b3 primers Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs 10x thermopol reaction buffer
    10x Thermopol Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/10x thermopol reaction buffer/product/New England Biolabs
    Average 99 stars, based on 54 article reviews
    Price from $9.99 to $1999.99
    10x thermopol reaction buffer - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher b220 ra3 6b2 pe
    B220 Ra3 6b2 Pe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/b220 ra3 6b2 pe/product/Thermo Fisher
    Average 99 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    b220 ra3 6b2 pe - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    85
    Thermo Fisher b3 universal primers
    B3 Universal Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/b3 universal primers/product/Thermo Fisher
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    b3 universal primers - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    85
    CombiMatrix b3 customarray synthesizer
    B3 Customarray Synthesizer, supplied by CombiMatrix, used in various techniques. Bioz Stars score: 85/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/b3 customarray synthesizer/product/CombiMatrix
    Average 85 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    b3 customarray synthesizer - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    99
    R&D Systems igfbp 3
    Differential modulation of IGF-induced Akt phosphorylation in response to 1, 25-D 3 and <t>IGFBP-3</t> treatment in MCF-7 and MCF-7/VD R cells. (a) MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 30 nM IGF-I, alone or in combination, in serum-free medium. Cells were also treated with 100 nM IGFBP-3 alone or in combination with 30 nM IGF-I in serum-free medium. After 5 days of treatment, whole cell extracts were prepared and analysed by immunoblotting for total-Akt (T-Akt) and phospho-Akt (P-Akt). (b) Densitometric analysis of immunoblots was performed using GS-800 Calibrated Densitometer (Bio-Rad UK). Data shown are representative of three identical experiments. Means of 3 separated experiments are shown. * P
    Igfbp 3, supplied by R&D Systems, used in various techniques. Bioz Stars score: 99/100, based on 297 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igfbp 3/product/R&D Systems
    Average 99 stars, based on 297 article reviews
    Price from $9.99 to $1999.99
    igfbp 3 - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    93
    PrimerDesign Inc tgcatgtgccacatgagact nd b3 ctttcctctgtattctctctcc
    Differential modulation of IGF-induced Akt phosphorylation in response to 1, 25-D 3 and <t>IGFBP-3</t> treatment in MCF-7 and MCF-7/VD R cells. (a) MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 30 nM IGF-I, alone or in combination, in serum-free medium. Cells were also treated with 100 nM IGFBP-3 alone or in combination with 30 nM IGF-I in serum-free medium. After 5 days of treatment, whole cell extracts were prepared and analysed by immunoblotting for total-Akt (T-Akt) and phospho-Akt (P-Akt). (b) Densitometric analysis of immunoblots was performed using GS-800 Calibrated Densitometer (Bio-Rad UK). Data shown are representative of three identical experiments. Means of 3 separated experiments are shown. * P
    Tgcatgtgccacatgagact Nd B3 Ctttcctctgtattctctctcc, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tgcatgtgccacatgagact nd b3 ctttcctctgtattctctctcc/product/PrimerDesign Inc
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    tgcatgtgccacatgagact nd b3 ctttcctctgtattctctctcc - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    84
    CombiMatrix customarray b3 dna synthesiser
    Differential modulation of IGF-induced Akt phosphorylation in response to 1, 25-D 3 and <t>IGFBP-3</t> treatment in MCF-7 and MCF-7/VD R cells. (a) MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 30 nM IGF-I, alone or in combination, in serum-free medium. Cells were also treated with 100 nM IGFBP-3 alone or in combination with 30 nM IGF-I in serum-free medium. After 5 days of treatment, whole cell extracts were prepared and analysed by immunoblotting for total-Akt (T-Akt) and phospho-Akt (P-Akt). (b) Densitometric analysis of immunoblots was performed using GS-800 Calibrated Densitometer (Bio-Rad UK). Data shown are representative of three identical experiments. Means of 3 separated experiments are shown. * P
    Customarray B3 Dna Synthesiser, supplied by CombiMatrix, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/customarray b3 dna synthesiser/product/CombiMatrix
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    customarray b3 dna synthesiser - by Bioz Stars, 2020-07
    84/100 stars
      Buy from Supplier

    92
    TaKaRa primer
    Differential modulation of IGF-induced Akt phosphorylation in response to 1, 25-D 3 and <t>IGFBP-3</t> treatment in MCF-7 and MCF-7/VD R cells. (a) MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 30 nM IGF-I, alone or in combination, in serum-free medium. Cells were also treated with 100 nM IGFBP-3 alone or in combination with 30 nM IGF-I in serum-free medium. After 5 days of treatment, whole cell extracts were prepared and analysed by immunoblotting for total-Akt (T-Akt) and phospho-Akt (P-Akt). (b) Densitometric analysis of immunoblots was performed using GS-800 Calibrated Densitometer (Bio-Rad UK). Data shown are representative of three identical experiments. Means of 3 separated experiments are shown. * P
    Primer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 7117 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer/product/TaKaRa
    Average 92 stars, based on 7117 article reviews
    Price from $9.99 to $1999.99
    primer - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    Agilent technologies 38 k oligonucleotide microarray
    Differential modulation of IGF-induced Akt phosphorylation in response to 1, 25-D 3 and <t>IGFBP-3</t> treatment in MCF-7 and MCF-7/VD R cells. (a) MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 30 nM IGF-I, alone or in combination, in serum-free medium. Cells were also treated with 100 nM IGFBP-3 alone or in combination with 30 nM IGF-I in serum-free medium. After 5 days of treatment, whole cell extracts were prepared and analysed by immunoblotting for total-Akt (T-Akt) and phospho-Akt (P-Akt). (b) Densitometric analysis of immunoblots was performed using GS-800 Calibrated Densitometer (Bio-Rad UK). Data shown are representative of three identical experiments. Means of 3 separated experiments are shown. * P
    38 K Oligonucleotide Microarray, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 92/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/38 k oligonucleotide microarray/product/Agilent technologies
    Average 92 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    38 k oligonucleotide microarray - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    91
    Genewiz f3 primers
    Differential modulation of IGF-induced Akt phosphorylation in response to 1, 25-D 3 and <t>IGFBP-3</t> treatment in MCF-7 and MCF-7/VD R cells. (a) MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 30 nM IGF-I, alone or in combination, in serum-free medium. Cells were also treated with 100 nM IGFBP-3 alone or in combination with 30 nM IGF-I in serum-free medium. After 5 days of treatment, whole cell extracts were prepared and analysed by immunoblotting for total-Akt (T-Akt) and phospho-Akt (P-Akt). (b) Densitometric analysis of immunoblots was performed using GS-800 Calibrated Densitometer (Bio-Rad UK). Data shown are representative of three identical experiments. Means of 3 separated experiments are shown. * P
    F3 Primers, supplied by Genewiz, used in various techniques. Bioz Stars score: 91/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/f3 primers/product/Genewiz
    Average 91 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    f3 primers - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    92
    Bioneer Corporation primer mix
    Differential modulation of IGF-induced Akt phosphorylation in response to 1, 25-D 3 and <t>IGFBP-3</t> treatment in MCF-7 and MCF-7/VD R cells. (a) MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 30 nM IGF-I, alone or in combination, in serum-free medium. Cells were also treated with 100 nM IGFBP-3 alone or in combination with 30 nM IGF-I in serum-free medium. After 5 days of treatment, whole cell extracts were prepared and analysed by immunoblotting for total-Akt (T-Akt) and phospho-Akt (P-Akt). (b) Densitometric analysis of immunoblots was performed using GS-800 Calibrated Densitometer (Bio-Rad UK). Data shown are representative of three identical experiments. Means of 3 separated experiments are shown. * P
    Primer Mix, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer mix/product/Bioneer Corporation
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    primer mix - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    93
    PrimerDesign Inc a lamp specific primer set
    Differential modulation of IGF-induced Akt phosphorylation in response to 1, 25-D 3 and <t>IGFBP-3</t> treatment in MCF-7 and MCF-7/VD R cells. (a) MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 30 nM IGF-I, alone or in combination, in serum-free medium. Cells were also treated with 100 nM IGFBP-3 alone or in combination with 30 nM IGF-I in serum-free medium. After 5 days of treatment, whole cell extracts were prepared and analysed by immunoblotting for total-Akt (T-Akt) and phospho-Akt (P-Akt). (b) Densitometric analysis of immunoblots was performed using GS-800 Calibrated Densitometer (Bio-Rad UK). Data shown are representative of three identical experiments. Means of 3 separated experiments are shown. * P
    A Lamp Specific Primer Set, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 93/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/a lamp specific primer set/product/PrimerDesign Inc
    Average 93 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    a lamp specific primer set - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    85
    Boehringer Mannheim heat denatured digoxigenin random primer labeled tg hspb3 insert
    Differential modulation of IGF-induced Akt phosphorylation in response to 1, 25-D 3 and <t>IGFBP-3</t> treatment in MCF-7 and MCF-7/VD R cells. (a) MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 30 nM IGF-I, alone or in combination, in serum-free medium. Cells were also treated with 100 nM IGFBP-3 alone or in combination with 30 nM IGF-I in serum-free medium. After 5 days of treatment, whole cell extracts were prepared and analysed by immunoblotting for total-Akt (T-Akt) and phospho-Akt (P-Akt). (b) Densitometric analysis of immunoblots was performed using GS-800 Calibrated Densitometer (Bio-Rad UK). Data shown are representative of three identical experiments. Means of 3 separated experiments are shown. * P
    Heat Denatured Digoxigenin Random Primer Labeled Tg Hspb3 Insert, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 85/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/heat denatured digoxigenin random primer labeled tg hspb3 insert/product/Boehringer Mannheim
    Average 85 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    heat denatured digoxigenin random primer labeled tg hspb3 insert - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    94
    Biotium evagreen
    Differential modulation of IGF-induced Akt phosphorylation in response to 1, 25-D 3 and <t>IGFBP-3</t> treatment in MCF-7 and MCF-7/VD R cells. (a) MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 30 nM IGF-I, alone or in combination, in serum-free medium. Cells were also treated with 100 nM IGFBP-3 alone or in combination with 30 nM IGF-I in serum-free medium. After 5 days of treatment, whole cell extracts were prepared and analysed by immunoblotting for total-Akt (T-Akt) and phospho-Akt (P-Akt). (b) Densitometric analysis of immunoblots was performed using GS-800 Calibrated Densitometer (Bio-Rad UK). Data shown are representative of three identical experiments. Means of 3 separated experiments are shown. * P
    Evagreen, supplied by Biotium, used in various techniques. Bioz Stars score: 94/100, based on 2149 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/evagreen/product/Biotium
    Average 94 stars, based on 2149 article reviews
    Price from $9.99 to $1999.99
    evagreen - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher dntps mix
    Differential modulation of IGF-induced Akt phosphorylation in response to 1, 25-D 3 and <t>IGFBP-3</t> treatment in MCF-7 and MCF-7/VD R cells. (a) MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 30 nM IGF-I, alone or in combination, in serum-free medium. Cells were also treated with 100 nM IGFBP-3 alone or in combination with 30 nM IGF-I in serum-free medium. After 5 days of treatment, whole cell extracts were prepared and analysed by immunoblotting for total-Akt (T-Akt) and phospho-Akt (P-Akt). (b) Densitometric analysis of immunoblots was performed using GS-800 Calibrated Densitometer (Bio-Rad UK). Data shown are representative of three identical experiments. Means of 3 separated experiments are shown. * P
    Dntps Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1434 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntps mix/product/Thermo Fisher
    Average 99 stars, based on 1434 article reviews
    Price from $9.99 to $1999.99
    dntps mix - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    90
    Elim Bio cvb3
    MALAT1 -mascRNA system is involved in cardiovascular innate immunity. ( A ) MALAT1 levels were highly abundant in all tissues including heart (blue box) (mean ± SEM, n = 2) and in PBMCs from two healthy volunteers (red box), all of which are much higher than NEAT1 . ( B ) The small tRNA-like MALAT1- derived mascRNA abundance was only high in PBMCs (red box), but low in normal heart (blue box), as determined by northern blot analysis. The upper and autoradiographs show 20-h and 48-h exposures, respectively. ( C ) mascRNA was present in circulating immune cell fractions at different steady state levels, as analyzed by northern blot analysis of FACS-sorted human PBMCs (mean ± SEM; n = 2 sorts of buffy coats). U6 designates control RNA. ( D ) PMA used for differentiation of THP-1 cells into macrophages resulted in upregulation of mascRNA levels (lane 7 vs. 8, blue box; lanes 1A–3B with PMA vs. 4A–6B without PMA), which was strongly reduced by anti-mascRNA ASO treatment via heteroduplex formation between the ASO and mascRNA (lanes 2A, 2B vs. 1A, 1B, red box). The bar graphs show that mascRNA depletion of PMA-treated THP-1 cells by ASO treatment induced multiple immune-associated genes including FAS/FASLG, TNF/IL6, MMP2, chemokine CCL20, chemokine receptors CCR5/CCR7, but not affected MALAT1 transcript, as measured by qPCR. Data were normalized to scrambled ASO treatment and represent mean ± SEM of 2 −ΔΔCt values referenced to HPRT1. Student's t -test unpaired; n = 5, except n = 4 for CCR5 and CCR7. ns, no significance. At the functional level, coincubation with anti-mascRNA-treated THP-1 cells for 24 h resulted in significantly higher caspase 3/7 activity in Jurkat cells, compared with coincubation with control-ASO-treated THP-1 cells ( P = 0.001; n = 2). ( E ). Elevation of mascRNA levels in adenovector-transduced rat cells (black bars) was shown up to 72 h after infection with <t>CVB3,</t> compared with empty vector-transduced cells (gray bars) (central bar graph). Rapid and massive increase of CVB3 genome equivalents was observed in rat cardiomyocytes transduced with empty vector, whereas in sharp contrast no virus replication was detectable in mascRNA-transduced cells (upper bar graph) (mean ± SEM; n = 3; #). Recombinant mascRNA inhibited CVB3 replication not only in rat cardiomyocytes, but also in murine cardiomyocytes (lower graph) where virus replication is far more rapid than in rat cells (pfu = plaque forming units) (mean ± SEM; n = 4; ** P
    Cvb3, supplied by Elim Bio, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cvb3/product/Elim Bio
    Average 90 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    cvb3 - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    93
    Thermo Fisher bsm dna polymerase
    Optimisation of <t>Bsm</t> polymerase concentration. ( A ) Green color of LAMP positive samples, orange color of negative control, ( B ) The green fluorescence after addition of SYBR Green to each reaction mixture under UV light, ( C ) Electrophoresis of LAMP products in 2% agarose gel stained with GelRed™ <t>DNA</t> staining solution. Neg – negative control – reaction mixture without DNA template, 1 – Bsm polymerase 16 Units, 2 – Bsm Polymerase 8 Units, 3 – Bsm Polymerase 4 Units, 4 – Bsm Polymerase 2 Units.
    Bsm Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 56 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsm dna polymerase/product/Thermo Fisher
    Average 93 stars, based on 56 article reviews
    Price from $9.99 to $1999.99
    bsm dna polymerase - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    99
    New England Biolabs bst dna polymerase large fragment
    Optimisation of <t>Bsm</t> polymerase concentration. ( A ) Green color of LAMP positive samples, orange color of negative control, ( B ) The green fluorescence after addition of SYBR Green to each reaction mixture under UV light, ( C ) Electrophoresis of LAMP products in 2% agarose gel stained with GelRed™ <t>DNA</t> staining solution. Neg – negative control – reaction mixture without DNA template, 1 – Bsm polymerase 16 Units, 2 – Bsm Polymerase 8 Units, 3 – Bsm Polymerase 4 Units, 4 – Bsm Polymerase 2 Units.
    Bst Dna Polymerase Large Fragment, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 330 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bst dna polymerase large fragment/product/New England Biolabs
    Average 99 stars, based on 330 article reviews
    Price from $9.99 to $1999.99
    bst dna polymerase large fragment - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    93
    Millipore deoxynucleoside triphosphate
    Optimisation of <t>Bsm</t> polymerase concentration. ( A ) Green color of LAMP positive samples, orange color of negative control, ( B ) The green fluorescence after addition of SYBR Green to each reaction mixture under UV light, ( C ) Electrophoresis of LAMP products in 2% agarose gel stained with GelRed™ <t>DNA</t> staining solution. Neg – negative control – reaction mixture without DNA template, 1 – Bsm polymerase 16 Units, 2 – Bsm Polymerase 8 Units, 3 – Bsm Polymerase 4 Units, 4 – Bsm Polymerase 2 Units.
    Deoxynucleoside Triphosphate, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 506 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphate/product/Millipore
    Average 93 stars, based on 506 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphate - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    Image Search Results


    Differential modulation of IGF-induced Akt phosphorylation in response to 1, 25-D 3 and IGFBP-3 treatment in MCF-7 and MCF-7/VD R cells. (a) MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 30 nM IGF-I, alone or in combination, in serum-free medium. Cells were also treated with 100 nM IGFBP-3 alone or in combination with 30 nM IGF-I in serum-free medium. After 5 days of treatment, whole cell extracts were prepared and analysed by immunoblotting for total-Akt (T-Akt) and phospho-Akt (P-Akt). (b) Densitometric analysis of immunoblots was performed using GS-800 Calibrated Densitometer (Bio-Rad UK). Data shown are representative of three identical experiments. Means of 3 separated experiments are shown. * P

    Journal: International Journal of Cell Biology

    Article Title: Role of Insulin-Like Growth Factor Binding Protein-3 in 1, 25-Dihydroxyvitamin-D3-Induced Breast Cancer Cell Apoptosis

    doi: 10.1155/2013/960378

    Figure Lengend Snippet: Differential modulation of IGF-induced Akt phosphorylation in response to 1, 25-D 3 and IGFBP-3 treatment in MCF-7 and MCF-7/VD R cells. (a) MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 30 nM IGF-I, alone or in combination, in serum-free medium. Cells were also treated with 100 nM IGFBP-3 alone or in combination with 30 nM IGF-I in serum-free medium. After 5 days of treatment, whole cell extracts were prepared and analysed by immunoblotting for total-Akt (T-Akt) and phospho-Akt (P-Akt). (b) Densitometric analysis of immunoblots was performed using GS-800 Calibrated Densitometer (Bio-Rad UK). Data shown are representative of three identical experiments. Means of 3 separated experiments are shown. * P

    Article Snippet: RT-PCR Analysis of IGFBP-3 mRNA The primers used to amplify IGFBP-3 and 28S rRNA were IGFBP-3 forward (GAAGGGCGACACTGCTTTTTC), IGFBP-3 reverse (CCAGCTCCAGGAAATGCTAG), 28S forward (GTTCACCCACTAATAGGGAAC), and 28S reverse (GGATTCTGACTTAGAGGCGTT).

    Techniques: Western Blot

    Proposed interaction between 1, 25-D 3 and IGFBP-3 in MCF-7 and MCF-7/VD R cells. In parental cells stimulation by 1, 25-D 3 of IGFBP-3 secretion attenuates IGF-1-induced activation of Akt, leading to apoptosis. In addition, 1, 25-D 3 may initiate caspase-independent pathways contributing to cell death in parental cells. In resistant cells, failure of IGFBP-3 secretion is associated with activation of the IGF-I/Akt pathway, leading to cell survival.

    Journal: International Journal of Cell Biology

    Article Title: Role of Insulin-Like Growth Factor Binding Protein-3 in 1, 25-Dihydroxyvitamin-D3-Induced Breast Cancer Cell Apoptosis

    doi: 10.1155/2013/960378

    Figure Lengend Snippet: Proposed interaction between 1, 25-D 3 and IGFBP-3 in MCF-7 and MCF-7/VD R cells. In parental cells stimulation by 1, 25-D 3 of IGFBP-3 secretion attenuates IGF-1-induced activation of Akt, leading to apoptosis. In addition, 1, 25-D 3 may initiate caspase-independent pathways contributing to cell death in parental cells. In resistant cells, failure of IGFBP-3 secretion is associated with activation of the IGF-I/Akt pathway, leading to cell survival.

    Article Snippet: RT-PCR Analysis of IGFBP-3 mRNA The primers used to amplify IGFBP-3 and 28S rRNA were IGFBP-3 forward (GAAGGGCGACACTGCTTTTTC), IGFBP-3 reverse (CCAGCTCCAGGAAATGCTAG), 28S forward (GTTCACCCACTAATAGGGAAC), and 28S reverse (GGATTCTGACTTAGAGGCGTT).

    Techniques: Activation Assay

    Effect of 1, 25-D 3 on MCF-7 and MCF-7/VD R cell viability and IGFBP-3 expression. (a) MCF-7 and MCF-7/VD R cells were treated with increasing concentrations of 1, 25-D 3 (up to 100 nM) or 0.1% ethanol vehicle as a control for 6 days. Cell viability was determined by neutral red assay. Means of 3 separate experiments are shown. * P

    Journal: International Journal of Cell Biology

    Article Title: Role of Insulin-Like Growth Factor Binding Protein-3 in 1, 25-Dihydroxyvitamin-D3-Induced Breast Cancer Cell Apoptosis

    doi: 10.1155/2013/960378

    Figure Lengend Snippet: Effect of 1, 25-D 3 on MCF-7 and MCF-7/VD R cell viability and IGFBP-3 expression. (a) MCF-7 and MCF-7/VD R cells were treated with increasing concentrations of 1, 25-D 3 (up to 100 nM) or 0.1% ethanol vehicle as a control for 6 days. Cell viability was determined by neutral red assay. Means of 3 separate experiments are shown. * P

    Article Snippet: RT-PCR Analysis of IGFBP-3 mRNA The primers used to amplify IGFBP-3 and 28S rRNA were IGFBP-3 forward (GAAGGGCGACACTGCTTTTTC), IGFBP-3 reverse (CCAGCTCCAGGAAATGCTAG), 28S forward (GTTCACCCACTAATAGGGAAC), and 28S reverse (GGATTCTGACTTAGAGGCGTT).

    Techniques: Expressing, Neutral Red Assay

    Caspase activation in response to 1, 25-D 3 and IGFBP-3. MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 0.1% ethanol as vehicle control for 5 days (left hand panel) or 100 nM IGFBP-3 for 3 days. Control cells received an equal volume of PBS diluent (right-hand panel). Whole cell extracts were prepared and analysed by immunoblotting using specific antibodies of interest and β -actin was used as a loading control. Data shown are representative of three identical experiments.

    Journal: International Journal of Cell Biology

    Article Title: Role of Insulin-Like Growth Factor Binding Protein-3 in 1, 25-Dihydroxyvitamin-D3-Induced Breast Cancer Cell Apoptosis

    doi: 10.1155/2013/960378

    Figure Lengend Snippet: Caspase activation in response to 1, 25-D 3 and IGFBP-3. MCF-7 and MCF-7/VD R cells were treated with 100 nM 1, 25-D 3 or 0.1% ethanol as vehicle control for 5 days (left hand panel) or 100 nM IGFBP-3 for 3 days. Control cells received an equal volume of PBS diluent (right-hand panel). Whole cell extracts were prepared and analysed by immunoblotting using specific antibodies of interest and β -actin was used as a loading control. Data shown are representative of three identical experiments.

    Article Snippet: RT-PCR Analysis of IGFBP-3 mRNA The primers used to amplify IGFBP-3 and 28S rRNA were IGFBP-3 forward (GAAGGGCGACACTGCTTTTTC), IGFBP-3 reverse (CCAGCTCCAGGAAATGCTAG), 28S forward (GTTCACCCACTAATAGGGAAC), and 28S reverse (GGATTCTGACTTAGAGGCGTT).

    Techniques: Activation Assay

    MALAT1 -mascRNA system is involved in cardiovascular innate immunity. ( A ) MALAT1 levels were highly abundant in all tissues including heart (blue box) (mean ± SEM, n = 2) and in PBMCs from two healthy volunteers (red box), all of which are much higher than NEAT1 . ( B ) The small tRNA-like MALAT1- derived mascRNA abundance was only high in PBMCs (red box), but low in normal heart (blue box), as determined by northern blot analysis. The upper and autoradiographs show 20-h and 48-h exposures, respectively. ( C ) mascRNA was present in circulating immune cell fractions at different steady state levels, as analyzed by northern blot analysis of FACS-sorted human PBMCs (mean ± SEM; n = 2 sorts of buffy coats). U6 designates control RNA. ( D ) PMA used for differentiation of THP-1 cells into macrophages resulted in upregulation of mascRNA levels (lane 7 vs. 8, blue box; lanes 1A–3B with PMA vs. 4A–6B without PMA), which was strongly reduced by anti-mascRNA ASO treatment via heteroduplex formation between the ASO and mascRNA (lanes 2A, 2B vs. 1A, 1B, red box). The bar graphs show that mascRNA depletion of PMA-treated THP-1 cells by ASO treatment induced multiple immune-associated genes including FAS/FASLG, TNF/IL6, MMP2, chemokine CCL20, chemokine receptors CCR5/CCR7, but not affected MALAT1 transcript, as measured by qPCR. Data were normalized to scrambled ASO treatment and represent mean ± SEM of 2 −ΔΔCt values referenced to HPRT1. Student's t -test unpaired; n = 5, except n = 4 for CCR5 and CCR7. ns, no significance. At the functional level, coincubation with anti-mascRNA-treated THP-1 cells for 24 h resulted in significantly higher caspase 3/7 activity in Jurkat cells, compared with coincubation with control-ASO-treated THP-1 cells ( P = 0.001; n = 2). ( E ). Elevation of mascRNA levels in adenovector-transduced rat cells (black bars) was shown up to 72 h after infection with CVB3, compared with empty vector-transduced cells (gray bars) (central bar graph). Rapid and massive increase of CVB3 genome equivalents was observed in rat cardiomyocytes transduced with empty vector, whereas in sharp contrast no virus replication was detectable in mascRNA-transduced cells (upper bar graph) (mean ± SEM; n = 3; #). Recombinant mascRNA inhibited CVB3 replication not only in rat cardiomyocytes, but also in murine cardiomyocytes (lower graph) where virus replication is far more rapid than in rat cells (pfu = plaque forming units) (mean ± SEM; n = 4; ** P

    Journal: Journal of Molecular Cell Biology

    Article Title: Long noncoding RNA MALAT1-derived mascRNA is involved in cardiovascular innate immunity

    doi: 10.1093/jmcb/mjw003

    Figure Lengend Snippet: MALAT1 -mascRNA system is involved in cardiovascular innate immunity. ( A ) MALAT1 levels were highly abundant in all tissues including heart (blue box) (mean ± SEM, n = 2) and in PBMCs from two healthy volunteers (red box), all of which are much higher than NEAT1 . ( B ) The small tRNA-like MALAT1- derived mascRNA abundance was only high in PBMCs (red box), but low in normal heart (blue box), as determined by northern blot analysis. The upper and autoradiographs show 20-h and 48-h exposures, respectively. ( C ) mascRNA was present in circulating immune cell fractions at different steady state levels, as analyzed by northern blot analysis of FACS-sorted human PBMCs (mean ± SEM; n = 2 sorts of buffy coats). U6 designates control RNA. ( D ) PMA used for differentiation of THP-1 cells into macrophages resulted in upregulation of mascRNA levels (lane 7 vs. 8, blue box; lanes 1A–3B with PMA vs. 4A–6B without PMA), which was strongly reduced by anti-mascRNA ASO treatment via heteroduplex formation between the ASO and mascRNA (lanes 2A, 2B vs. 1A, 1B, red box). The bar graphs show that mascRNA depletion of PMA-treated THP-1 cells by ASO treatment induced multiple immune-associated genes including FAS/FASLG, TNF/IL6, MMP2, chemokine CCL20, chemokine receptors CCR5/CCR7, but not affected MALAT1 transcript, as measured by qPCR. Data were normalized to scrambled ASO treatment and represent mean ± SEM of 2 −ΔΔCt values referenced to HPRT1. Student's t -test unpaired; n = 5, except n = 4 for CCR5 and CCR7. ns, no significance. At the functional level, coincubation with anti-mascRNA-treated THP-1 cells for 24 h resulted in significantly higher caspase 3/7 activity in Jurkat cells, compared with coincubation with control-ASO-treated THP-1 cells ( P = 0.001; n = 2). ( E ). Elevation of mascRNA levels in adenovector-transduced rat cells (black bars) was shown up to 72 h after infection with CVB3, compared with empty vector-transduced cells (gray bars) (central bar graph). Rapid and massive increase of CVB3 genome equivalents was observed in rat cardiomyocytes transduced with empty vector, whereas in sharp contrast no virus replication was detectable in mascRNA-transduced cells (upper bar graph) (mean ± SEM; n = 3; #). Recombinant mascRNA inhibited CVB3 replication not only in rat cardiomyocytes, but also in murine cardiomyocytes (lower graph) where virus replication is far more rapid than in rat cells (pfu = plaque forming units) (mean ± SEM; n = 4; ** P

    Article Snippet: First, we compared myocardial transcriptomes in two groups of CVB3 cardiomyopathy patients, one of which eliminated CVB3 spontaneously (Cox-ELIM), whereas the other showed CVB3 persistence and clinical deterioration (Cox-PERS).

    Techniques: Derivative Assay, Northern Blot, FACS, Allele-specific Oligonucleotide, Real-time Polymerase Chain Reaction, Functional Assay, Activity Assay, Infection, Plasmid Preparation, Transduction, Recombinant

    Optimisation of Bsm polymerase concentration. ( A ) Green color of LAMP positive samples, orange color of negative control, ( B ) The green fluorescence after addition of SYBR Green to each reaction mixture under UV light, ( C ) Electrophoresis of LAMP products in 2% agarose gel stained with GelRed™ DNA staining solution. Neg – negative control – reaction mixture without DNA template, 1 – Bsm polymerase 16 Units, 2 – Bsm Polymerase 8 Units, 3 – Bsm Polymerase 4 Units, 4 – Bsm Polymerase 2 Units.

    Journal: Virology Journal

    Article Title: Loop-mediated isothermal amplification for the detection of goose circovirus

    doi: 10.1186/1743-422X-9-110

    Figure Lengend Snippet: Optimisation of Bsm polymerase concentration. ( A ) Green color of LAMP positive samples, orange color of negative control, ( B ) The green fluorescence after addition of SYBR Green to each reaction mixture under UV light, ( C ) Electrophoresis of LAMP products in 2% agarose gel stained with GelRed™ DNA staining solution. Neg – negative control – reaction mixture without DNA template, 1 – Bsm polymerase 16 Units, 2 – Bsm Polymerase 8 Units, 3 – Bsm Polymerase 4 Units, 4 – Bsm Polymerase 2 Units.

    Article Snippet: The LAMP reaction was carried out on in 25 μL containing: 1× Bsm Pol buffer (20 mM Tris–HCl (pH 8.8 at 25°C), 10 mM KCl, 10 mM (NH4 )2 SO4 , 5 mM MgSO4 , 0.1% Tween 20) (Thermo Scientific-Fermentas, Vilnus, Lithuania), 0.8 M betaine (Sigma-Aldrich, St Louis, Missouri, United States), 1.2 mM of each dNTPs (EurX), 0.4-1.2 mM each of inner primers FIP and BIP, 0.1-0.4 mM each of outer primers F3 and B3, 0.2-0.6 mM of each LF and LR primers, 2 - 8U Bsm DNA polymerase (Thermo Scientific-Fermentas, Vilnus, Lithuania), 1 μL of DNA template (~25 ng) and deionised water.

    Techniques: Concentration Assay, Negative Control, Fluorescence, SYBR Green Assay, Electrophoresis, Agarose Gel Electrophoresis, Staining