atr shrna Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher 20 nm silencer select sirna against atr
    Polyamides induce phosphorylation of MCM2 and FANCD2 monoubiquitination. ( A ) MCM2 S108 phosphorylation and FANCD2 monoubiquitination levels were measured in DU145 cells treated with 4-mM HU for 2 h, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 over a time course of 18, 36 and 72 h. Monoubiquitination was estimated by normalizing the band intensity of the large molecular weight monoubiquitinated FANCD2 band (FANCD2-L) to the low molecular weight non-ubiquitinated FANCD2 band (FANCD2-S). ( B ) MCM2 S108 phosphorylation and FANCD2-Ub levels were measured in cells treated with 4-mM HU for 2 h, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 for 36 h with or without the addition of 2-mM caffeine. ( C ) MCM2 S108 phosphorylation and FANCD2-Ub levels were measured in cells treated with negative control or <t>ATR-targeting</t> <t>siRNA</t> for 48 h prior to the addition of 4-mM HU for 2 h, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 for 36 h.
    20 Nm Silencer Select Sirna Against Atr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/20 nm silencer select sirna against atr/product/Thermo Fisher
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    20 nm silencer select sirna against atr - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore atr sirna
    <t>ATR,</t> but not Chk1 or Nbs1, is required for the stabilization of cyclin E in the presence of MMC. A , HeLa cells transfected with ATR, Chk1, Nbs1, or control siRNAs were synchronized and released into regular medium with MMC or without drug. Cyclin E levels were examined at the indicated times after release by immunoblot analysis. Glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) is a loading control. B , ATR prevents the ubiquitylation of cyclin E in response to MMC. Synchronized HeLa cells depleted of ATR by <t>siRNA</t> ( left panel ) were transfected with HA-ubiquitin and subsequently subjected to IP analysis by immunoblotting ( center panel ). Right panel shows the loading control.
    Atr Sirna, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atr sirna/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    atr sirna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    88
    Thermo Fisher atr shrna
    A. <t>ATR</t> is responsible for CHEK1 phosphorylation at serine345 following replication stress. A1. MCF7 cells were subjected to 10 nM <t>siRNA</t> for 48 h before being treated with 1 μM gemcitabine (Gem) or 10 mM hydroxyurea
    Atr Shrna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atr shrna/product/Thermo Fisher
    Average 88 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    atr shrna - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc atr sirna
    <t>ATR-CHEK1-TP53</t> signaling pathway activation was required for mediating autophagy-dependent VEGFA production in Beas-2B cells under PM2.5 exposure. (A, C and E) Beas-2B cells were transfected with TP53 <t>siRNA</t> or DRAM1 siRNA (A), ATR siRNA (C) or CHEK1 siRNA (E) and their respective control siRNAs; then, cells were treated with PM2.5 (100 μg/mL) 36 h after transfection. The activation status of SRC and STAT3 and the expression level of VEGFA were determined 24 h after PM2.5 exposure. (B, D and F) Beas-2B cells stably transfected with a VEGFA promoter-driven luciferase reporter were transfected and treated as described in (A, C and E), respectively. Then, the induction of VEGFA promoter-dependent luciferase activity was determined 12 h after PM2.5 exposure (**, P
    Atr Sirna, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atr sirna/product/Cell Signaling Technology Inc
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    atr sirna - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    Horizon Discovery atr sirna
    H3K56 deacetylation and acetylation is not regulated by <t>ATR</t> checkpoint kinase. ( A ) Seckel cells are proficient in the deacetylation and restoration of H3K56 acetylation in response to UV irradiation. Seckel cells were exposed to 10 J m −2 UV radiation and were harvested at the indicated times. Whole cell lysates prepared from the cells were resolved on SDS–PAGE and H3K56 acetylation levels determined by western blotting. ( B ) ATR deficiency does not affect either the deacetylation or restoration of H3K56 acetylation in response to UV irradiation. HeLa cells were transfected with 100 nM ATR <t>siRNA</t> using Lipofectamine tansfection reagent. At 48 h after transfection, cells were irradiated with 10 J m −2 UV and harvested at the indicated times. Whole-cell lysates were prepared, resolved on SDS–PAGE and H3K56Ac levels determined by western blotting with anti-H3K56Ac antibodies.
    Atr Sirna, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 86/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atr sirna/product/Horizon Discovery
    Average 86 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    atr sirna - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    94
    Santa Cruz Biotechnology atr sirna
    ATM and <t>ATR</t> protein levels show a reciprocal relationship. ( A ) Brain sections from 2-mo-old WT, Atm tm1Awb /Atm tm1Awb (Awb), and Atm tm1Bal /Atm tm1Bal (Bal) mice were labeled with ATR (green) or MAP2 (red) antibodies and counterstained with DAPI (blue). (Scale bars: as marked.) ( B ) ATR immunostaining intensity. n = 3 animals for each group. Error bars represent SEM. * P = 0.0232; * P = 0.036, unpaired t test. ( C ) Western blots of Atm KO (Awb) and WT cortical lysates. Actin served as a loading control. n = 3 animals for each group. Error bars represent SEM. *** P = 0.0006, unpaired t test. ( D ) Western blots of HEK293T cells lysates obtained at 48 h after transfection with Atm <t>-shRNA</t> or Atr -shRNA. GAPDH served as a loading control. ( E ) Quantification of the blots shown in D . n = 4–6 independent cultures. Error bars represent SEM. *** P = 0.0007; * P = 0.01; * P = 0.0445; ** P = 0.0032, unpaired t test. ( F ) Western blots of ATM, ATR, VGLUT1, and VGAT of lysates from 21 DIV cortical neurons treated with D-CPP-ene or bicuculline for 24 h. ( G ) Quantification of the blots shown in F . n = 3∼4 independent neuronal cultures. Error bars represent SEM. For ATM, * P = 0.0317, * P = 0.0152; for VGLUT1, * P = 0.03; for ATR, ** P = 0.0046, * P = 0.0213; for VGAT, * P = 0.0293, * P = 0.0479, unpaired t test.
    Atr Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atr sirna/product/Santa Cruz Biotechnology
    Average 94 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    atr sirna - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    86
    MWG-Biotech atr sirna
    Rad51 focus formation in AT cells depends on functional <t>ATR.</t> ( A ) WT and AT cells were pre-treated with 10 mM caffeine for 2 h and pulse-labeled with EdU shortly before IR (1 Gy). Rad51 foci were recorded 2 and 6 h later in EdU-positive cells. Not only the foci number declined upon caffeine treatment but also the size of the remaining foci was reduced (see also Supplementary Figure 5 ). ( B ) Quantification of Rad51 foci in EdU-positive CV-1 cells treated with ATR <t>siRNA</t> ( C ) and scrambled control without ATM inhibition (10 µM KU55933). ( D ) Western blot of Chk1 expressed in WT and AT cells irradiated with 10 Gy. ( E ) WT and AT cells were EdU-labeled, irradiated with 1 Gy and during repair continuously exposed to the Chk1 inhibitor UCN-01 (0.1 µM). Quantification of Rad51 foci 2 and 6 h after IR in EdU-positive cells.
    Atr Sirna, supplied by MWG-Biotech, used in various techniques. Bioz Stars score: 86/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atr sirna/product/MWG-Biotech
    Average 86 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    atr sirna - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    95
    Cell Signaling Technology Inc signalsilence atr sirna ii
    Rad51 focus formation in AT cells depends on functional <t>ATR.</t> ( A ) WT and AT cells were pre-treated with 10 mM caffeine for 2 h and pulse-labeled with EdU shortly before IR (1 Gy). Rad51 foci were recorded 2 and 6 h later in EdU-positive cells. Not only the foci number declined upon caffeine treatment but also the size of the remaining foci was reduced (see also Supplementary Figure 5 ). ( B ) Quantification of Rad51 foci in EdU-positive CV-1 cells treated with ATR <t>siRNA</t> ( C ) and scrambled control without ATM inhibition (10 µM KU55933). ( D ) Western blot of Chk1 expressed in WT and AT cells irradiated with 10 Gy. ( E ) WT and AT cells were EdU-labeled, irradiated with 1 Gy and during repair continuously exposed to the Chk1 inhibitor UCN-01 (0.1 µM). Quantification of Rad51 foci 2 and 6 h after IR in EdU-positive cells.
    Signalsilence Atr Sirna Ii, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/signalsilence atr sirna ii/product/Cell Signaling Technology Inc
    Average 95 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    signalsilence atr sirna ii - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    85
    Horizon Discovery mouse atr
    Rad51 focus formation in AT cells depends on functional <t>ATR.</t> ( A ) WT and AT cells were pre-treated with 10 mM caffeine for 2 h and pulse-labeled with EdU shortly before IR (1 Gy). Rad51 foci were recorded 2 and 6 h later in EdU-positive cells. Not only the foci number declined upon caffeine treatment but also the size of the remaining foci was reduced (see also Supplementary Figure 5 ). ( B ) Quantification of Rad51 foci in EdU-positive CV-1 cells treated with ATR <t>siRNA</t> ( C ) and scrambled control without ATM inhibition (10 µM KU55933). ( D ) Western blot of Chk1 expressed in WT and AT cells irradiated with 10 Gy. ( E ) WT and AT cells were EdU-labeled, irradiated with 1 Gy and during repair continuously exposed to the Chk1 inhibitor UCN-01 (0.1 µM). Quantification of Rad51 foci 2 and 6 h after IR in EdU-positive cells.
    Mouse Atr, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse atr/product/Horizon Discovery
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    mouse atr - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    95
    Santa Cruz Biotechnology atr targeting shrna plasmid
    Rad51 focus formation in AT cells depends on functional <t>ATR.</t> ( A ) WT and AT cells were pre-treated with 10 mM caffeine for 2 h and pulse-labeled with EdU shortly before IR (1 Gy). Rad51 foci were recorded 2 and 6 h later in EdU-positive cells. Not only the foci number declined upon caffeine treatment but also the size of the remaining foci was reduced (see also Supplementary Figure 5 ). ( B ) Quantification of Rad51 foci in EdU-positive CV-1 cells treated with ATR <t>siRNA</t> ( C ) and scrambled control without ATM inhibition (10 µM KU55933). ( D ) Western blot of Chk1 expressed in WT and AT cells irradiated with 10 Gy. ( E ) WT and AT cells were EdU-labeled, irradiated with 1 Gy and during repair continuously exposed to the Chk1 inhibitor UCN-01 (0.1 µM). Quantification of Rad51 foci 2 and 6 h after IR in EdU-positive cells.
    Atr Targeting Shrna Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atr targeting shrna plasmid/product/Santa Cruz Biotechnology
    Average 95 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    atr targeting shrna plasmid - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    91
    Millipore atr shrnas
    Knockdown of <t>ATR</t> diminishes NS1-induced G2-phase arrest in UT7/Epo-S1 cells. (A) Cell cycle analysis. NS1-S1 cells were transduced with shRNA-expressing lentivirus as indicated. After 48 h, cells were treated with Dox at 5 μg/ml (Dox+) or without (Dox-). After 72 h, the cells were collected and co-stained with an anti-BrdU antibody and DAPI. Cell cycle analysis of mCherry-expressing cells is shown. (B) Statistical analyses. The percentage of cells at G1-, S-, and G2-phase after shRNA transduction is depicted in color. The numbers show the percentages of the cells at G2-phase. The percentage of shScram and other <t>shRNAs</t> transduced NS1-expressing cells at G2-phase was statistically analyzed. **P
    Atr Shrnas, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atr shrnas/product/Millipore
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    atr shrnas - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    85
    Horizon Discovery atr specific sirna smartpool
    Knockdown of <t>ATR</t> diminishes NS1-induced G2-phase arrest in UT7/Epo-S1 cells. (A) Cell cycle analysis. NS1-S1 cells were transduced with shRNA-expressing lentivirus as indicated. After 48 h, cells were treated with Dox at 5 μg/ml (Dox+) or without (Dox-). After 72 h, the cells were collected and co-stained with an anti-BrdU antibody and DAPI. Cell cycle analysis of mCherry-expressing cells is shown. (B) Statistical analyses. The percentage of cells at G1-, S-, and G2-phase after shRNA transduction is depicted in color. The numbers show the percentages of the cells at G2-phase. The percentage of shScram and other <t>shRNAs</t> transduced NS1-expressing cells at G2-phase was statistically analyzed. **P
    Atr Specific Sirna Smartpool, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atr specific sirna smartpool/product/Horizon Discovery
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    atr specific sirna smartpool - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    85
    Horizon Discovery smart pool atr sirna
    FA proteins are involved in S-phase checkpoint activation. ( A ) Replicative DNA synthesis was measured as a function of time after exposure to 10 μM 8-MOP+10 kJ/m 2 UVA in WT, GM3657 (□, lymphoblasts), MRC5 (•, fibroblasts) and FA cells from A, C, G and D2 complementation groups. ( B ) Replicative DNA synthesis was measured 3 h after exposure to 10 μM 8-MOP+10 kJ/m 2 UVA in WT, FA cells from C, G and D2 complementation groups, ectopically corrected FA cells or in FA-D2 cells transfected with CHK1 <t>siRNA.</t> ( C ) Inhibition of MRE11 expression by MRE11-siRNA transfection in FA cells. Equal loading of proteins was demonstrated by RAD50 immunoblotting. ( D ) Consequence of MRE11 interference on NBS1 phosphorylation following exposure to photoactivated psoralens. ( E ) Analysis of CHK1 phosphorylation in photoactivated (10 kJ/m 2 UVA) 8-MOP (10 μM) treated FA cells by Western blot with a specific anti-phospho-CHK1 antibody directed against phospho-S345. ( F , G ) Formation and quantitation of <t>ATR</t> foci in response to 10 μM 8-MOP+10 kJ/m 2 UVA treatment as evaluated by immunostaining of cells with an anti-ATR antibody in WT, NBS1 or FANC defective cells.
    Smart Pool Atr Sirna, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/smart pool atr sirna/product/Horizon Discovery
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    smart pool atr sirna - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    99
    Millipore shrna knockdowns shrna targeting atr
    The DNA damage-activated PIKKs family members ATM, <t>ATR</t> and DNA-PK are not required for downregulation of BRCA1. A) Immunoblotting detection of BRCA1 in HeLa cells treated with 10 Gy IR or 200 µM MMS. B) BRCA1 downregulation is not blocked by caffeine. Immunoblotting detection of BRCA1 in HeLa cells pre-treated with 10 mM caffeine for 30 min prior to 200 µM MMS treatment for 6 hrs. C) The downregulation of BRCA1 is not prevented by the ATM inhibitor (KU-55933). Immunoblotting detection of BRCA1 in HeLa cells pre-treated with 10 µM KU-55933 for 30 min prior to 200 µM MMS treatment for 6 hrs. γH2AX and pChk2 detection were used as controls to confirm inhibition of ATM and/or ATR kinases. D) BRCA1 is downregulated in ATM-deficient human fibroblasts. Cells were treated with 200 µM MMS treatment for 6 hrs and harvested for immunoblotting. E) Depletion of ATR by RNAi does not prevent BRCA1 downregulation by MMS. Left , immunodetection of ATR following <t>shRNA</t> constructs transfection and puromycin selection. Right , ATR-depleted cells were treated with 200 µM MMS and harvested at the indicated times for immunoblotting. F) BRCA1 is downregulated in DNA-PKcs deficient cells. Glioblastoma DNA-PKcs proficient (MO59K) or deficient (MO59J) were treated with 200 µM MMS and harvested at the indicated times for immunoblotting.
    Shrna Knockdowns Shrna Targeting Atr, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrna knockdowns shrna targeting atr/product/Millipore
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    shrna knockdowns shrna targeting atr - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    84
    Santa Cruz Biotechnology mouse atr
    <t>ATR</t> promotes the phosphorylation of cyclin D1 during normal S phase. ATR <t>siRNA</t> (A) or the control siRNA (B) was microinjected into sparse cultures of NIH 3T3 cells 48 h prior to fixation, staining, and analysis. The phosphorylated to total cyclin D1 ratio
    Mouse Atr, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 84/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse atr/product/Santa Cruz Biotechnology
    Average 84 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    mouse atr - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    92
    OriGene gfp atr shrna
    ATM and <t>ATR</t> protein levels show a reciprocal relationship. ( A ) Brain sections from 2-mo-old WT, Atm tm1Awb /Atm tm1Awb (Awb), and Atm tm1Bal /Atm tm1Bal (Bal) mice were labeled with ATR (green) or MAP2 (red) antibodies and counterstained with DAPI (blue). (Scale bars: as marked.) ( B ) ATR immunostaining intensity. n = 3 animals for each group. Error bars represent SEM. * P = 0.0232; * P = 0.036, unpaired t test. ( C ) Western blots of Atm KO (Awb) and WT cortical lysates. Actin served as a loading control. n = 3 animals for each group. Error bars represent SEM. *** P = 0.0006, unpaired t test. ( D ) Western blots of HEK293T cells lysates obtained at 48 h after transfection with Atm <t>-shRNA</t> or Atr -shRNA. GAPDH served as a loading control. ( E ) Quantification of the blots shown in D . n = 4–6 independent cultures. Error bars represent SEM. *** P = 0.0007; * P = 0.01; * P = 0.0445; ** P = 0.0032, unpaired t test. ( F ) Western blots of ATM, ATR, VGLUT1, and VGAT of lysates from 21 DIV cortical neurons treated with D-CPP-ene or bicuculline for 24 h. ( G ) Quantification of the blots shown in F . n = 3∼4 independent neuronal cultures. Error bars represent SEM. For ATM, * P = 0.0317, * P = 0.0152; for VGLUT1, * P = 0.03; for ATR, ** P = 0.0046, * P = 0.0213; for VGAT, * P = 0.0293, * P = 0.0479, unpaired t test.
    Gfp Atr Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gfp atr shrna/product/OriGene
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gfp atr shrna - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    88
    Horizon Discovery atr sirna ccuccgugauguugcuuga
    ATM and <t>ATR</t> protein levels show a reciprocal relationship. ( A ) Brain sections from 2-mo-old WT, Atm tm1Awb /Atm tm1Awb (Awb), and Atm tm1Bal /Atm tm1Bal (Bal) mice were labeled with ATR (green) or MAP2 (red) antibodies and counterstained with DAPI (blue). (Scale bars: as marked.) ( B ) ATR immunostaining intensity. n = 3 animals for each group. Error bars represent SEM. * P = 0.0232; * P = 0.036, unpaired t test. ( C ) Western blots of Atm KO (Awb) and WT cortical lysates. Actin served as a loading control. n = 3 animals for each group. Error bars represent SEM. *** P = 0.0006, unpaired t test. ( D ) Western blots of HEK293T cells lysates obtained at 48 h after transfection with Atm <t>-shRNA</t> or Atr -shRNA. GAPDH served as a loading control. ( E ) Quantification of the blots shown in D . n = 4–6 independent cultures. Error bars represent SEM. *** P = 0.0007; * P = 0.01; * P = 0.0445; ** P = 0.0032, unpaired t test. ( F ) Western blots of ATM, ATR, VGLUT1, and VGAT of lysates from 21 DIV cortical neurons treated with D-CPP-ene or bicuculline for 24 h. ( G ) Quantification of the blots shown in F . n = 3∼4 independent neuronal cultures. Error bars represent SEM. For ATM, * P = 0.0317, * P = 0.0152; for VGLUT1, * P = 0.03; for ATR, ** P = 0.0046, * P = 0.0213; for VGAT, * P = 0.0293, * P = 0.0479, unpaired t test.
    Atr Sirna Ccuccgugauguugcuuga, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 88/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atr sirna ccuccgugauguugcuuga/product/Horizon Discovery
    Average 88 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    atr sirna ccuccgugauguugcuuga - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    86
    Horizon Discovery smart pool sirna against atr
    ATM and <t>ATR</t> protein levels show a reciprocal relationship. ( A ) Brain sections from 2-mo-old WT, Atm tm1Awb /Atm tm1Awb (Awb), and Atm tm1Bal /Atm tm1Bal (Bal) mice were labeled with ATR (green) or MAP2 (red) antibodies and counterstained with DAPI (blue). (Scale bars: as marked.) ( B ) ATR immunostaining intensity. n = 3 animals for each group. Error bars represent SEM. * P = 0.0232; * P = 0.036, unpaired t test. ( C ) Western blots of Atm KO (Awb) and WT cortical lysates. Actin served as a loading control. n = 3 animals for each group. Error bars represent SEM. *** P = 0.0006, unpaired t test. ( D ) Western blots of HEK293T cells lysates obtained at 48 h after transfection with Atm <t>-shRNA</t> or Atr -shRNA. GAPDH served as a loading control. ( E ) Quantification of the blots shown in D . n = 4–6 independent cultures. Error bars represent SEM. *** P = 0.0007; * P = 0.01; * P = 0.0445; ** P = 0.0032, unpaired t test. ( F ) Western blots of ATM, ATR, VGLUT1, and VGAT of lysates from 21 DIV cortical neurons treated with D-CPP-ene or bicuculline for 24 h. ( G ) Quantification of the blots shown in F . n = 3∼4 independent neuronal cultures. Error bars represent SEM. For ATM, * P = 0.0317, * P = 0.0152; for VGLUT1, * P = 0.03; for ATR, ** P = 0.0046, * P = 0.0213; for VGAT, * P = 0.0293, * P = 0.0479, unpaired t test.
    Smart Pool Sirna Against Atr, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 86/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/smart pool sirna against atr/product/Horizon Discovery
    Average 86 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    smart pool sirna against atr - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    94
    GE Healthcare tripz inducible lentiviral human atr shrna
    ATM and <t>ATR</t> protein levels show a reciprocal relationship. ( A ) Brain sections from 2-mo-old WT, Atm tm1Awb /Atm tm1Awb (Awb), and Atm tm1Bal /Atm tm1Bal (Bal) mice were labeled with ATR (green) or MAP2 (red) antibodies and counterstained with DAPI (blue). (Scale bars: as marked.) ( B ) ATR immunostaining intensity. n = 3 animals for each group. Error bars represent SEM. * P = 0.0232; * P = 0.036, unpaired t test. ( C ) Western blots of Atm KO (Awb) and WT cortical lysates. Actin served as a loading control. n = 3 animals for each group. Error bars represent SEM. *** P = 0.0006, unpaired t test. ( D ) Western blots of HEK293T cells lysates obtained at 48 h after transfection with Atm <t>-shRNA</t> or Atr -shRNA. GAPDH served as a loading control. ( E ) Quantification of the blots shown in D . n = 4–6 independent cultures. Error bars represent SEM. *** P = 0.0007; * P = 0.01; * P = 0.0445; ** P = 0.0032, unpaired t test. ( F ) Western blots of ATM, ATR, VGLUT1, and VGAT of lysates from 21 DIV cortical neurons treated with D-CPP-ene or bicuculline for 24 h. ( G ) Quantification of the blots shown in F . n = 3∼4 independent neuronal cultures. Error bars represent SEM. For ATM, * P = 0.0317, * P = 0.0152; for VGLUT1, * P = 0.03; for ATR, ** P = 0.0046, * P = 0.0213; for VGAT, * P = 0.0293, * P = 0.0479, unpaired t test.
    Tripz Inducible Lentiviral Human Atr Shrna, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 94/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tripz inducible lentiviral human atr shrna/product/GE Healthcare
    Average 94 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    tripz inducible lentiviral human atr shrna - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    88
    Horizon Discovery atr positive control
    A whole genome siRNA screen for replication stress response genes. (A) Overview of the screening strategy. (B) U2OS cells were added to 384-well plates containing siRNA and Dharmafect <t>transfection</t> reagent. Seventy-two hours later, BrdU was incorporated for 30 minutes, then removed and cells were treated for 24 hours with 2mM HU. HU was removed and cells were labelled with 10µM EdU for 4 hours before fixing and performing immunofluorescence and automated imaging for BrdU, γH2AX, EdU, and DAPI. (C) Representative images of NT (non-targeting) and <t>ATR</t> siRNA controls showing BrdU and EdU incorporation and γH2AX intensity levels. (D) The mean values of NT and ATR control siRNAs from all plates for each replicate are depicted. Error bars represent standard error of the mean (SEM).
    Atr Positive Control, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atr positive control/product/Horizon Discovery
    Average 88 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    atr positive control - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    86
    Millipore mouse atr sirnas
    siRNA-mediated knockdown of Atr1 and Atr2 in mouse VSMCs. <t>Atr</t> expression in cells transfected with control ( CTL ) or atr -specific <t>siRNAs</t> is shown; + denotes equivalent siRNA to achieve final concentration of 0.2 μmol/liter. A , Western ( top
    Mouse Atr Sirnas, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse atr sirnas/product/Millipore
    Average 86 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    mouse atr sirnas - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    86
    Horizon Discovery human atr
    siRNA-mediated knockdown of Atr1 and Atr2 in mouse VSMCs. <t>Atr</t> expression in cells transfected with control ( CTL ) or atr -specific <t>siRNAs</t> is shown; + denotes equivalent siRNA to achieve final concentration of 0.2 μmol/liter. A , Western ( top
    Human Atr, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 86/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human atr/product/Horizon Discovery
    Average 86 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    human atr - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    Polyamides induce phosphorylation of MCM2 and FANCD2 monoubiquitination. ( A ) MCM2 S108 phosphorylation and FANCD2 monoubiquitination levels were measured in DU145 cells treated with 4-mM HU for 2 h, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 over a time course of 18, 36 and 72 h. Monoubiquitination was estimated by normalizing the band intensity of the large molecular weight monoubiquitinated FANCD2 band (FANCD2-L) to the low molecular weight non-ubiquitinated FANCD2 band (FANCD2-S). ( B ) MCM2 S108 phosphorylation and FANCD2-Ub levels were measured in cells treated with 4-mM HU for 2 h, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 for 36 h with or without the addition of 2-mM caffeine. ( C ) MCM2 S108 phosphorylation and FANCD2-Ub levels were measured in cells treated with negative control or ATR-targeting siRNA for 48 h prior to the addition of 4-mM HU for 2 h, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 for 36 h.

    Journal: Nucleic Acids Research

    Article Title: Replication stress by Py–Im polyamides induces a non-canonical ATR-dependent checkpoint response

    doi: 10.1093/nar/gku866

    Figure Lengend Snippet: Polyamides induce phosphorylation of MCM2 and FANCD2 monoubiquitination. ( A ) MCM2 S108 phosphorylation and FANCD2 monoubiquitination levels were measured in DU145 cells treated with 4-mM HU for 2 h, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 over a time course of 18, 36 and 72 h. Monoubiquitination was estimated by normalizing the band intensity of the large molecular weight monoubiquitinated FANCD2 band (FANCD2-L) to the low molecular weight non-ubiquitinated FANCD2 band (FANCD2-S). ( B ) MCM2 S108 phosphorylation and FANCD2-Ub levels were measured in cells treated with 4-mM HU for 2 h, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 for 36 h with or without the addition of 2-mM caffeine. ( C ) MCM2 S108 phosphorylation and FANCD2-Ub levels were measured in cells treated with negative control or ATR-targeting siRNA for 48 h prior to the addition of 4-mM HU for 2 h, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 for 36 h.

    Article Snippet: Knockdown of ATR by siRNA ATR was knocked down for cell cycle analysis and immunoblot experiments using 20-nM Silencer Select siRNA against ATR (Ambion, s536) and RNAiMAX lipofectamine (Life Technologies) according to the manufacturer's protocol.

    Techniques: Molecular Weight, Negative Control

    Polyamides induce ATR activation without extensive ssDNA formation. ( A ) Immunoblot of ATRpT1989 and ATR following immunoprecipitation (IP) of ATR in DU145 whole cell lysates treated with 4-mM hydroxyurea (HU) for 2 h, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 in the presence or absence of 10-μM NU6027 (NU, ATR inhibitor) for 36 h. ( B ) Immunoblots of ATMpS1981 and ATM after treatment with 30-μM etoposide (Etop) for 30 min, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 in the presence or absence of 10-μM KU55933 (KU, ATM inhibitor) for 36 h. ( C ) Representative images of ssDNA formation via CldU immunofluorescence under non-denaturing conditions are shown for cells after treatment with 4-mM HU for 2 h, DMSO, 30-μM polyamide 1 or 3-μM polyamide 2 for 12 h, and 10-μM polyamide 1 or 1-μM polyamide 2 for 36 h. ( D ) Bar graphs of the mean and standard deviation of percent CldU positive cells ( > 10 foci/cell). One hundred and fifty cells over three replicates were counted for each condition. ( E ) Immunoblots of ATR and checkpoint-related factors loaded onto chromatin upon treatment with 10-mM HU for 2 h, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 for 36 h. ( F ) DNA histograms of propidium iodide (PI) stained DU145 cells after treatment with negative control or ATR-targeting siRNA for 48 h followed by treatment with DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 for 36 h. The percentage of cells in S-phase is included at the top right of each graph.

    Journal: Nucleic Acids Research

    Article Title: Replication stress by Py–Im polyamides induces a non-canonical ATR-dependent checkpoint response

    doi: 10.1093/nar/gku866

    Figure Lengend Snippet: Polyamides induce ATR activation without extensive ssDNA formation. ( A ) Immunoblot of ATRpT1989 and ATR following immunoprecipitation (IP) of ATR in DU145 whole cell lysates treated with 4-mM hydroxyurea (HU) for 2 h, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 in the presence or absence of 10-μM NU6027 (NU, ATR inhibitor) for 36 h. ( B ) Immunoblots of ATMpS1981 and ATM after treatment with 30-μM etoposide (Etop) for 30 min, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 in the presence or absence of 10-μM KU55933 (KU, ATM inhibitor) for 36 h. ( C ) Representative images of ssDNA formation via CldU immunofluorescence under non-denaturing conditions are shown for cells after treatment with 4-mM HU for 2 h, DMSO, 30-μM polyamide 1 or 3-μM polyamide 2 for 12 h, and 10-μM polyamide 1 or 1-μM polyamide 2 for 36 h. ( D ) Bar graphs of the mean and standard deviation of percent CldU positive cells ( > 10 foci/cell). One hundred and fifty cells over three replicates were counted for each condition. ( E ) Immunoblots of ATR and checkpoint-related factors loaded onto chromatin upon treatment with 10-mM HU for 2 h, and DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 for 36 h. ( F ) DNA histograms of propidium iodide (PI) stained DU145 cells after treatment with negative control or ATR-targeting siRNA for 48 h followed by treatment with DMSO, 10-μM polyamide 1 or 1-μM polyamide 2 for 36 h. The percentage of cells in S-phase is included at the top right of each graph.

    Article Snippet: Knockdown of ATR by siRNA ATR was knocked down for cell cycle analysis and immunoblot experiments using 20-nM Silencer Select siRNA against ATR (Ambion, s536) and RNAiMAX lipofectamine (Life Technologies) according to the manufacturer's protocol.

    Techniques: Activation Assay, Immunoprecipitation, Western Blot, Immunofluorescence, Standard Deviation, Staining, Negative Control

    ATR, but not Chk1 or Nbs1, is required for the stabilization of cyclin E in the presence of MMC. A , HeLa cells transfected with ATR, Chk1, Nbs1, or control siRNAs were synchronized and released into regular medium with MMC or without drug. Cyclin E levels were examined at the indicated times after release by immunoblot analysis. Glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) is a loading control. B , ATR prevents the ubiquitylation of cyclin E in response to MMC. Synchronized HeLa cells depleted of ATR by siRNA ( left panel ) were transfected with HA-ubiquitin and subsequently subjected to IP analysis by immunoblotting ( center panel ). Right panel shows the loading control.

    Journal: The Journal of Biological Chemistry

    Article Title: Cyclin E Is Stabilized in Response to Replication Fork Barriers Leading to Prolonged S Phase Arrest *

    doi: 10.1074/jbc.M109.035949

    Figure Lengend Snippet: ATR, but not Chk1 or Nbs1, is required for the stabilization of cyclin E in the presence of MMC. A , HeLa cells transfected with ATR, Chk1, Nbs1, or control siRNAs were synchronized and released into regular medium with MMC or without drug. Cyclin E levels were examined at the indicated times after release by immunoblot analysis. Glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) is a loading control. B , ATR prevents the ubiquitylation of cyclin E in response to MMC. Synchronized HeLa cells depleted of ATR by siRNA ( left panel ) were transfected with HA-ubiquitin and subsequently subjected to IP analysis by immunoblotting ( center panel ). Right panel shows the loading control.

    Article Snippet: An additional ATR siRNA was purchased from Sigma (SASI_HS01_00176271).

    Techniques: Transfection

    A. ATR is responsible for CHEK1 phosphorylation at serine345 following replication stress. A1. MCF7 cells were subjected to 10 nM siRNA for 48 h before being treated with 1 μM gemcitabine (Gem) or 10 mM hydroxyurea

    Journal: Molecular Oncology

    Article Title: Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer), Untangling the ATR‐CHEK1 network for prognostication, prediction and therapeutic target validation in breast cancer

    doi: 10.1016/j.molonc.2014.10.013

    Figure Lengend Snippet: A. ATR is responsible for CHEK1 phosphorylation at serine345 following replication stress. A1. MCF7 cells were subjected to 10 nM siRNA for 48 h before being treated with 1 μM gemcitabine (Gem) or 10 mM hydroxyurea

    Article Snippet: Lentivirus particles containing ATR‐specific shRNA were formed by transfecting HEK293T cells with pCMVΔ8.91 packaging vector, pMD2.G envelope vector and pTRIPZ doxycycline‐inducible lentiviral vector containing ATR shRNA (Thermo, Northumberland, UK).

    Techniques:

    Inhibition of UV irradiation or gemcitabine/cisplatin-induced intracellular relocation of pol η by caffeine or siRNA targeting ATR. Intracellular location of pol η in XP30RO cells transfected with an EGFP-pol η expression vector

    Journal:

    Article Title: Human DNA polymerase ? activity and translocation is regulated by phosphorylation

    doi: 10.1073/pnas.0808589105

    Figure Lengend Snippet: Inhibition of UV irradiation or gemcitabine/cisplatin-induced intracellular relocation of pol η by caffeine or siRNA targeting ATR. Intracellular location of pol η in XP30RO cells transfected with an EGFP-pol η expression vector

    Article Snippet: To down-regulate the expression of ATR, specific siRNA targeting ATR (Stealth siRNA, Invitrogen, Co.) was used.

    Techniques: Inhibition, Irradiation, Transfection, Expressing, Plasmid Preparation

    ATR-CHEK1-TP53 signaling pathway activation was required for mediating autophagy-dependent VEGFA production in Beas-2B cells under PM2.5 exposure. (A, C and E) Beas-2B cells were transfected with TP53 siRNA or DRAM1 siRNA (A), ATR siRNA (C) or CHEK1 siRNA (E) and their respective control siRNAs; then, cells were treated with PM2.5 (100 μg/mL) 36 h after transfection. The activation status of SRC and STAT3 and the expression level of VEGFA were determined 24 h after PM2.5 exposure. (B, D and F) Beas-2B cells stably transfected with a VEGFA promoter-driven luciferase reporter were transfected and treated as described in (A, C and E), respectively. Then, the induction of VEGFA promoter-dependent luciferase activity was determined 12 h after PM2.5 exposure (**, P

    Journal: Autophagy

    Article Title: TP53-dependent autophagy links the ATR-CHEK1 axis activation to proinflammatory VEGFA production in human bronchial epithelial cells exposed to fine particulate matter (PM2.5)

    doi: 10.1080/15548627.2016.1204496

    Figure Lengend Snippet: ATR-CHEK1-TP53 signaling pathway activation was required for mediating autophagy-dependent VEGFA production in Beas-2B cells under PM2.5 exposure. (A, C and E) Beas-2B cells were transfected with TP53 siRNA or DRAM1 siRNA (A), ATR siRNA (C) or CHEK1 siRNA (E) and their respective control siRNAs; then, cells were treated with PM2.5 (100 μg/mL) 36 h after transfection. The activation status of SRC and STAT3 and the expression level of VEGFA were determined 24 h after PM2.5 exposure. (B, D and F) Beas-2B cells stably transfected with a VEGFA promoter-driven luciferase reporter were transfected and treated as described in (A, C and E), respectively. Then, the induction of VEGFA promoter-dependent luciferase activity was determined 12 h after PM2.5 exposure (**, P

    Article Snippet: The siRNAs and regents used were as follows: ATR siRNA (Cell Signaling Technology, 6288), ATM siRNA (Cell Signaling Technology, 6328), ATG5 siRNA (Cell Signaling Technology, 6348), DRAM1 siRNA (Riobo Technology, 1314.14), CHEK1 ( CHK1 ) siRNA (Riobo Technology, 13285.14), BECN1 siRNA (Cell Signaling Technology, 6222), 3-MA (Sigma-Aldrich, M9281), PMB (Sigma-Aldrich, P1004) and BafA1 (LC Laboratories, B1080); Primary antibodies used were as follows: BECN1 (Cell Signaling Technology, 3495), MAP1LC3B (Cell Signaling Technology, 3868), phospho-TP53 (Ser15; Cell Signaling Technology, 9284), TP53 (Cell Signaling Technology, 2524), phospho-SRC (Tyr416; Cell Signaling Technology, 6943), SRC (Cell Signaling Technology, 2109), phospho-STAT3 (Tyr705; Cell Signaling Technology, 9145), STAT3 (Cell Signaling Technology, 9139), phospho-ATM (Ser1981; Cell Signaling Technology, 5883), ATM (Cell Signaling Technology, 2873), phospho-ATR (Ser428; Cell Signaling Technology, 2853), ATR (Cell Signaling Technology, 2790), phospho-CHEK1 (Ser345; Cell Signaling Technology, 2348), CHEK1 (Cell Signaling Technology, 2360), SQSTM1 (Cell Signaling Technology, 8025), ACTB (Cell Signaling Technology, 4970), ATG5 (Cell Signaling Technology, 9980) and DRAM1 (Santa Cruz Biotechnology, 98654).

    Techniques: Activation Assay, Transfection, Expressing, Stable Transfection, Luciferase, Activity Assay

    H3K56 deacetylation and acetylation is not regulated by ATR checkpoint kinase. ( A ) Seckel cells are proficient in the deacetylation and restoration of H3K56 acetylation in response to UV irradiation. Seckel cells were exposed to 10 J m −2 UV radiation and were harvested at the indicated times. Whole cell lysates prepared from the cells were resolved on SDS–PAGE and H3K56 acetylation levels determined by western blotting. ( B ) ATR deficiency does not affect either the deacetylation or restoration of H3K56 acetylation in response to UV irradiation. HeLa cells were transfected with 100 nM ATR siRNA using Lipofectamine tansfection reagent. At 48 h after transfection, cells were irradiated with 10 J m −2 UV and harvested at the indicated times. Whole-cell lysates were prepared, resolved on SDS–PAGE and H3K56Ac levels determined by western blotting with anti-H3K56Ac antibodies.

    Journal: Nucleic Acids Research

    Article Title: ASF1A and ATM regulate H3K56-mediated cell-cycle checkpoint recovery in response to UV irradiation

    doi: 10.1093/nar/gkr523

    Figure Lengend Snippet: H3K56 deacetylation and acetylation is not regulated by ATR checkpoint kinase. ( A ) Seckel cells are proficient in the deacetylation and restoration of H3K56 acetylation in response to UV irradiation. Seckel cells were exposed to 10 J m −2 UV radiation and were harvested at the indicated times. Whole cell lysates prepared from the cells were resolved on SDS–PAGE and H3K56 acetylation levels determined by western blotting. ( B ) ATR deficiency does not affect either the deacetylation or restoration of H3K56 acetylation in response to UV irradiation. HeLa cells were transfected with 100 nM ATR siRNA using Lipofectamine tansfection reagent. At 48 h after transfection, cells were irradiated with 10 J m −2 UV and harvested at the indicated times. Whole-cell lysates were prepared, resolved on SDS–PAGE and H3K56Ac levels determined by western blotting with anti-H3K56Ac antibodies.

    Article Snippet: ATR siRNA was from Dharmacon, Chicago, IL, USA. siRNA transfections were conducted using LipofectamineTM 2000 transfection reagent (Invitrogen) according to the manufacturer’s instructions.

    Techniques: Irradiation, SDS Page, Western Blot, Transfection

    ATR, but not Chk1 or Nbs1, is required for the stabilization of cyclin E in the presence of MMC. A , HeLa cells transfected with ATR, Chk1, Nbs1, or control siRNAs were synchronized and released into regular medium with MMC or without drug. Cyclin E levels were examined at the indicated times after release by immunoblot analysis. Glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) is a loading control. B , ATR prevents the ubiquitylation of cyclin E in response to MMC. Synchronized HeLa cells depleted of ATR by siRNA ( left panel ) were transfected with HA-ubiquitin and subsequently subjected to IP analysis by immunoblotting ( center panel ). Right panel shows the loading control.

    Journal: The Journal of Biological Chemistry

    Article Title: Cyclin E Is Stabilized in Response to Replication Fork Barriers Leading to Prolonged S Phase Arrest *

    doi: 10.1074/jbc.M109.035949

    Figure Lengend Snippet: ATR, but not Chk1 or Nbs1, is required for the stabilization of cyclin E in the presence of MMC. A , HeLa cells transfected with ATR, Chk1, Nbs1, or control siRNAs were synchronized and released into regular medium with MMC or without drug. Cyclin E levels were examined at the indicated times after release by immunoblot analysis. Glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) is a loading control. B , ATR prevents the ubiquitylation of cyclin E in response to MMC. Synchronized HeLa cells depleted of ATR by siRNA ( left panel ) were transfected with HA-ubiquitin and subsequently subjected to IP analysis by immunoblotting ( center panel ). Right panel shows the loading control.

    Article Snippet: Nbs1 (L-009641-00), cyclin E (J-003213-10), Pin1 (J-003291-10), Chk1 (D-003255-06), and ATR ( ) siRNAs were purchased from Dharmacon.

    Techniques: Transfection

    ATM and ATR protein levels show a reciprocal relationship. ( A ) Brain sections from 2-mo-old WT, Atm tm1Awb /Atm tm1Awb (Awb), and Atm tm1Bal /Atm tm1Bal (Bal) mice were labeled with ATR (green) or MAP2 (red) antibodies and counterstained with DAPI (blue). (Scale bars: as marked.) ( B ) ATR immunostaining intensity. n = 3 animals for each group. Error bars represent SEM. * P = 0.0232; * P = 0.036, unpaired t test. ( C ) Western blots of Atm KO (Awb) and WT cortical lysates. Actin served as a loading control. n = 3 animals for each group. Error bars represent SEM. *** P = 0.0006, unpaired t test. ( D ) Western blots of HEK293T cells lysates obtained at 48 h after transfection with Atm -shRNA or Atr -shRNA. GAPDH served as a loading control. ( E ) Quantification of the blots shown in D . n = 4–6 independent cultures. Error bars represent SEM. *** P = 0.0007; * P = 0.01; * P = 0.0445; ** P = 0.0032, unpaired t test. ( F ) Western blots of ATM, ATR, VGLUT1, and VGAT of lysates from 21 DIV cortical neurons treated with D-CPP-ene or bicuculline for 24 h. ( G ) Quantification of the blots shown in F . n = 3∼4 independent neuronal cultures. Error bars represent SEM. For ATM, * P = 0.0317, * P = 0.0152; for VGLUT1, * P = 0.03; for ATR, ** P = 0.0046, * P = 0.0213; for VGAT, * P = 0.0293, * P = 0.0479, unpaired t test.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: ATM and ATR play complementary roles in the behavior of excitatory and inhibitory vesicle populations

    doi: 10.1073/pnas.1716892115

    Figure Lengend Snippet: ATM and ATR protein levels show a reciprocal relationship. ( A ) Brain sections from 2-mo-old WT, Atm tm1Awb /Atm tm1Awb (Awb), and Atm tm1Bal /Atm tm1Bal (Bal) mice were labeled with ATR (green) or MAP2 (red) antibodies and counterstained with DAPI (blue). (Scale bars: as marked.) ( B ) ATR immunostaining intensity. n = 3 animals for each group. Error bars represent SEM. * P = 0.0232; * P = 0.036, unpaired t test. ( C ) Western blots of Atm KO (Awb) and WT cortical lysates. Actin served as a loading control. n = 3 animals for each group. Error bars represent SEM. *** P = 0.0006, unpaired t test. ( D ) Western blots of HEK293T cells lysates obtained at 48 h after transfection with Atm -shRNA or Atr -shRNA. GAPDH served as a loading control. ( E ) Quantification of the blots shown in D . n = 4–6 independent cultures. Error bars represent SEM. *** P = 0.0007; * P = 0.01; * P = 0.0445; ** P = 0.0032, unpaired t test. ( F ) Western blots of ATM, ATR, VGLUT1, and VGAT of lysates from 21 DIV cortical neurons treated with D-CPP-ene or bicuculline for 24 h. ( G ) Quantification of the blots shown in F . n = 3∼4 independent neuronal cultures. Error bars represent SEM. For ATM, * P = 0.0317, * P = 0.0152; for VGLUT1, * P = 0.03; for ATR, ** P = 0.0046, * P = 0.0213; for VGAT, * P = 0.0293, * P = 0.0479, unpaired t test.

    Article Snippet: For siRNA and ORF plasmids, Atr -siRNA (sc-29764) was obtained from Santa Cruz Biotechnology, GFP- Atm -shRNA (TL320267) and GFP- Atr -shRNA (TL519184) were supplied by Origene, mCherry- Atm -shRNA (MSH026597) was obtained from Genecopoeia, GFP-C1-PLCdelta-PH (21179) was provided by Addgene.

    Techniques: Mouse Assay, Labeling, Immunostaining, Western Blot, Transfection, shRNA, Conditioned Place Preference

    Rad51 focus formation in AT cells depends on functional ATR. ( A ) WT and AT cells were pre-treated with 10 mM caffeine for 2 h and pulse-labeled with EdU shortly before IR (1 Gy). Rad51 foci were recorded 2 and 6 h later in EdU-positive cells. Not only the foci number declined upon caffeine treatment but also the size of the remaining foci was reduced (see also Supplementary Figure 5 ). ( B ) Quantification of Rad51 foci in EdU-positive CV-1 cells treated with ATR siRNA ( C ) and scrambled control without ATM inhibition (10 µM KU55933). ( D ) Western blot of Chk1 expressed in WT and AT cells irradiated with 10 Gy. ( E ) WT and AT cells were EdU-labeled, irradiated with 1 Gy and during repair continuously exposed to the Chk1 inhibitor UCN-01 (0.1 µM). Quantification of Rad51 foci 2 and 6 h after IR in EdU-positive cells.

    Journal: Nucleic Acids Research

    Article Title: Radiation-induced double-strand breaks require ATM but not Artemis for homologous recombination during S-phase

    doi: 10.1093/nar/gks604

    Figure Lengend Snippet: Rad51 focus formation in AT cells depends on functional ATR. ( A ) WT and AT cells were pre-treated with 10 mM caffeine for 2 h and pulse-labeled with EdU shortly before IR (1 Gy). Rad51 foci were recorded 2 and 6 h later in EdU-positive cells. Not only the foci number declined upon caffeine treatment but also the size of the remaining foci was reduced (see also Supplementary Figure 5 ). ( B ) Quantification of Rad51 foci in EdU-positive CV-1 cells treated with ATR siRNA ( C ) and scrambled control without ATM inhibition (10 µM KU55933). ( D ) Western blot of Chk1 expressed in WT and AT cells irradiated with 10 Gy. ( E ) WT and AT cells were EdU-labeled, irradiated with 1 Gy and during repair continuously exposed to the Chk1 inhibitor UCN-01 (0.1 µM). Quantification of Rad51 foci 2 and 6 h after IR in EdU-positive cells.

    Article Snippet: ATR siRNA was obtained from MWG Biotech (ATR: AAGCCAAGACAAAUUCUGUGU).

    Techniques: Functional Assay, Labeling, Inhibition, Western Blot, Irradiation

    Knockdown of ATR diminishes NS1-induced G2-phase arrest in UT7/Epo-S1 cells. (A) Cell cycle analysis. NS1-S1 cells were transduced with shRNA-expressing lentivirus as indicated. After 48 h, cells were treated with Dox at 5 μg/ml (Dox+) or without (Dox-). After 72 h, the cells were collected and co-stained with an anti-BrdU antibody and DAPI. Cell cycle analysis of mCherry-expressing cells is shown. (B) Statistical analyses. The percentage of cells at G1-, S-, and G2-phase after shRNA transduction is depicted in color. The numbers show the percentages of the cells at G2-phase. The percentage of shScram and other shRNAs transduced NS1-expressing cells at G2-phase was statistically analyzed. **P

    Journal: PLoS Pathogens

    Article Title: Parvovirus B19 NS1 protein induces cell cycle arrest at G2-phase by activating the ATR-CDC25C-CDK1 pathway

    doi: 10.1371/journal.ppat.1006266

    Figure Lengend Snippet: Knockdown of ATR diminishes NS1-induced G2-phase arrest in UT7/Epo-S1 cells. (A) Cell cycle analysis. NS1-S1 cells were transduced with shRNA-expressing lentivirus as indicated. After 48 h, cells were treated with Dox at 5 μg/ml (Dox+) or without (Dox-). After 72 h, the cells were collected and co-stained with an anti-BrdU antibody and DAPI. Cell cycle analysis of mCherry-expressing cells is shown. (B) Statistical analyses. The percentage of cells at G1-, S-, and G2-phase after shRNA transduction is depicted in color. The numbers show the percentages of the cells at G2-phase. The percentage of shScram and other shRNAs transduced NS1-expressing cells at G2-phase was statistically analyzed. **P

    Article Snippet: Validated MYT1, MAPKAPK2 (MK2), p38MAPK (p38), p21, MARK3, and ATR shRNAs were obtained from Sigma (St. Louis, MO).

    Techniques: Cell Cycle Assay, Transduction, shRNA, Expressing, Staining

    FA proteins are involved in S-phase checkpoint activation. ( A ) Replicative DNA synthesis was measured as a function of time after exposure to 10 μM 8-MOP+10 kJ/m 2 UVA in WT, GM3657 (□, lymphoblasts), MRC5 (•, fibroblasts) and FA cells from A, C, G and D2 complementation groups. ( B ) Replicative DNA synthesis was measured 3 h after exposure to 10 μM 8-MOP+10 kJ/m 2 UVA in WT, FA cells from C, G and D2 complementation groups, ectopically corrected FA cells or in FA-D2 cells transfected with CHK1 siRNA. ( C ) Inhibition of MRE11 expression by MRE11-siRNA transfection in FA cells. Equal loading of proteins was demonstrated by RAD50 immunoblotting. ( D ) Consequence of MRE11 interference on NBS1 phosphorylation following exposure to photoactivated psoralens. ( E ) Analysis of CHK1 phosphorylation in photoactivated (10 kJ/m 2 UVA) 8-MOP (10 μM) treated FA cells by Western blot with a specific anti-phospho-CHK1 antibody directed against phospho-S345. ( F , G ) Formation and quantitation of ATR foci in response to 10 μM 8-MOP+10 kJ/m 2 UVA treatment as evaluated by immunostaining of cells with an anti-ATR antibody in WT, NBS1 or FANC defective cells.

    Journal: The EMBO Journal

    Article Title: The DNA crosslink-induced S-phase checkpoint depends on ATR-CHK1 and ATR-NBS1-FANCD2 pathways

    doi: 10.1038/sj.emboj.7600113

    Figure Lengend Snippet: FA proteins are involved in S-phase checkpoint activation. ( A ) Replicative DNA synthesis was measured as a function of time after exposure to 10 μM 8-MOP+10 kJ/m 2 UVA in WT, GM3657 (□, lymphoblasts), MRC5 (•, fibroblasts) and FA cells from A, C, G and D2 complementation groups. ( B ) Replicative DNA synthesis was measured 3 h after exposure to 10 μM 8-MOP+10 kJ/m 2 UVA in WT, FA cells from C, G and D2 complementation groups, ectopically corrected FA cells or in FA-D2 cells transfected with CHK1 siRNA. ( C ) Inhibition of MRE11 expression by MRE11-siRNA transfection in FA cells. Equal loading of proteins was demonstrated by RAD50 immunoblotting. ( D ) Consequence of MRE11 interference on NBS1 phosphorylation following exposure to photoactivated psoralens. ( E ) Analysis of CHK1 phosphorylation in photoactivated (10 kJ/m 2 UVA) 8-MOP (10 μM) treated FA cells by Western blot with a specific anti-phospho-CHK1 antibody directed against phospho-S345. ( F , G ) Formation and quantitation of ATR foci in response to 10 μM 8-MOP+10 kJ/m 2 UVA treatment as evaluated by immunostaining of cells with an anti-ATR antibody in WT, NBS1 or FANC defective cells.

    Article Snippet: ATR expression was knocked down using the smart pool ATR siRNA from Dharmacon.

    Techniques: Activation Assay, DNA Synthesis, Transfection, Inhibition, Expressing, Western Blot, Quantitation Assay, Immunostaining

    CHK1 and NBS1 are independently involved in ICL-dependent S-phase checkpoint downstream of ATR. ( A ) CHK1-siRNA transfection induces inhibition of CHK1 expression in HeLa cells. Protein extracts from mock-transfected (No siRNA), Ctrl siRNA or CHK1-siRNA-transfected cells were analyzed by Western blot with an anti-CHK1 antibody. ( B ) Replicative DNA synthesis in WT, NBS and/or CHK1-siRNA-inhibited cells 3 h after crosslinking treatment (10 μM 8-MOP+10 kJ/m 2 UVA). ( C ) CHK1 phosphorylation in response to ICLs (10 μM 8-MOP+10 kJ/m 2 UVA, 3 h recovery) or HU (2 mM, 6 h of treatment) exposure in WT, NBS, ATRkd-Dox or ATRkd-expressing cells (ATRkd+Dox) was assessed by Western blot with anti-phospho-CHK1 antibody directed against phospho-S345. ( D ) Analysis of NBS1 phosphorylation in response to ICLs (10 μM 8-MOP+10 kJ/m 2 UVA, 3 h recovery) or HU (2 mM, 6 h of treatment) exposure in WT (ATRkd-Dox) and ATRkd-expressing (ATRkd+Dox) cells (first panel), in CHK1-siRNA-treated cells (middle panel) or in response to ICLs or IR (5 Gy) in control and A-T cells (lower panel), as observed by Western blot with an anti-NBS1 antibody. ( E ) Representative images showing ICL-induced NBS1 assembly in nuclear foci in cells expressing or not the inactive form of ATR. Images were taken 3 h after treatment with 8-MOP (10 μM+10 kJ/m 2 UVA). ( F ) Quantification of NBS1 foci in WT, ATRkd-expressing and CHK1-siRNA-transfected cells following exposure to photoactivated 8-MOP.

    Journal: The EMBO Journal

    Article Title: The DNA crosslink-induced S-phase checkpoint depends on ATR-CHK1 and ATR-NBS1-FANCD2 pathways

    doi: 10.1038/sj.emboj.7600113

    Figure Lengend Snippet: CHK1 and NBS1 are independently involved in ICL-dependent S-phase checkpoint downstream of ATR. ( A ) CHK1-siRNA transfection induces inhibition of CHK1 expression in HeLa cells. Protein extracts from mock-transfected (No siRNA), Ctrl siRNA or CHK1-siRNA-transfected cells were analyzed by Western blot with an anti-CHK1 antibody. ( B ) Replicative DNA synthesis in WT, NBS and/or CHK1-siRNA-inhibited cells 3 h after crosslinking treatment (10 μM 8-MOP+10 kJ/m 2 UVA). ( C ) CHK1 phosphorylation in response to ICLs (10 μM 8-MOP+10 kJ/m 2 UVA, 3 h recovery) or HU (2 mM, 6 h of treatment) exposure in WT, NBS, ATRkd-Dox or ATRkd-expressing cells (ATRkd+Dox) was assessed by Western blot with anti-phospho-CHK1 antibody directed against phospho-S345. ( D ) Analysis of NBS1 phosphorylation in response to ICLs (10 μM 8-MOP+10 kJ/m 2 UVA, 3 h recovery) or HU (2 mM, 6 h of treatment) exposure in WT (ATRkd-Dox) and ATRkd-expressing (ATRkd+Dox) cells (first panel), in CHK1-siRNA-treated cells (middle panel) or in response to ICLs or IR (5 Gy) in control and A-T cells (lower panel), as observed by Western blot with an anti-NBS1 antibody. ( E ) Representative images showing ICL-induced NBS1 assembly in nuclear foci in cells expressing or not the inactive form of ATR. Images were taken 3 h after treatment with 8-MOP (10 μM+10 kJ/m 2 UVA). ( F ) Quantification of NBS1 foci in WT, ATRkd-expressing and CHK1-siRNA-transfected cells following exposure to photoactivated 8-MOP.

    Article Snippet: ATR expression was knocked down using the smart pool ATR siRNA from Dharmacon.

    Techniques: Transfection, Inhibition, Expressing, Western Blot, DNA Synthesis

    ATR is involved in the S-phase checkpoint induced by ICL agents. ( A ) Replicative DNA synthesis was assessed by 3 H–T incorporation at various time points following exposure to 8-MOP (10 μM)+UVA (10 kJ/m 2 ) (left panel) or 3 h post-treatment after various doses of 8-MOP photoactivated by UVA (10 kJ/m 2 ) (right panel) in GM3657 (▾), MRC5 (•), ATM defective cells (□), ATRkd-Dox (○) control cells, ATRkd-expressing cells (▪), i.e. ATRkd+doxycyclin 48 h before crosslinking treatment, or HeLa cells transfected with ATR siRNA (▿) 48 h before the genotoxic treatment. ( B ) Induction by doxycyclin (1 μg/ml) of the Flag-tagged ATRkd protein in ATRkd-transfected cells as analyzed by Western blot with an anti-Flag antibody. ( C ) Inhibition of ATR expression by ATR-siRNA transfection. * Indicates aspecific bands recognized by the α-ATR antibody used.

    Journal: The EMBO Journal

    Article Title: The DNA crosslink-induced S-phase checkpoint depends on ATR-CHK1 and ATR-NBS1-FANCD2 pathways

    doi: 10.1038/sj.emboj.7600113

    Figure Lengend Snippet: ATR is involved in the S-phase checkpoint induced by ICL agents. ( A ) Replicative DNA synthesis was assessed by 3 H–T incorporation at various time points following exposure to 8-MOP (10 μM)+UVA (10 kJ/m 2 ) (left panel) or 3 h post-treatment after various doses of 8-MOP photoactivated by UVA (10 kJ/m 2 ) (right panel) in GM3657 (▾), MRC5 (•), ATM defective cells (□), ATRkd-Dox (○) control cells, ATRkd-expressing cells (▪), i.e. ATRkd+doxycyclin 48 h before crosslinking treatment, or HeLa cells transfected with ATR siRNA (▿) 48 h before the genotoxic treatment. ( B ) Induction by doxycyclin (1 μg/ml) of the Flag-tagged ATRkd protein in ATRkd-transfected cells as analyzed by Western blot with an anti-Flag antibody. ( C ) Inhibition of ATR expression by ATR-siRNA transfection. * Indicates aspecific bands recognized by the α-ATR antibody used.

    Article Snippet: ATR expression was knocked down using the smart pool ATR siRNA from Dharmacon.

    Techniques: DNA Synthesis, Expressing, Transfection, Western Blot, Inhibition

    The DNA damage-activated PIKKs family members ATM, ATR and DNA-PK are not required for downregulation of BRCA1. A) Immunoblotting detection of BRCA1 in HeLa cells treated with 10 Gy IR or 200 µM MMS. B) BRCA1 downregulation is not blocked by caffeine. Immunoblotting detection of BRCA1 in HeLa cells pre-treated with 10 mM caffeine for 30 min prior to 200 µM MMS treatment for 6 hrs. C) The downregulation of BRCA1 is not prevented by the ATM inhibitor (KU-55933). Immunoblotting detection of BRCA1 in HeLa cells pre-treated with 10 µM KU-55933 for 30 min prior to 200 µM MMS treatment for 6 hrs. γH2AX and pChk2 detection were used as controls to confirm inhibition of ATM and/or ATR kinases. D) BRCA1 is downregulated in ATM-deficient human fibroblasts. Cells were treated with 200 µM MMS treatment for 6 hrs and harvested for immunoblotting. E) Depletion of ATR by RNAi does not prevent BRCA1 downregulation by MMS. Left , immunodetection of ATR following shRNA constructs transfection and puromycin selection. Right , ATR-depleted cells were treated with 200 µM MMS and harvested at the indicated times for immunoblotting. F) BRCA1 is downregulated in DNA-PKcs deficient cells. Glioblastoma DNA-PKcs proficient (MO59K) or deficient (MO59J) were treated with 200 µM MMS and harvested at the indicated times for immunoblotting.

    Journal: PLoS ONE

    Article Title: PI 3 Kinase Related Kinases-Independent Proteolysis of BRCA1 Regulates Rad51 Recruitment during Genotoxic Stress in Human Cells

    doi: 10.1371/journal.pone.0014027

    Figure Lengend Snippet: The DNA damage-activated PIKKs family members ATM, ATR and DNA-PK are not required for downregulation of BRCA1. A) Immunoblotting detection of BRCA1 in HeLa cells treated with 10 Gy IR or 200 µM MMS. B) BRCA1 downregulation is not blocked by caffeine. Immunoblotting detection of BRCA1 in HeLa cells pre-treated with 10 mM caffeine for 30 min prior to 200 µM MMS treatment for 6 hrs. C) The downregulation of BRCA1 is not prevented by the ATM inhibitor (KU-55933). Immunoblotting detection of BRCA1 in HeLa cells pre-treated with 10 µM KU-55933 for 30 min prior to 200 µM MMS treatment for 6 hrs. γH2AX and pChk2 detection were used as controls to confirm inhibition of ATM and/or ATR kinases. D) BRCA1 is downregulated in ATM-deficient human fibroblasts. Cells were treated with 200 µM MMS treatment for 6 hrs and harvested for immunoblotting. E) Depletion of ATR by RNAi does not prevent BRCA1 downregulation by MMS. Left , immunodetection of ATR following shRNA constructs transfection and puromycin selection. Right , ATR-depleted cells were treated with 200 µM MMS and harvested at the indicated times for immunoblotting. F) BRCA1 is downregulated in DNA-PKcs deficient cells. Glioblastoma DNA-PKcs proficient (MO59K) or deficient (MO59J) were treated with 200 µM MMS and harvested at the indicated times for immunoblotting.

    Article Snippet: shRNA knockdowns shRNA targeting ATR (TRC0000039615) was purchased from Sigma-Aldrich.

    Techniques: Inhibition, Immunodetection, shRNA, Construct, Transfection, Selection

    ATR promotes the phosphorylation of cyclin D1 during normal S phase. ATR siRNA (A) or the control siRNA (B) was microinjected into sparse cultures of NIH 3T3 cells 48 h prior to fixation, staining, and analysis. The phosphorylated to total cyclin D1 ratio

    Journal: Molecular and Cellular Biology

    Article Title: Phosphorylation of Cyclin D1 Regulated by ATM or ATR Controls Cell Cycle Progression ▿

    doi: 10.1128/MCB.02047-07

    Figure Lengend Snippet: ATR promotes the phosphorylation of cyclin D1 during normal S phase. ATR siRNA (A) or the control siRNA (B) was microinjected into sparse cultures of NIH 3T3 cells 48 h prior to fixation, staining, and analysis. The phosphorylated to total cyclin D1 ratio

    Article Snippet: Mouse monoclonal anti-cyclin D1 Ab (72-13G, sc-450), mouse monoclonal anti-green fluorescent protein (GFP) (B-2, Sc9996), goat polyclonal anti-ATR Ab (N-19, sc-1887), and small interfering RNA (siRNA) against mouse ATR (sc-29764) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Staining

    Western analysis following ATR ablation. (A) NIH 3T3 cells were either transfected with siRNA against ATR or mock transfected. After 48 h, they were stimulated with serum for 15 h, UV irradiated, and subjected to Western analysis for the indicated markers.

    Journal: Molecular and Cellular Biology

    Article Title: Phosphorylation of Cyclin D1 Regulated by ATM or ATR Controls Cell Cycle Progression ▿

    doi: 10.1128/MCB.02047-07

    Figure Lengend Snippet: Western analysis following ATR ablation. (A) NIH 3T3 cells were either transfected with siRNA against ATR or mock transfected. After 48 h, they were stimulated with serum for 15 h, UV irradiated, and subjected to Western analysis for the indicated markers.

    Article Snippet: Mouse monoclonal anti-cyclin D1 Ab (72-13G, sc-450), mouse monoclonal anti-green fluorescent protein (GFP) (B-2, Sc9996), goat polyclonal anti-ATR Ab (N-19, sc-1887), and small interfering RNA (siRNA) against mouse ATR (sc-29764) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Western Blot, Transfection, Irradiation

    Cyclin D1 phosphorylation following UV irradiation depends upon ATR activity. (A to I) NIH 3T3 cells were microinjected with siRNA (2 μM) against ATR, or an unrelated siRNA. Forty-eight hours later, the injected cultures were UV irradiated, while

    Journal: Molecular and Cellular Biology

    Article Title: Phosphorylation of Cyclin D1 Regulated by ATM or ATR Controls Cell Cycle Progression ▿

    doi: 10.1128/MCB.02047-07

    Figure Lengend Snippet: Cyclin D1 phosphorylation following UV irradiation depends upon ATR activity. (A to I) NIH 3T3 cells were microinjected with siRNA (2 μM) against ATR, or an unrelated siRNA. Forty-eight hours later, the injected cultures were UV irradiated, while

    Article Snippet: Mouse monoclonal anti-cyclin D1 Ab (72-13G, sc-450), mouse monoclonal anti-green fluorescent protein (GFP) (B-2, Sc9996), goat polyclonal anti-ATR Ab (N-19, sc-1887), and small interfering RNA (siRNA) against mouse ATR (sc-29764) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Irradiation, Activity Assay, Injection

    ATM and ATR protein levels show a reciprocal relationship. ( A ) Brain sections from 2-mo-old WT, Atm tm1Awb /Atm tm1Awb (Awb), and Atm tm1Bal /Atm tm1Bal (Bal) mice were labeled with ATR (green) or MAP2 (red) antibodies and counterstained with DAPI (blue). (Scale bars: as marked.) ( B ) ATR immunostaining intensity. n = 3 animals for each group. Error bars represent SEM. * P = 0.0232; * P = 0.036, unpaired t test. ( C ) Western blots of Atm KO (Awb) and WT cortical lysates. Actin served as a loading control. n = 3 animals for each group. Error bars represent SEM. *** P = 0.0006, unpaired t test. ( D ) Western blots of HEK293T cells lysates obtained at 48 h after transfection with Atm -shRNA or Atr -shRNA. GAPDH served as a loading control. ( E ) Quantification of the blots shown in D . n = 4–6 independent cultures. Error bars represent SEM. *** P = 0.0007; * P = 0.01; * P = 0.0445; ** P = 0.0032, unpaired t test. ( F ) Western blots of ATM, ATR, VGLUT1, and VGAT of lysates from 21 DIV cortical neurons treated with D-CPP-ene or bicuculline for 24 h. ( G ) Quantification of the blots shown in F . n = 3∼4 independent neuronal cultures. Error bars represent SEM. For ATM, * P = 0.0317, * P = 0.0152; for VGLUT1, * P = 0.03; for ATR, ** P = 0.0046, * P = 0.0213; for VGAT, * P = 0.0293, * P = 0.0479, unpaired t test.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: ATM and ATR play complementary roles in the behavior of excitatory and inhibitory vesicle populations

    doi: 10.1073/pnas.1716892115

    Figure Lengend Snippet: ATM and ATR protein levels show a reciprocal relationship. ( A ) Brain sections from 2-mo-old WT, Atm tm1Awb /Atm tm1Awb (Awb), and Atm tm1Bal /Atm tm1Bal (Bal) mice were labeled with ATR (green) or MAP2 (red) antibodies and counterstained with DAPI (blue). (Scale bars: as marked.) ( B ) ATR immunostaining intensity. n = 3 animals for each group. Error bars represent SEM. * P = 0.0232; * P = 0.036, unpaired t test. ( C ) Western blots of Atm KO (Awb) and WT cortical lysates. Actin served as a loading control. n = 3 animals for each group. Error bars represent SEM. *** P = 0.0006, unpaired t test. ( D ) Western blots of HEK293T cells lysates obtained at 48 h after transfection with Atm -shRNA or Atr -shRNA. GAPDH served as a loading control. ( E ) Quantification of the blots shown in D . n = 4–6 independent cultures. Error bars represent SEM. *** P = 0.0007; * P = 0.01; * P = 0.0445; ** P = 0.0032, unpaired t test. ( F ) Western blots of ATM, ATR, VGLUT1, and VGAT of lysates from 21 DIV cortical neurons treated with D-CPP-ene or bicuculline for 24 h. ( G ) Quantification of the blots shown in F . n = 3∼4 independent neuronal cultures. Error bars represent SEM. For ATM, * P = 0.0317, * P = 0.0152; for VGLUT1, * P = 0.03; for ATR, ** P = 0.0046, * P = 0.0213; for VGAT, * P = 0.0293, * P = 0.0479, unpaired t test.

    Article Snippet: For siRNA and ORF plasmids, Atr -siRNA (sc-29764) was obtained from Santa Cruz Biotechnology, GFP- Atm -shRNA (TL320267) and GFP- Atr -shRNA (TL519184) were supplied by Origene, mCherry- Atm -shRNA (MSH026597) was obtained from Genecopoeia, GFP-C1-PLCdelta-PH (21179) was provided by Addgene.

    Techniques: Mouse Assay, Labeling, Immunostaining, Western Blot, Transfection, shRNA, Conditioned Place Preference

    A whole genome siRNA screen for replication stress response genes. (A) Overview of the screening strategy. (B) U2OS cells were added to 384-well plates containing siRNA and Dharmafect transfection reagent. Seventy-two hours later, BrdU was incorporated for 30 minutes, then removed and cells were treated for 24 hours with 2mM HU. HU was removed and cells were labelled with 10µM EdU for 4 hours before fixing and performing immunofluorescence and automated imaging for BrdU, γH2AX, EdU, and DAPI. (C) Representative images of NT (non-targeting) and ATR siRNA controls showing BrdU and EdU incorporation and γH2AX intensity levels. (D) The mean values of NT and ATR control siRNAs from all plates for each replicate are depicted. Error bars represent standard error of the mean (SEM).

    Journal: DNA repair

    Article Title: A whole genome RNAi screen identifies replication stress response genes

    doi: 10.1016/j.dnarep.2015.09.024

    Figure Lengend Snippet: A whole genome siRNA screen for replication stress response genes. (A) Overview of the screening strategy. (B) U2OS cells were added to 384-well plates containing siRNA and Dharmafect transfection reagent. Seventy-two hours later, BrdU was incorporated for 30 minutes, then removed and cells were treated for 24 hours with 2mM HU. HU was removed and cells were labelled with 10µM EdU for 4 hours before fixing and performing immunofluorescence and automated imaging for BrdU, γH2AX, EdU, and DAPI. (C) Representative images of NT (non-targeting) and ATR siRNA controls showing BrdU and EdU incorporation and γH2AX intensity levels. (D) The mean values of NT and ATR control siRNAs from all plates for each replicate are depicted. Error bars represent standard error of the mean (SEM).

    Article Snippet: The screens were performed in triplicate in 384-well plates containing sample, All Stars Negative Control (non-targeting) (Qiagen), ATR positive control (Dharmacon), and cell death transfection efficiency control (Qiagen) siRNAs.

    Techniques: Transfection, Immunofluorescence, Imaging

    siRNA-mediated knockdown of Atr1 and Atr2 in mouse VSMCs. Atr expression in cells transfected with control ( CTL ) or atr -specific siRNAs is shown; + denotes equivalent siRNA to achieve final concentration of 0.2 μmol/liter. A , Western ( top

    Journal: The Journal of Biological Chemistry

    Article Title: Atrophin Proteins Interact with the Fat1 Cadherin and Regulate Migration and Orientation in Vascular Smooth Muscle Cells

    doi: 10.1074/jbc.M809333200

    Figure Lengend Snippet: siRNA-mediated knockdown of Atr1 and Atr2 in mouse VSMCs. Atr expression in cells transfected with control ( CTL ) or atr -specific siRNAs is shown; + denotes equivalent siRNA to achieve final concentration of 0.2 μmol/liter. A , Western ( top

    Article Snippet: The mouse atr siRNAs (Sigma/Proligo) were designed to target 21-nucleotide sequences derived from atr1 (GenBank™ accession number NM007881, starting at positions 719 (GAATGCTAGTGGAGGTGTT), 905 (GAGCTTACCTTCTGCACCA), and 1297 (CTAGTATGTCTGTCTCTAA)), atr2 (GenBank™ accession number XM204015, starting at positions 689 (CTGATTATGTTGACACCTA); 1116 (CAGTTATGATGCCGGCAAA), and 4622 (CAAGTCAGGAGGATTATTA)).

    Techniques: Expressing, Transfection, CTL Assay, Concentration Assay, Western Blot