes are reverse transcribed into cDNAs using a primer that contains a barcode and an adapter sequence. After removing the RNAs, the 3′ adapter is attached and amplified by PCR to obtain the sequencing library. The core ribozyme sequence is shown in black with the degenerate bases depicted in red. Other sequence elements: T7 promoter (purple), barcode (yellow), adapter sequences for sequencing (green and blue).

    Article Snippet: The RNA library was reverse transcribed using a primer that contains a barcode sequence to identify the reaction conditions (with or without guanine), as well as a portion of the Adapter T sequence used by the Illumina sequencer.

    Techniques: In Vitro, Sequencing, Amplification, Polymerase Chain Reaction