bacterial 16s rrna genes Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher 16s rrna gene
    16s Rrna Gene, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 3951 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/16s rrna gene/product/Thermo Fisher
    Average 93 stars, based on 3951 article reviews
    Price from $9.99 to $1999.99
    16s rrna gene - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    92
    Promega bacterial 16s rrna gene
    Phylogenetic classification of amplified archaeal <t>16S</t> <t>rRNA</t> genes in the methanogenic incubations. The maximum taxonomy depth is on family level. Taxonomic groups with
    Bacterial 16s Rrna Gene, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial 16s rrna gene/product/Promega
    Average 92 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    bacterial 16s rrna gene - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    88
    Illumina Inc bacterial 16s rrna gene amplification
    ( a ) Rarefaction curves showing the observed OTU richness (at 97% identity) of the <t>16S</t> <t>rRNA</t> gene with increasing sequencing depth. Mean values (n = 3) were shown for the two salinity treatments (S1 and S4) and two soil depths. ( b ) Comparison of the bacterial communities at the phylum level. Relative read abundance of different bacterial phyla in bacterial communities. Sequences that could not be classified into any known group were labeled “others”.
    Bacterial 16s Rrna Gene Amplification, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 88/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial 16s rrna gene amplification/product/Illumina Inc
    Average 88 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    bacterial 16s rrna gene amplification - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    93
    Illumina Inc 16s rrna genes
    Distribution of sequence lengths for matching barcodes. Once all the forward and reverse reads from the Illumina sequencer are joined one can see – in gray here – a pattern in the size of the fragments produced. Superposing in red the abundance of length variation found in the SILVAMOD database, one can see that the variation we uncovered follows closely the natural variation of the V3–V4 region of the <t>16S</t> <t>rRNA</t> gene. As shown in Fig. 3 , each of the three peaks are composed of characteristic phyla.
    16s Rrna Genes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 93/100, based on 1546 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/16s rrna genes/product/Illumina Inc
    Average 93 stars, based on 1546 article reviews
    Price from $9.99 to $1999.99
    16s rrna genes - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    90
    Illumina Inc bacterial 16s rrna gene amplicon sequencing
    Heatmap of the bacterial community composition based on <t>16S</t> <t>rRNA</t> gene sequences for the sponge samples collected in 2014. OTUs were clustered at 97% similarity and the lowest taxonomy classification are given. Columns are clustered based on Bray–Curtis dissimilarity using hierarchical clustering with the “average” method (scale depicts percentage of dissimilarities). Samples are indicated in purple: C. concentrica , orange: Scopalina sp., blue: seawater, and red: T. anhelans . Numbers 1, 2, and 3 indicate sample replicates.
    Bacterial 16s Rrna Gene Amplicon Sequencing, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial 16s rrna gene amplicon sequencing/product/Illumina Inc
    Average 90 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    bacterial 16s rrna gene amplicon sequencing - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    91
    Roche bacterial 16s rrna genes
    <t>16S</t> <t>rRNA</t> clone libraries.
    Bacterial 16s Rrna Genes, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial 16s rrna genes/product/Roche
    Average 91 stars, based on 44 article reviews
    Price from $9.99 to $1999.99
    bacterial 16s rrna genes - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    91
    Pacific Biosciences full length bacterial 16s rrna gene
    Comparing sequence error types across different alignment filtering. The different types of sequencing errors, obtained from the MOTHUR error report file, were plotted in Graph Pad Prism 6. The x-axis shows the base pair position in the full-length bacterial <t>16S</t> <t>rRNA</t> gene and the y-axis shows the sequence error rate on a log 2 scale. The abundance of substitution errors, insertion errors, and deletion errors using standard quality filtering a , with low stringency post alignment filtering b , and high stringency post alignment filtering c are shown. The standard quality filtering parameters were: maximum ambiguous sequences = 0, maximum number of homo-polymers 6, sequence quality average of 35 over a sequence quality window of 50 bp. The extra post alignment screening parameters were: post alignment screening using minimum sequence similarity and minimum alignment score of 80% b and post alignment screening using minimum sequence similarity and minimum alignment score of 90% c
    Full Length Bacterial 16s Rrna Gene, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 91/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/full length bacterial 16s rrna gene/product/Pacific Biosciences
    Average 91 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    full length bacterial 16s rrna gene - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    89
    Illumina Inc bacterial 16s rrna gene
    Comparison of the microbiome from quarters with clinical mastitis associated with Escherichia coli and healthy quarters (i.e. reference for calculation of fold change). Size of the circle is proportional to the overall prevalence of each family. Color of the circle is associated with effect size. The graph plots log fold change in <t>16S</t> <t>rRNA</t> gene abundance in mastitic relative to healthy control quarters versus false discovery rate (FDR) logWorth (i.e. −log10P). P-values are adjusted for FDR. The dashed line represents the adjusted P -value = 0.01.
    Bacterial 16s Rrna Gene, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 89/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial 16s rrna gene/product/Illumina Inc
    Average 89 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    bacterial 16s rrna gene - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    92
    PrimerDesign Inc bacterial 16s rrna genes
    Comparison of the microbiome from quarters with clinical mastitis associated with Escherichia coli and healthy quarters (i.e. reference for calculation of fold change). Size of the circle is proportional to the overall prevalence of each family. Color of the circle is associated with effect size. The graph plots log fold change in <t>16S</t> <t>rRNA</t> gene abundance in mastitic relative to healthy control quarters versus false discovery rate (FDR) logWorth (i.e. −log10P). P-values are adjusted for FDR. The dashed line represents the adjusted P -value = 0.01.
    Bacterial 16s Rrna Genes, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 92/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial 16s rrna genes/product/PrimerDesign Inc
    Average 92 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    bacterial 16s rrna genes - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    93
    Genewiz bacterial 16s rrna gene
    Comparison of the microbiome from quarters with clinical mastitis associated with Escherichia coli and healthy quarters (i.e. reference for calculation of fold change). Size of the circle is proportional to the overall prevalence of each family. Color of the circle is associated with effect size. The graph plots log fold change in <t>16S</t> <t>rRNA</t> gene abundance in mastitic relative to healthy control quarters versus false discovery rate (FDR) logWorth (i.e. −log10P). P-values are adjusted for FDR. The dashed line represents the adjusted P -value = 0.01.
    Bacterial 16s Rrna Gene, supplied by Genewiz, used in various techniques. Bioz Stars score: 93/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial 16s rrna gene/product/Genewiz
    Average 93 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    bacterial 16s rrna gene - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    90
    Marker Gene Technologies bacterial 16s rrna gene
    Comparison of the microbiome from quarters with clinical mastitis associated with Escherichia coli and healthy quarters (i.e. reference for calculation of fold change). Size of the circle is proportional to the overall prevalence of each family. Color of the circle is associated with effect size. The graph plots log fold change in <t>16S</t> <t>rRNA</t> gene abundance in mastitic relative to healthy control quarters versus false discovery rate (FDR) logWorth (i.e. −log10P). P-values are adjusted for FDR. The dashed line represents the adjusted P -value = 0.01.
    Bacterial 16s Rrna Gene, supplied by Marker Gene Technologies, used in various techniques. Bioz Stars score: 90/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial 16s rrna gene/product/Marker Gene Technologies
    Average 90 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    bacterial 16s rrna gene - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    93
    Roche 16s rrna gene
    Total bacterial abundance (black bar) determined by quantitative PCR targeting the <t>16S</t> <t>rRNA</t> gene and total aerosol particle numbers (particle size: > 1.0 μm [gray bar]) determined by particle counter. Samples were collected during each of the four seasons, including after rainy days and Asian dust days.
    16s Rrna Gene, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 1597 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/16s rrna gene/product/Roche
    Average 93 stars, based on 1597 article reviews
    Price from $9.99 to $1999.99
    16s rrna gene - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    89
    TaKaRa bacterial 16s rrna gene
    Comparison of similarities and differences for gut microbiota composition between transgenic fish and wild-type controls across different developmental stages. (a) Comparison of the average Sørensen index obtained from DGGE patterns of <t>16S</t> <t>rRNA</t> genes between transgenic fish and wild-type controls or within each group of transgenic fish and wild-type controls. (b) Comparison of Raup and Crick similarity index ( S RC ) obtained from DGGE patterns of 16S rRNA genes between transgenic fish and wild-type controls or within each group of transgenic fish and wild-type controls. Dashed lines indicate significant cutoff for difference (low line) and similarity (upper line). Error bars represent the standard error of the mean.
    Bacterial 16s Rrna Gene, supplied by TaKaRa, used in various techniques. Bioz Stars score: 89/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial 16s rrna gene/product/TaKaRa
    Average 89 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    bacterial 16s rrna gene - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    90
    Bio-Rad bacterial 16s rrna genes
    Predicted domain coverage and specificity of archaeal primers. Dark bars are Methanogenic Archaea reported in the rumen. The coverage and specificity of Met630f and Met803r primers were determined in silico using PrimerProspector 33 . The primers were predicted to give > 90% coverage of Archaea based on 867 reference sequences contained in the Greengenes <t>16S</t> <t>rRNA</t> database, with only
    Bacterial 16s Rrna Genes, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial 16s rrna genes/product/Bio-Rad
    Average 90 stars, based on 31 article reviews
    Price from $9.99 to $1999.99
    bacterial 16s rrna genes - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    91
    Eurofins bacterial 16s rrna genes
    Predicted domain coverage and specificity of archaeal primers. Dark bars are Methanogenic Archaea reported in the rumen. The coverage and specificity of Met630f and Met803r primers were determined in silico using PrimerProspector 33 . The primers were predicted to give > 90% coverage of Archaea based on 867 reference sequences contained in the Greengenes <t>16S</t> <t>rRNA</t> database, with only
    Bacterial 16s Rrna Genes, supplied by Eurofins, used in various techniques. Bioz Stars score: 91/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial 16s rrna genes/product/Eurofins
    Average 91 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    bacterial 16s rrna genes - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    88
    Illumina Inc bacterial archaeal 16s rrna gene
    Bar graph illustrating the bacterial load measured as mean log10 number of the <t>16S</t> <t>rRNA</t> gene identified in milk samples of cows enrolled either on with antibiotic (ceftiofur hydrochloride) and teat sealant (ATS) or just teat sealant (TS) at dry off and 7 days postpartum. Error bars correspond to standard error of the mean.
    Bacterial Archaeal 16s Rrna Gene, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 88/100, based on 60 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bacterial archaeal 16s rrna gene/product/Illumina Inc
    Average 88 stars, based on 60 article reviews
    Price from $9.99 to $1999.99
    bacterial archaeal 16s rrna gene - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    91
    Illumina Inc 16s rrna gene sequencing bacterial 16s rrna gene amplification
    Bar graph illustrating the bacterial load measured as mean log10 number of the <t>16S</t> <t>rRNA</t> gene identified in milk samples of cows enrolled either on with antibiotic (ceftiofur hydrochloride) and teat sealant (ATS) or just teat sealant (TS) at dry off and 7 days postpartum. Error bars correspond to standard error of the mean.
    16s Rrna Gene Sequencing Bacterial 16s Rrna Gene Amplification, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 91/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/16s rrna gene sequencing bacterial 16s rrna gene amplification/product/Illumina Inc
    Average 91 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    16s rrna gene sequencing bacterial 16s rrna gene amplification - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    92
    First BASE Laboratories rrna gene sequencing
    Bar graph illustrating the bacterial load measured as mean log10 number of the <t>16S</t> <t>rRNA</t> gene identified in milk samples of cows enrolled either on with antibiotic (ceftiofur hydrochloride) and teat sealant (ATS) or just teat sealant (TS) at dry off and 7 days postpartum. Error bars correspond to standard error of the mean.
    Rrna Gene Sequencing, supplied by First BASE Laboratories, used in various techniques. Bioz Stars score: 92/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rrna gene sequencing/product/First BASE Laboratories
    Average 92 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    rrna gene sequencing - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    92
    Illumina Inc rrna gene
    Bar graph illustrating the bacterial load measured as mean log10 number of the <t>16S</t> <t>rRNA</t> gene identified in milk samples of cows enrolled either on with antibiotic (ceftiofur hydrochloride) and teat sealant (ATS) or just teat sealant (TS) at dry off and 7 days postpartum. Error bars correspond to standard error of the mean.
    Rrna Gene, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 92/100, based on 269 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rrna gene/product/Illumina Inc
    Average 92 stars, based on 269 article reviews
    Price from $9.99 to $1999.99
    rrna gene - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    91
    TaKaRa rrna gene
    Bar graph illustrating the bacterial load measured as mean log10 number of the <t>16S</t> <t>rRNA</t> gene identified in milk samples of cows enrolled either on with antibiotic (ceftiofur hydrochloride) and teat sealant (ATS) or just teat sealant (TS) at dry off and 7 days postpartum. Error bars correspond to standard error of the mean.
    Rrna Gene, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 78 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rrna gene/product/TaKaRa
    Average 91 stars, based on 78 article reviews
    Price from $9.99 to $1999.99
    rrna gene - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    Image Search Results


    Phylogenetic classification of amplified archaeal 16S rRNA genes in the methanogenic incubations. The maximum taxonomy depth is on family level. Taxonomic groups with

    Journal: Environmental Microbiology

    Article Title: Increases in temperature and nutrient availability positively affect methane‐cycling microorganisms in Arctic thermokarst lake sediments

    doi: 10.1111/1462-2920.14345

    Figure Lengend Snippet: Phylogenetic classification of amplified archaeal 16S rRNA genes in the methanogenic incubations. The maximum taxonomy depth is on family level. Taxonomic groups with

    Article Snippet: Standard curves were constructed with a 10‐fold serial dilution of a quantified copy number of pGEM®‐T Easy plasmids with inserted Illumina PCR fragments of archaeal and bacterial 16S rRNA gene (Promega, Madison, WI).

    Techniques: Amplification

    ( a ) Rarefaction curves showing the observed OTU richness (at 97% identity) of the 16S rRNA gene with increasing sequencing depth. Mean values (n = 3) were shown for the two salinity treatments (S1 and S4) and two soil depths. ( b ) Comparison of the bacterial communities at the phylum level. Relative read abundance of different bacterial phyla in bacterial communities. Sequences that could not be classified into any known group were labeled “others”.

    Journal: Scientific Reports

    Article Title: Salinity altered root distribution and increased diversity of bacterial communities in the rhizosphere soil of Jerusalem artichoke

    doi: 10.1038/srep20687

    Figure Lengend Snippet: ( a ) Rarefaction curves showing the observed OTU richness (at 97% identity) of the 16S rRNA gene with increasing sequencing depth. Mean values (n = 3) were shown for the two salinity treatments (S1 and S4) and two soil depths. ( b ) Comparison of the bacterial communities at the phylum level. Relative read abundance of different bacterial phyla in bacterial communities. Sequences that could not be classified into any known group were labeled “others”.

    Article Snippet: Bacterial 16S rRNA gene amplification and Illumina Sequencing Primers 577F (5′-AYTGGGYDTAAAGNG-3′) and 926R (5′-CCGTCAATTCMTTTRAGT-3′) targeting the regions (V3-V4) of the 16S rRNA gene were used for PCR, because sequences in that regions provided the greatest diversity at the domain and bacterial phylum levels .

    Techniques: Sequencing, Labeling

    Distribution of sequence lengths for matching barcodes. Once all the forward and reverse reads from the Illumina sequencer are joined one can see – in gray here – a pattern in the size of the fragments produced. Superposing in red the abundance of length variation found in the SILVAMOD database, one can see that the variation we uncovered follows closely the natural variation of the V3–V4 region of the 16S rRNA gene. As shown in Fig. 3 , each of the three peaks are composed of characteristic phyla.

    Journal: PLoS ONE

    Article Title: Microbial Community Composition and Diversity via 16S rRNA Gene Amplicons: Evaluating the Illumina Platform

    doi: 10.1371/journal.pone.0116955

    Figure Lengend Snippet: Distribution of sequence lengths for matching barcodes. Once all the forward and reverse reads from the Illumina sequencer are joined one can see – in gray here – a pattern in the size of the fragments produced. Superposing in red the abundance of length variation found in the SILVAMOD database, one can see that the variation we uncovered follows closely the natural variation of the V3–V4 region of the 16S rRNA gene. As shown in Fig. 3 , each of the three peaks are composed of characteristic phyla.

    Article Snippet: Here we introduce our own protocol starting with PCR amplification of bacterial 16S rRNA genes, followed by paired-end Illumina sequencing and ending with bioinformatic analyses.

    Techniques: Sequencing, Produced

    Heatmap of the bacterial community composition based on 16S rRNA gene sequences for the sponge samples collected in 2014. OTUs were clustered at 97% similarity and the lowest taxonomy classification are given. Columns are clustered based on Bray–Curtis dissimilarity using hierarchical clustering with the “average” method (scale depicts percentage of dissimilarities). Samples are indicated in purple: C. concentrica , orange: Scopalina sp., blue: seawater, and red: T. anhelans . Numbers 1, 2, and 3 indicate sample replicates.

    Journal: PeerJ

    Article Title: Diversity, host-specificity and stability of sponge-associated fungal communities of co-occurring sponges

    doi: 10.7717/peerj.4965

    Figure Lengend Snippet: Heatmap of the bacterial community composition based on 16S rRNA gene sequences for the sponge samples collected in 2014. OTUs were clustered at 97% similarity and the lowest taxonomy classification are given. Columns are clustered based on Bray–Curtis dissimilarity using hierarchical clustering with the “average” method (scale depicts percentage of dissimilarities). Samples are indicated in purple: C. concentrica , orange: Scopalina sp., blue: seawater, and red: T. anhelans . Numbers 1, 2, and 3 indicate sample replicates.

    Article Snippet: Bacterial 16S rRNA gene amplicon sequencing of sponge and seawater samples were therefore conducted using primers 515F (5′-GTG CCA GCM GCC GCG GTA A-3′) and 806R (5′-GGA CTA CHV GGG TWT CTA AT-3′) with the Illumina MiSeq sequencing platform and 2 × 250 bp chemistry at the Ramaciotti Centre for Genomics (University of New South Wales, Sydney, NSW, Australia), according to the methodology described by .

    Techniques:

    16S rRNA clone libraries.

    Journal: Applied and Environmental Microbiology

    Article Title: Identification of Anthraquinone-Degrading Bacteria in Soil Contaminated with Polycyclic Aromatic Hydrocarbons

    doi: 10.1128/AEM.00033-15

    Figure Lengend Snippet: 16S rRNA clone libraries.

    Article Snippet: Bacterial 16S rRNA genes were amplified using the FastStart high-fidelity PCR system (Roche, Indianapolis, IN).

    Techniques:

    Comparing sequence error types across different alignment filtering. The different types of sequencing errors, obtained from the MOTHUR error report file, were plotted in Graph Pad Prism 6. The x-axis shows the base pair position in the full-length bacterial 16S rRNA gene and the y-axis shows the sequence error rate on a log 2 scale. The abundance of substitution errors, insertion errors, and deletion errors using standard quality filtering a , with low stringency post alignment filtering b , and high stringency post alignment filtering c are shown. The standard quality filtering parameters were: maximum ambiguous sequences = 0, maximum number of homo-polymers 6, sequence quality average of 35 over a sequence quality window of 50 bp. The extra post alignment screening parameters were: post alignment screening using minimum sequence similarity and minimum alignment score of 80% b and post alignment screening using minimum sequence similarity and minimum alignment score of 90% c

    Journal: BMC Microbiology

    Article Title: Evaluation of PacBio sequencing for full-length bacterial 16S rRNA gene classification

    doi: 10.1186/s12866-016-0891-4

    Figure Lengend Snippet: Comparing sequence error types across different alignment filtering. The different types of sequencing errors, obtained from the MOTHUR error report file, were plotted in Graph Pad Prism 6. The x-axis shows the base pair position in the full-length bacterial 16S rRNA gene and the y-axis shows the sequence error rate on a log 2 scale. The abundance of substitution errors, insertion errors, and deletion errors using standard quality filtering a , with low stringency post alignment filtering b , and high stringency post alignment filtering c are shown. The standard quality filtering parameters were: maximum ambiguous sequences = 0, maximum number of homo-polymers 6, sequence quality average of 35 over a sequence quality window of 50 bp. The extra post alignment screening parameters were: post alignment screening using minimum sequence similarity and minimum alignment score of 80% b and post alignment screening using minimum sequence similarity and minimum alignment score of 90% c

    Article Snippet: We could not identify a bias regarding different phyla and genera classification between capillary and PacBio full-length bacterial 16S rRNA gene in the pooled stool community.

    Techniques: Sequencing

    Alpha diversity analysis using 97% (0.03) OTU distance. Several different alpha diversity indexes: number of observed OTUs a ; Chao community richness b ; Shannon diversity index c ; Q statistic – Qstat diversity index d ; inverse Simpson diversity index e ; and sample coverage index f calculated in Mothur are shown for five different datasets analyzed. Lines connect the same samples in each detection method. Statistical analysis was performed in Graph Pad using the One-way ANOVA for between group comparisons. Abbreviations: OTU = operational taxonomy unit, MiSeq = Illumina MiSeq sequencing platform, V1V2 = bacterial 16S rRNA gene region V1 to V2, V1V9 = bacterial full-length 16S rRNA gene, LO = PacBio datasets with low stringency post alignment screening using a minimum alignment score of 80% and minimum alignment similarity score of 80%. HI = PacBio datasets with high stringency post alignment screening using a minimum alignment score of 90% and a minimum alignment similarity score of 90%. Dashed line = significant difference at 95% confidence interval ( P

    Journal: BMC Microbiology

    Article Title: Evaluation of PacBio sequencing for full-length bacterial 16S rRNA gene classification

    doi: 10.1186/s12866-016-0891-4

    Figure Lengend Snippet: Alpha diversity analysis using 97% (0.03) OTU distance. Several different alpha diversity indexes: number of observed OTUs a ; Chao community richness b ; Shannon diversity index c ; Q statistic – Qstat diversity index d ; inverse Simpson diversity index e ; and sample coverage index f calculated in Mothur are shown for five different datasets analyzed. Lines connect the same samples in each detection method. Statistical analysis was performed in Graph Pad using the One-way ANOVA for between group comparisons. Abbreviations: OTU = operational taxonomy unit, MiSeq = Illumina MiSeq sequencing platform, V1V2 = bacterial 16S rRNA gene region V1 to V2, V1V9 = bacterial full-length 16S rRNA gene, LO = PacBio datasets with low stringency post alignment screening using a minimum alignment score of 80% and minimum alignment similarity score of 80%. HI = PacBio datasets with high stringency post alignment screening using a minimum alignment score of 90% and a minimum alignment similarity score of 90%. Dashed line = significant difference at 95% confidence interval ( P

    Article Snippet: We could not identify a bias regarding different phyla and genera classification between capillary and PacBio full-length bacterial 16S rRNA gene in the pooled stool community.

    Techniques: Sequencing

    Alpha diversity analysis using unique OTU distance. Several different alpha diversity indexes: number of observed OTUs a ; Chao community richness b ; Shannon diversity index c ; Q statistic – Qstat diversity index d ; inverse Simpson diversity index e ; and sample coverage index f calculated in Mothur are shown for five different datasets analyzed. Lines connect the same samples in each dataset. Statistical analysis was performed in Graph Pad using the One-way ANOVA for between group comparisons. Abbreviations: OTU = operational taxonomy unit, MiSeq = Illumina MiSeq sequencing platform, V1V2 = bacterial 16S rRNA gene region V1 to V2, V1V9 = bacterial full-length 16S rRNA gene, LO = PacBio datasets with low stringency post alignment screening using a minimum alignment score of 80% and minimum alignment similarity score of 80%. HI = PacBio datasets with high stringency post alignment screening using a minimum alignment score of 90% and a minimum alignment similarity score of 90%. Dashed line = significant difference at 95% confidence interval ( P

    Journal: BMC Microbiology

    Article Title: Evaluation of PacBio sequencing for full-length bacterial 16S rRNA gene classification

    doi: 10.1186/s12866-016-0891-4

    Figure Lengend Snippet: Alpha diversity analysis using unique OTU distance. Several different alpha diversity indexes: number of observed OTUs a ; Chao community richness b ; Shannon diversity index c ; Q statistic – Qstat diversity index d ; inverse Simpson diversity index e ; and sample coverage index f calculated in Mothur are shown for five different datasets analyzed. Lines connect the same samples in each dataset. Statistical analysis was performed in Graph Pad using the One-way ANOVA for between group comparisons. Abbreviations: OTU = operational taxonomy unit, MiSeq = Illumina MiSeq sequencing platform, V1V2 = bacterial 16S rRNA gene region V1 to V2, V1V9 = bacterial full-length 16S rRNA gene, LO = PacBio datasets with low stringency post alignment screening using a minimum alignment score of 80% and minimum alignment similarity score of 80%. HI = PacBio datasets with high stringency post alignment screening using a minimum alignment score of 90% and a minimum alignment similarity score of 90%. Dashed line = significant difference at 95% confidence interval ( P

    Article Snippet: We could not identify a bias regarding different phyla and genera classification between capillary and PacBio full-length bacterial 16S rRNA gene in the pooled stool community.

    Techniques: Sequencing

    Change in sequence error rate a and the proportion of high quality reads that were retained when using different sequencing curation methods b. a The overall sequence error rates are plotted on the y-axis. The x-axis show the different allowed mismatches in the pre-clustering steps (5, 10, and 15 base pair for the full-length bacterial 16S rRNA gene) across the different screened datasets: no post alignment screening, post alignment screening using minimum sequence similarity (minsim) and minimum alignment score of (minscore) of 80%, post alignment screening using minsim and minscore of 90%. The round, square, top facing triangle and bottom facing triangle symbols denotes the 1 pass, 2 pass, 4 pass, and 8 pass datasets, respectively. b Top panel – Bold symbols, number of filtered raw reads across the different 1 pass, 2 pass, 4 pass, and 8 pass datasets. Top panel – Open symbols, number of high quality reads (HQRs) across the different post aligned screened datasets, i.e. no post alignment screening, post alignment screening using minimum sequence similarity and minimum alignment score of 80% (80/80), post alignment screening using minimum sequence similarity and minimum alignment score of 90% (90/90). b Bottom panel, + symbol = number of HQRs in the pre-clustered dataset with 5 allowed mismatches, x symbol = number of HQRs in the pre-clustered dataset with 10 allowed mismatches, circle with dot = number of HQRs in the pre-clustered datasets with 15 allowed mismatches

    Journal: BMC Microbiology

    Article Title: Evaluation of PacBio sequencing for full-length bacterial 16S rRNA gene classification

    doi: 10.1186/s12866-016-0891-4

    Figure Lengend Snippet: Change in sequence error rate a and the proportion of high quality reads that were retained when using different sequencing curation methods b. a The overall sequence error rates are plotted on the y-axis. The x-axis show the different allowed mismatches in the pre-clustering steps (5, 10, and 15 base pair for the full-length bacterial 16S rRNA gene) across the different screened datasets: no post alignment screening, post alignment screening using minimum sequence similarity (minsim) and minimum alignment score of (minscore) of 80%, post alignment screening using minsim and minscore of 90%. The round, square, top facing triangle and bottom facing triangle symbols denotes the 1 pass, 2 pass, 4 pass, and 8 pass datasets, respectively. b Top panel – Bold symbols, number of filtered raw reads across the different 1 pass, 2 pass, 4 pass, and 8 pass datasets. Top panel – Open symbols, number of high quality reads (HQRs) across the different post aligned screened datasets, i.e. no post alignment screening, post alignment screening using minimum sequence similarity and minimum alignment score of 80% (80/80), post alignment screening using minimum sequence similarity and minimum alignment score of 90% (90/90). b Bottom panel, + symbol = number of HQRs in the pre-clustered dataset with 5 allowed mismatches, x symbol = number of HQRs in the pre-clustered dataset with 10 allowed mismatches, circle with dot = number of HQRs in the pre-clustered datasets with 15 allowed mismatches

    Article Snippet: We could not identify a bias regarding different phyla and genera classification between capillary and PacBio full-length bacterial 16S rRNA gene in the pooled stool community.

    Techniques: Sequencing

    Comparison of the microbiome from quarters with clinical mastitis associated with Escherichia coli and healthy quarters (i.e. reference for calculation of fold change). Size of the circle is proportional to the overall prevalence of each family. Color of the circle is associated with effect size. The graph plots log fold change in 16S rRNA gene abundance in mastitic relative to healthy control quarters versus false discovery rate (FDR) logWorth (i.e. −log10P). P-values are adjusted for FDR. The dashed line represents the adjusted P -value = 0.01.

    Journal: Scientific Reports

    Article Title: Longitudinal metagenomic profiling of bovine milk to assess the impact of intramammary treatment using a third-generation cephalosporin

    doi: 10.1038/srep37565

    Figure Lengend Snippet: Comparison of the microbiome from quarters with clinical mastitis associated with Escherichia coli and healthy quarters (i.e. reference for calculation of fold change). Size of the circle is proportional to the overall prevalence of each family. Color of the circle is associated with effect size. The graph plots log fold change in 16S rRNA gene abundance in mastitic relative to healthy control quarters versus false discovery rate (FDR) logWorth (i.e. −log10P). P-values are adjusted for FDR. The dashed line represents the adjusted P -value = 0.01.

    Article Snippet: Amplification of the V4 Hypervariable Region of the Bacterial 16S rRNA Gene, Library Preparation, and 16S rRNA Gene Sequencing The V4 hypervariable region of the bacterial 16S rRNA gene was amplified from genomic DNA by PCR utilizing the primers 515F and 806R optimized for the Illumina MiSeq platform (Illumina Inc., San Diego, CA) as described previously .

    Techniques:

    Comparison of the microbiome from quarters with clinical mastitis associated with negative culture and healthy quarters (i.e. reference for calculation of fold change) on day 0. Size of the circle is proportional to the overall prevalence of each family. Color of the circle is associated with effect size. The graph plots log fold change in 16S rRNA gene abundance in mastitic relative to healthy control quarters versus false discovery rate (FDR) logWorth (i.e. −log10P). P-values are adjusted for FDR. The dashed line represents the adjusted P -value = 0.05.

    Journal: Scientific Reports

    Article Title: Longitudinal metagenomic profiling of bovine milk to assess the impact of intramammary treatment using a third-generation cephalosporin

    doi: 10.1038/srep37565

    Figure Lengend Snippet: Comparison of the microbiome from quarters with clinical mastitis associated with negative culture and healthy quarters (i.e. reference for calculation of fold change) on day 0. Size of the circle is proportional to the overall prevalence of each family. Color of the circle is associated with effect size. The graph plots log fold change in 16S rRNA gene abundance in mastitic relative to healthy control quarters versus false discovery rate (FDR) logWorth (i.e. −log10P). P-values are adjusted for FDR. The dashed line represents the adjusted P -value = 0.05.

    Article Snippet: Amplification of the V4 Hypervariable Region of the Bacterial 16S rRNA Gene, Library Preparation, and 16S rRNA Gene Sequencing The V4 hypervariable region of the bacterial 16S rRNA gene was amplified from genomic DNA by PCR utilizing the primers 515F and 806R optimized for the Illumina MiSeq platform (Illumina Inc., San Diego, CA) as described previously .

    Techniques:

    Effect of clinical mastitis and intramammary treatment with ceftiofur hydrochloride (days 1–5) on the number of 16S rRNA gene copies in cows with clinical mastitis associated with Escherichia coli ( a ) or negative culture ( c ), and microbial diversity in cows with clinical mastitis associated with Escherichia coli ( b ) or negative culture ( d ). Bars represent standard error of the mean. Asterisks represent significant differences at α = 0.05 between groups within the same study day. ( a ) Mastitic-Control had a significantly greater bacterial load than Mastitic-Ceftiofur and healthy quarters on day 3. ( c ) On day 1, both mastitic quarters had a significantly greater bacterial load when compared to healthy quarters. On day 8, Mastitic-Control had a significantly greater bacterial load than Mastitic-Ceftiofur and healthy quarters.

    Journal: Scientific Reports

    Article Title: Longitudinal metagenomic profiling of bovine milk to assess the impact of intramammary treatment using a third-generation cephalosporin

    doi: 10.1038/srep37565

    Figure Lengend Snippet: Effect of clinical mastitis and intramammary treatment with ceftiofur hydrochloride (days 1–5) on the number of 16S rRNA gene copies in cows with clinical mastitis associated with Escherichia coli ( a ) or negative culture ( c ), and microbial diversity in cows with clinical mastitis associated with Escherichia coli ( b ) or negative culture ( d ). Bars represent standard error of the mean. Asterisks represent significant differences at α = 0.05 between groups within the same study day. ( a ) Mastitic-Control had a significantly greater bacterial load than Mastitic-Ceftiofur and healthy quarters on day 3. ( c ) On day 1, both mastitic quarters had a significantly greater bacterial load when compared to healthy quarters. On day 8, Mastitic-Control had a significantly greater bacterial load than Mastitic-Ceftiofur and healthy quarters.

    Article Snippet: Amplification of the V4 Hypervariable Region of the Bacterial 16S rRNA Gene, Library Preparation, and 16S rRNA Gene Sequencing The V4 hypervariable region of the bacterial 16S rRNA gene was amplified from genomic DNA by PCR utilizing the primers 515F and 806R optimized for the Illumina MiSeq platform (Illumina Inc., San Diego, CA) as described previously .

    Techniques:

    Taxonomic composition of the soil, rhizosphere and root endosphere of pioneer desert plants in Jizan and Al Wahbah. Relative abundance of bacterial phyla (A) and bacterial families (B) associated with the soil, rhizosphere and root endosphere of four plant species at two different locations of the Saudi Arabian desert (Jizan and Al Wahbah), based on the V3-V4 region of the 16S rRNA region. Number of biological replicates indicated above stacked columns ( n ) , taxa present at greater than 1% of the average community are shown. E— E . granulata ; P— P . turgidum ; T— T . terrestris ; Z— Z . simplex .

    Journal: PLoS ONE

    Article Title: Desert plant bacteria reveal host influence and beneficial plant growth properties

    doi: 10.1371/journal.pone.0208223

    Figure Lengend Snippet: Taxonomic composition of the soil, rhizosphere and root endosphere of pioneer desert plants in Jizan and Al Wahbah. Relative abundance of bacterial phyla (A) and bacterial families (B) associated with the soil, rhizosphere and root endosphere of four plant species at two different locations of the Saudi Arabian desert (Jizan and Al Wahbah), based on the V3-V4 region of the 16S rRNA region. Number of biological replicates indicated above stacked columns ( n ) , taxa present at greater than 1% of the average community are shown. E— E . granulata ; P— P . turgidum ; T— T . terrestris ; Z— Z . simplex .

    Article Snippet: Briefly, the V3-V4 regions of the 16S bacterial rRNA gene were amplified using a two-step PCR protocol with V3-V4 primers (For: 5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG CCTACGGGNGGCWGCAG-3’ ; Rev: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG GACTACHVGGGTATCTAATCC-3’ , overhang adapter sequences are underlined) [ ] for the first PCR step and Illumina Nextera XT Index kit (Illumina Inc., San Diego, CA, USA) for the second PCR step.

    Techniques:

    Taxonomic composition of culturable root endosphere bacteria (endophytes) from Jizan desert plants. Relative abundance of the bacterial phyla (bar chart) and genera (pie chart) as a percentage of the total bacteria isolated from each plant species’ root endosphere (presented after each bar in parentheses), based on the full-length 16S rRNA sequences.

    Journal: PLoS ONE

    Article Title: Desert plant bacteria reveal host influence and beneficial plant growth properties

    doi: 10.1371/journal.pone.0208223

    Figure Lengend Snippet: Taxonomic composition of culturable root endosphere bacteria (endophytes) from Jizan desert plants. Relative abundance of the bacterial phyla (bar chart) and genera (pie chart) as a percentage of the total bacteria isolated from each plant species’ root endosphere (presented after each bar in parentheses), based on the full-length 16S rRNA sequences.

    Article Snippet: Briefly, the V3-V4 regions of the 16S bacterial rRNA gene were amplified using a two-step PCR protocol with V3-V4 primers (For: 5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG CCTACGGGNGGCWGCAG-3’ ; Rev: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG GACTACHVGGGTATCTAATCC-3’ , overhang adapter sequences are underlined) [ ] for the first PCR step and Illumina Nextera XT Index kit (Illumina Inc., San Diego, CA, USA) for the second PCR step.

    Techniques: Isolation

    The increases in the percentage of Dehalococcoides -like 16S rRNA genes out of the total number of Bacteria 16S rRNA genes and the total number of Dehalococcoides -like 16S rRNA genes are shown for the separation only method applied to the PCB-enriched

    Journal: Applied and Environmental Microbiology

    Article Title: Rapid Enrichment of Dehalococcoides-Like Bacteria by Partial Hydrophobic Separation

    doi: 10.1128/AEM.02946-16

    Figure Lengend Snippet: The increases in the percentage of Dehalococcoides -like 16S rRNA genes out of the total number of Bacteria 16S rRNA genes and the total number of Dehalococcoides -like 16S rRNA genes are shown for the separation only method applied to the PCB-enriched

    Article Snippet: Evaluating bias of Illumina-based bacterial 16S rRNA gene profiles .

    Techniques:

    The changes in the percentage of Dehalococcoides -like 16S rRNA genes out of the total number of Bacteria 16S rRNA genes are shown for the incubation plus separation experiments with the PCB-enriched sediment-free culture. Incubation periods ranged from

    Journal: Applied and Environmental Microbiology

    Article Title: Rapid Enrichment of Dehalococcoides-Like Bacteria by Partial Hydrophobic Separation

    doi: 10.1128/AEM.02946-16

    Figure Lengend Snippet: The changes in the percentage of Dehalococcoides -like 16S rRNA genes out of the total number of Bacteria 16S rRNA genes are shown for the incubation plus separation experiments with the PCB-enriched sediment-free culture. Incubation periods ranged from

    Article Snippet: Evaluating bias of Illumina-based bacterial 16S rRNA gene profiles .

    Techniques: Incubation

    The increases in the percentage of Dehalococcoides -like 16S rRNA genes out of the total number of Bacteria 16S rRNA genes are shown for the separation only method using both TCE and HD with anaerobic digester sludge (A) and TCE with uncontaminated sediment

    Journal: Applied and Environmental Microbiology

    Article Title: Rapid Enrichment of Dehalococcoides-Like Bacteria by Partial Hydrophobic Separation

    doi: 10.1128/AEM.02946-16

    Figure Lengend Snippet: The increases in the percentage of Dehalococcoides -like 16S rRNA genes out of the total number of Bacteria 16S rRNA genes are shown for the separation only method using both TCE and HD with anaerobic digester sludge (A) and TCE with uncontaminated sediment

    Article Snippet: Evaluating bias of Illumina-based bacterial 16S rRNA gene profiles .

    Techniques:

    The numbers of 16S rRNA genes (copies per milliliter of sample) of Desulfitobacterium (light gray), Dehalococcoides -like bacteria (medium gray), and total Bacteria (black) are shown from the interface samples after cycles of enrichment and separation

    Journal: Applied and Environmental Microbiology

    Article Title: Rapid Enrichment of Dehalococcoides-Like Bacteria by Partial Hydrophobic Separation

    doi: 10.1128/AEM.02946-16

    Figure Lengend Snippet: The numbers of 16S rRNA genes (copies per milliliter of sample) of Desulfitobacterium (light gray), Dehalococcoides -like bacteria (medium gray), and total Bacteria (black) are shown from the interface samples after cycles of enrichment and separation

    Article Snippet: Evaluating bias of Illumina-based bacterial 16S rRNA gene profiles .

    Techniques:

    Total bacterial abundance (black bar) determined by quantitative PCR targeting the 16S rRNA gene and total aerosol particle numbers (particle size: > 1.0 μm [gray bar]) determined by particle counter. Samples were collected during each of the four seasons, including after rainy days and Asian dust days.

    Journal: Scientific Reports

    Article Title: Investigation of bacterial effects of Asian dust events through comparison with seasonal variability in outdoor airborne bacterial community

    doi: 10.1038/srep35706

    Figure Lengend Snippet: Total bacterial abundance (black bar) determined by quantitative PCR targeting the 16S rRNA gene and total aerosol particle numbers (particle size: > 1.0 μm [gray bar]) determined by particle counter. Samples were collected during each of the four seasons, including after rainy days and Asian dust days.

    Article Snippet: Estimation of bacterial abundance To determine bacterial abundance, 16S rRNA gene was quantified by real-time PCR using a LightCycler (Roche Diagnostics, Mannheim, Germany).

    Techniques: Real-time Polymerase Chain Reaction

    Correlation of bacterial abundance with particle size distribution. The bacterial abundance was determined by quantitative PCR targeting the 16S rRNA gene (V6–V8). Blue and yellow indicate non-Asian and Asian dust samples, respectively.

    Journal: Scientific Reports

    Article Title: Investigation of bacterial effects of Asian dust events through comparison with seasonal variability in outdoor airborne bacterial community

    doi: 10.1038/srep35706

    Figure Lengend Snippet: Correlation of bacterial abundance with particle size distribution. The bacterial abundance was determined by quantitative PCR targeting the 16S rRNA gene (V6–V8). Blue and yellow indicate non-Asian and Asian dust samples, respectively.

    Article Snippet: Estimation of bacterial abundance To determine bacterial abundance, 16S rRNA gene was quantified by real-time PCR using a LightCycler (Roche Diagnostics, Mannheim, Germany).

    Techniques: Real-time Polymerase Chain Reaction

    Multidimensional scaling (MDS) analysis of bacterial 16S rRNA genes obtained from aerosols in outdoor environments.

    Journal: Scientific Reports

    Article Title: Investigation of bacterial effects of Asian dust events through comparison with seasonal variability in outdoor airborne bacterial community

    doi: 10.1038/srep35706

    Figure Lengend Snippet: Multidimensional scaling (MDS) analysis of bacterial 16S rRNA genes obtained from aerosols in outdoor environments.

    Article Snippet: Estimation of bacterial abundance To determine bacterial abundance, 16S rRNA gene was quantified by real-time PCR using a LightCycler (Roche Diagnostics, Mannheim, Germany).

    Techniques:

    Taxonomic composition of each sample of outdoor airborne bacterial communities. Composition estimates are based on relative abundances of bacterial 16S rRNA gene sequences assigned to different common phyla and classes.

    Journal: Scientific Reports

    Article Title: Investigation of bacterial effects of Asian dust events through comparison with seasonal variability in outdoor airborne bacterial community

    doi: 10.1038/srep35706

    Figure Lengend Snippet: Taxonomic composition of each sample of outdoor airborne bacterial communities. Composition estimates are based on relative abundances of bacterial 16S rRNA gene sequences assigned to different common phyla and classes.

    Article Snippet: Estimation of bacterial abundance To determine bacterial abundance, 16S rRNA gene was quantified by real-time PCR using a LightCycler (Roche Diagnostics, Mannheim, Germany).

    Techniques:

    Comparison of similarities and differences for gut microbiota composition between transgenic fish and wild-type controls across different developmental stages. (a) Comparison of the average Sørensen index obtained from DGGE patterns of 16S rRNA genes between transgenic fish and wild-type controls or within each group of transgenic fish and wild-type controls. (b) Comparison of Raup and Crick similarity index ( S RC ) obtained from DGGE patterns of 16S rRNA genes between transgenic fish and wild-type controls or within each group of transgenic fish and wild-type controls. Dashed lines indicate significant cutoff for difference (low line) and similarity (upper line). Error bars represent the standard error of the mean.

    Journal: PLoS ONE

    Article Title: Gut Microbiota Contributes to the Growth of Fast-Growing Transgenic Common Carp (Cyprinus carpio L.)

    doi: 10.1371/journal.pone.0064577

    Figure Lengend Snippet: Comparison of similarities and differences for gut microbiota composition between transgenic fish and wild-type controls across different developmental stages. (a) Comparison of the average Sørensen index obtained from DGGE patterns of 16S rRNA genes between transgenic fish and wild-type controls or within each group of transgenic fish and wild-type controls. (b) Comparison of Raup and Crick similarity index ( S RC ) obtained from DGGE patterns of 16S rRNA genes between transgenic fish and wild-type controls or within each group of transgenic fish and wild-type controls. Dashed lines indicate significant cutoff for difference (low line) and similarity (upper line). Error bars represent the standard error of the mean.

    Article Snippet: Bacterial 16S rRNA Gene Pyrosequencing The V1-V3 regions, which have more related variations for 16S rRNA gene than shorter sequences or the full-length sequence , were amplified using the bacterial primers 27F and 534R ( ) with Pyrobest™ DNA polymerase (Takara).

    Techniques: Transgenic Assay, Fluorescence In Situ Hybridization, Denaturing Gradient Gel Electrophoresis

    Comparison of relative Bacteroidetes and Firmicutes abundance at different developmental stages. Real-time quantitative PCR (Q-PCR) was used to quantify the abundance of gut Firmicutes and Bacteroidetes based on the 16S rRNA genes (V3 region). (a) Relative abundance of Firmicutes and Bacteroidetes in transgenic fish. (b) Relative abundance of Firmicutes and Bacteroidetes in wild-type controls.

    Journal: PLoS ONE

    Article Title: Gut Microbiota Contributes to the Growth of Fast-Growing Transgenic Common Carp (Cyprinus carpio L.)

    doi: 10.1371/journal.pone.0064577

    Figure Lengend Snippet: Comparison of relative Bacteroidetes and Firmicutes abundance at different developmental stages. Real-time quantitative PCR (Q-PCR) was used to quantify the abundance of gut Firmicutes and Bacteroidetes based on the 16S rRNA genes (V3 region). (a) Relative abundance of Firmicutes and Bacteroidetes in transgenic fish. (b) Relative abundance of Firmicutes and Bacteroidetes in wild-type controls.

    Article Snippet: Bacterial 16S rRNA Gene Pyrosequencing The V1-V3 regions, which have more related variations for 16S rRNA gene than shorter sequences or the full-length sequence , were amplified using the bacterial primers 27F and 534R ( ) with Pyrobest™ DNA polymerase (Takara).

    Techniques: Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Transgenic Assay, Fluorescence In Situ Hybridization

    Predicted domain coverage and specificity of archaeal primers. Dark bars are Methanogenic Archaea reported in the rumen. The coverage and specificity of Met630f and Met803r primers were determined in silico using PrimerProspector 33 . The primers were predicted to give > 90% coverage of Archaea based on 867 reference sequences contained in the Greengenes 16S rRNA database, with only

    Journal: Scientific Reports

    Article Title: Archaeal abundance in post-mortem ruminal digesta may help predict methane emissions from beef cattle

    doi: 10.1038/srep05892

    Figure Lengend Snippet: Predicted domain coverage and specificity of archaeal primers. Dark bars are Methanogenic Archaea reported in the rumen. The coverage and specificity of Met630f and Met803r primers were determined in silico using PrimerProspector 33 . The primers were predicted to give > 90% coverage of Archaea based on 867 reference sequences contained in the Greengenes 16S rRNA database, with only

    Article Snippet: Bacterial 16S rRNA genes were analyzed by qPCR using a BioRad iQ5.

    Techniques: In Silico

    Bar graph illustrating the bacterial load measured as mean log10 number of the 16S rRNA gene identified in milk samples of cows enrolled either on with antibiotic (ceftiofur hydrochloride) and teat sealant (ATS) or just teat sealant (TS) at dry off and 7 days postpartum. Error bars correspond to standard error of the mean.

    Journal: Scientific Reports

    Article Title: Milk microbiome and bacterial load following dry cow therapy without antibiotics in dairy cows with healthy mammary gland

    doi: 10.1038/s41598-017-08790-5

    Figure Lengend Snippet: Bar graph illustrating the bacterial load measured as mean log10 number of the 16S rRNA gene identified in milk samples of cows enrolled either on with antibiotic (ceftiofur hydrochloride) and teat sealant (ATS) or just teat sealant (TS) at dry off and 7 days postpartum. Error bars correspond to standard error of the mean.

    Article Snippet: The V4 hypervariable region of the bacterial/archaeal 16S rRNA gene was amplified by PCR according to a previously described protocol and optimized for the Illumina MiSeq platform (Illumina Inc., San Diego, CA, USA) using different 12-bp error-correcting Golay barcodes for the 16S rRNA gene PCR .

    Techniques:

    Bar graph illustrating the mean log10 number of the 16S rRNA gene identified in milk samples collected at dry off and 7 days postpartum. Error bars correspond to standard error of the mean.

    Journal: Scientific Reports

    Article Title: Milk microbiome and bacterial load following dry cow therapy without antibiotics in dairy cows with healthy mammary gland

    doi: 10.1038/s41598-017-08790-5

    Figure Lengend Snippet: Bar graph illustrating the mean log10 number of the 16S rRNA gene identified in milk samples collected at dry off and 7 days postpartum. Error bars correspond to standard error of the mean.

    Article Snippet: The V4 hypervariable region of the bacterial/archaeal 16S rRNA gene was amplified by PCR according to a previously described protocol and optimized for the Illumina MiSeq platform (Illumina Inc., San Diego, CA, USA) using different 12-bp error-correcting Golay barcodes for the 16S rRNA gene PCR .

    Techniques: