anti-stat3 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Cell Signaling Technology Inc stat3
    Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 16391 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 16391 article reviews
    Price from $9.99 to $1999.99
    stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc anti stat3
    TRIM28 functions as a cofactor for RORγt and <t>STAT3.</t> a Overlay of TRIM28 binding peaks with that of RORγt and STAT3 in Th17 cells. b Genome-wide distributions of binding peaks of RORγt, STAT3, and p300 at TRIM28 binding sites. c IGV browser view of RORγt, STAT3, and TRIM28 binding peaks at the Il17-Il17f gene locus. d Binding of RORγt and STAT3 to the Il17-Il17f gene locus in WT and Trim28 −/ − Th17 cells cultured at TGF-β plus IL-6 condition. e Overexpression of RORγt in WT or TRIM28 KO CD4 + T cells polarized under neutral (Th0) or Th17 (TGF-β plus IL-6) conditions. d , e The experiments were repeated 2–3 times with consistent results, and Student’s t test was used for the statistical test (ns = not significant; * p
    Anti Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 3773 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 3773 article reviews
    Price from $9.99 to $1999.99
    anti stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc p stat3
    Summary for the effect of CXCL12 on apoptosis through activation of <t>JAK2/STAT3</t> signaling in human lung cancer cells. Notes: Proposed mechanisms of suppression effects of CXCL12 on the apoptosis of human lung cancer cells. CXCL12 binds to its receptor (CXCR4) and activates JAK2, which phosphorylates STAT3. Tyr705-phosphorylated STAT3 (p-STAT3) translocates to the nucleus and activates transcription of Bcl-XL, Bcl-2, and cyclin D1, thereby inhibiting apoptosis and inducing cell cycle progression of lung cancer cells.
    P Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 5731 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 5731 article reviews
    Price from $9.99 to $1999.99
    p stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc phospho stat3
    Summary for the effect of CXCL12 on apoptosis through activation of <t>JAK2/STAT3</t> signaling in human lung cancer cells. Notes: Proposed mechanisms of suppression effects of CXCL12 on the apoptosis of human lung cancer cells. CXCL12 binds to its receptor (CXCR4) and activates JAK2, which phosphorylates STAT3. Tyr705-phosphorylated STAT3 (p-STAT3) translocates to the nucleus and activates transcription of Bcl-XL, Bcl-2, and cyclin D1, thereby inhibiting apoptosis and inducing cell cycle progression of lung cancer cells.
    Phospho Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 3849 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phospho stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 3849 article reviews
    Price from $9.99 to $1999.99
    phospho stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc anti phospho stat3
    Epha2 on oral epithelial cells binds β-glucan and primes the cells for an inflammatory response ( Left panel ) EphA2 (blue) and dectin-1 (green) bind to exposed β-glucan on the fungal surface. Binding to EphA2 is independent of Ca 2+ and activates mitogen-activated protein kinase (MAPK) and signal transducer and activator of transcription 3 <t>(Stat3).</t> Binding to dectin-1 requires Ca 2+ and activates nuclear factor ‘kappa-light-chain-enhancer’ of activated B-cells (NF-κB). ( Right panel ) During fungal proliferation, prolonged activation of EphA2 via EGFR (grey) induces the endocytosis of C. albicans and a pro-inflammatory response in the epithelial cells. EphA2-EGFR induces endocytosis and triggers MAPK signaling. EphA2 also activates Stat3 Activation of the Stat3 and MAPK pathways leads to the release of alarmins, cytokines, chemokines, and host defense peptides (HDPs, orange helix).
    Anti Phospho Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1473 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti phospho stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 1473 article reviews
    Price from $9.99 to $1999.99
    anti phospho stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    92
    Santa Cruz Biotechnology anti stat3
    SDHB and IDH 2 protein levels are associated with Gleason grade SDHB protein expression levels in a TMA ( n = 83) detected by immunohistochemistry (IHC). Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. TMA, tissue microarray. Representative IHC staining of SDHB in normal prostate glands and Gleason grade (GL) 3–5 PCa glands. Scale bar = 100 μm. IDH2 protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. Representative IHC staining of IDH2 in normal prostate glands and GL 3–5 PCa glands. Scale bar = 100 μm. Nuclear (N) and cytoplasmic (C) <t>STAT3</t> protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q = adj. P ‐value; n.s., not significant. Source data are available online for this figure.
    Anti Stat3, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1721 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti stat3/product/Santa Cruz Biotechnology
    Average 92 stars, based on 1721 article reviews
    Price from $9.99 to $1999.99
    anti stat3 - by Bioz Stars, 2020-10
    92/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc total stat3
    Il6 activation contributes to activation of <t>Stat3/Myc</t> signaling in Pten Δ/Δ ; Trp53 Δ/Δ cells
    Total Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 2052 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/total stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 2052 article reviews
    Price from $9.99 to $1999.99
    total stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc anti p stat3
    Nuclear translocation of <t>STAT3</t> was suppressed by ursolic acid in HCT116 cells. The localization of STAT3 (red) and 4,6-diamidino-2-phenylindole (DAPI) (blue) in HCT116 cells. HCT116 cells were treated by ursolic acid for 24 h. STAT3 was probed with primary antibody and labelled using secondary antibody conjugated. Scale bar = 40 μm. Corresponding zoomed images of the STAT3, DAPI, and Merge (indicated by the yellow box).
    Anti P Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 901 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti p stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 901 article reviews
    Price from $9.99 to $1999.99
    anti p stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    93
    Cell Signaling Technology Inc antibody against stat3
    FEZF1-AS1 promotes <t>STAT3</t> expression. ( A ) FEZF1-AS1 knockdown inhibited the protein levels of p-STAT3 and STAT3 in ES2 cells. ( B ) Expression correlation between STAT3 and FEZF1-AS1 was determined by qRT-PCR in ovarian cancer tissues. * P
    Antibody Against Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 93/100, based on 151 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antibody against stat3/product/Cell Signaling Technology Inc
    Average 93 stars, based on 151 article reviews
    Price from $9.99 to $1999.99
    antibody against stat3 - by Bioz Stars, 2020-10
    93/100 stars
      Buy from Supplier

    99
    Abcam anti stat3
    The gemcitabine-erlotinib (E+G) combination group inhibits the activity of the JAK-STAT pathway, as well as the expression of downstream HIF-1α, cyclin D1 and p53. (A and B) The protein levels of phosphorylated <t>STAT3</t> Tyr 705 (p-STAT3 Tyr 705 ), HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells were analyzed by western blotting, respectively. (C and D) The protein expression of p-STAT3 Tyr 705 , HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells was calculated using one-way ANOVA. *P
    Anti Stat3, supplied by Abcam, used in various techniques. Bioz Stars score: 99/100, based on 584 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti stat3/product/Abcam
    Average 99 stars, based on 584 article reviews
    Price from $9.99 to $1999.99
    anti stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    stat3  (Abcam)
    98
    Abcam stat3
    The gemcitabine-erlotinib (E+G) combination group inhibits the activity of the JAK-STAT pathway, as well as the expression of downstream HIF-1α, cyclin D1 and p53. (A and B) The protein levels of phosphorylated <t>STAT3</t> Tyr 705 (p-STAT3 Tyr 705 ), HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells were analyzed by western blotting, respectively. (C and D) The protein expression of p-STAT3 Tyr 705 , HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells was calculated using one-way ANOVA. *P
    Stat3, supplied by Abcam, used in various techniques. Bioz Stars score: 98/100, based on 1167 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stat3/product/Abcam
    Average 98 stars, based on 1167 article reviews
    Price from $9.99 to $1999.99
    stat3 - by Bioz Stars, 2020-10
    98/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc phosphorylated stat3
    The gemcitabine-erlotinib (E+G) combination group inhibits the activity of the JAK-STAT pathway, as well as the expression of downstream HIF-1α, cyclin D1 and p53. (A and B) The protein levels of phosphorylated <t>STAT3</t> Tyr 705 (p-STAT3 Tyr 705 ), HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells were analyzed by western blotting, respectively. (C and D) The protein expression of p-STAT3 Tyr 705 , HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells was calculated using one-way ANOVA. *P
    Phosphorylated Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1037 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphorylated stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 1037 article reviews
    Price from $9.99 to $1999.99
    phosphorylated stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    98
    Abcam p stat3
    The gemcitabine-erlotinib (E+G) combination group inhibits the activity of the JAK-STAT pathway, as well as the expression of downstream HIF-1α, cyclin D1 and p53. (A and B) The protein levels of phosphorylated <t>STAT3</t> Tyr 705 (p-STAT3 Tyr 705 ), HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells were analyzed by western blotting, respectively. (C and D) The protein expression of p-STAT3 Tyr 705 , HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells was calculated using one-way ANOVA. *P
    P Stat3, supplied by Abcam, used in various techniques. Bioz Stars score: 98/100, based on 797 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p stat3/product/Abcam
    Average 98 stars, based on 797 article reviews
    Price from $9.99 to $1999.99
    p stat3 - by Bioz Stars, 2020-10
    98/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc antibodies against p stat3
    The gemcitabine-erlotinib (E+G) combination group inhibits the activity of the JAK-STAT pathway, as well as the expression of downstream HIF-1α, cyclin D1 and p53. (A and B) The protein levels of phosphorylated <t>STAT3</t> Tyr 705 (p-STAT3 Tyr 705 ), HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells were analyzed by western blotting, respectively. (C and D) The protein expression of p-STAT3 Tyr 705 , HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells was calculated using one-way ANOVA. *P
    Antibodies Against P Stat3, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 212 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antibodies against p stat3/product/Cell Signaling Technology Inc
    Average 99 stars, based on 212 article reviews
    Price from $9.99 to $1999.99
    antibodies against p stat3 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    TRIM28 functions as a cofactor for RORγt and STAT3. a Overlay of TRIM28 binding peaks with that of RORγt and STAT3 in Th17 cells. b Genome-wide distributions of binding peaks of RORγt, STAT3, and p300 at TRIM28 binding sites. c IGV browser view of RORγt, STAT3, and TRIM28 binding peaks at the Il17-Il17f gene locus. d Binding of RORγt and STAT3 to the Il17-Il17f gene locus in WT and Trim28 −/ − Th17 cells cultured at TGF-β plus IL-6 condition. e Overexpression of RORγt in WT or TRIM28 KO CD4 + T cells polarized under neutral (Th0) or Th17 (TGF-β plus IL-6) conditions. d , e The experiments were repeated 2–3 times with consistent results, and Student’s t test was used for the statistical test (ns = not significant; * p

    Journal: Nature Communications

    Article Title: Epigenetic activation during T helper 17 cell differentiation is mediated by Tripartite motif containing 28

    doi: 10.1038/s41467-018-03852-2

    Figure Lengend Snippet: TRIM28 functions as a cofactor for RORγt and STAT3. a Overlay of TRIM28 binding peaks with that of RORγt and STAT3 in Th17 cells. b Genome-wide distributions of binding peaks of RORγt, STAT3, and p300 at TRIM28 binding sites. c IGV browser view of RORγt, STAT3, and TRIM28 binding peaks at the Il17-Il17f gene locus. d Binding of RORγt and STAT3 to the Il17-Il17f gene locus in WT and Trim28 −/ − Th17 cells cultured at TGF-β plus IL-6 condition. e Overexpression of RORγt in WT or TRIM28 KO CD4 + T cells polarized under neutral (Th0) or Th17 (TGF-β plus IL-6) conditions. d , e The experiments were repeated 2–3 times with consistent results, and Student’s t test was used for the statistical test (ns = not significant; * p

    Article Snippet: The following antibodies were used for immunoblotting: anti-TRIM28 antibody (CST, catalog 4124), anti-RORγt (ebioscience, 14-6988-82), anti-STAT3 (CST, 12640).

    Techniques: Binding Assay, Genome Wide, Cell Culture, Over Expression

    Cytokine signaling regulated TRIM28 recruitment. a Expression of TRIM28 in different T-cell subsets and naive CD4 + T cells. b TRIM28 ChIP-qPCR results in WT Th0, WT Th17, STAT3 KO Th17 or RORγt KO Th17 cells. c RORγt overexpression in WT or STAT3 KO CD4 + T cells polarized under neutral (Th0) condition. d Overlay of p300 binding peaks in WT/STAT3KO(Upper) or WT/RORγKO (lower) Th17 cells over Th17-specific SEs with decreased p300 intensity. e . f . Those experiments were repeated twice with consistent results, and Student’s t test was used for the statistical test (ns = not significant; * p

    Journal: Nature Communications

    Article Title: Epigenetic activation during T helper 17 cell differentiation is mediated by Tripartite motif containing 28

    doi: 10.1038/s41467-018-03852-2

    Figure Lengend Snippet: Cytokine signaling regulated TRIM28 recruitment. a Expression of TRIM28 in different T-cell subsets and naive CD4 + T cells. b TRIM28 ChIP-qPCR results in WT Th0, WT Th17, STAT3 KO Th17 or RORγt KO Th17 cells. c RORγt overexpression in WT or STAT3 KO CD4 + T cells polarized under neutral (Th0) condition. d Overlay of p300 binding peaks in WT/STAT3KO(Upper) or WT/RORγKO (lower) Th17 cells over Th17-specific SEs with decreased p300 intensity. e . f . Those experiments were repeated twice with consistent results, and Student’s t test was used for the statistical test (ns = not significant; * p

    Article Snippet: The following antibodies were used for immunoblotting: anti-TRIM28 antibody (CST, catalog 4124), anti-RORγt (ebioscience, 14-6988-82), anti-STAT3 (CST, 12640).

    Techniques: Expressing, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Over Expression, Binding Assay

    Summary for the effect of CXCL12 on apoptosis through activation of JAK2/STAT3 signaling in human lung cancer cells. Notes: Proposed mechanisms of suppression effects of CXCL12 on the apoptosis of human lung cancer cells. CXCL12 binds to its receptor (CXCR4) and activates JAK2, which phosphorylates STAT3. Tyr705-phosphorylated STAT3 (p-STAT3) translocates to the nucleus and activates transcription of Bcl-XL, Bcl-2, and cyclin D1, thereby inhibiting apoptosis and inducing cell cycle progression of lung cancer cells.

    Journal: OncoTargets and therapy

    Article Title: CXCL12 suppresses cisplatin-induced apoptosis through activation of JAK2/STAT3 signaling in human non-small-cell lung cancer cells

    doi: 10.2147/OTT.S133055

    Figure Lengend Snippet: Summary for the effect of CXCL12 on apoptosis through activation of JAK2/STAT3 signaling in human lung cancer cells. Notes: Proposed mechanisms of suppression effects of CXCL12 on the apoptosis of human lung cancer cells. CXCL12 binds to its receptor (CXCR4) and activates JAK2, which phosphorylates STAT3. Tyr705-phosphorylated STAT3 (p-STAT3) translocates to the nucleus and activates transcription of Bcl-XL, Bcl-2, and cyclin D1, thereby inhibiting apoptosis and inducing cell cycle progression of lung cancer cells.

    Article Snippet: After endogenous peroxidase was quenched with 3% hydrogen peroxide and blocked for 10 min, the sections were incubated overnight at 4°C with antibodies against CXCL12 (1:200; R & D Systems Inc.) or p-STAT3 (1:150; Cell Signaling Technology).

    Techniques: Activation Assay

    CXCL12 stimulates activation of the STAT3 pathway in a time-dependent manner. Notes: ( A and B ) The time course shows that 100 ng/mL CXCL12 induced a significant increase of STAT3 phosphorylation at 24 h. ( C and D ) Representative images for the expression of apoptosis-related proteins determined by Western blot analysis after treatment in A549 cells. β-Actin served as an internal control (Con) for normalization purposes. * P

    Journal: OncoTargets and therapy

    Article Title: CXCL12 suppresses cisplatin-induced apoptosis through activation of JAK2/STAT3 signaling in human non-small-cell lung cancer cells

    doi: 10.2147/OTT.S133055

    Figure Lengend Snippet: CXCL12 stimulates activation of the STAT3 pathway in a time-dependent manner. Notes: ( A and B ) The time course shows that 100 ng/mL CXCL12 induced a significant increase of STAT3 phosphorylation at 24 h. ( C and D ) Representative images for the expression of apoptosis-related proteins determined by Western blot analysis after treatment in A549 cells. β-Actin served as an internal control (Con) for normalization purposes. * P

    Article Snippet: After endogenous peroxidase was quenched with 3% hydrogen peroxide and blocked for 10 min, the sections were incubated overnight at 4°C with antibodies against CXCL12 (1:200; R & D Systems Inc.) or p-STAT3 (1:150; Cell Signaling Technology).

    Techniques: Activation Assay, Expressing, Western Blot

    Immunohistochemical expression of CXCL12 and p-STAT3 in NSCLC tissues (SP method; magnification, ×200). Notes: ( A ) Immunoreactivity was observed in the malignant cell cytoplasm. The brown granules in the cytoplasm of NSCLC cells indicate CXCL12. ( B ) Negative expression of CXCL12 in NSCLC tissues. ( C ) Nuclear staining of p-STAT3 in NSCLC tissues. ( D ) Negative expression of p-STAT3 in NSCLC tissues. Abbreviations: NSCLC, non-small-cell lung cancer; SP, streptavidin–peroxidase biotin.

    Journal: OncoTargets and therapy

    Article Title: CXCL12 suppresses cisplatin-induced apoptosis through activation of JAK2/STAT3 signaling in human non-small-cell lung cancer cells

    doi: 10.2147/OTT.S133055

    Figure Lengend Snippet: Immunohistochemical expression of CXCL12 and p-STAT3 in NSCLC tissues (SP method; magnification, ×200). Notes: ( A ) Immunoreactivity was observed in the malignant cell cytoplasm. The brown granules in the cytoplasm of NSCLC cells indicate CXCL12. ( B ) Negative expression of CXCL12 in NSCLC tissues. ( C ) Nuclear staining of p-STAT3 in NSCLC tissues. ( D ) Negative expression of p-STAT3 in NSCLC tissues. Abbreviations: NSCLC, non-small-cell lung cancer; SP, streptavidin–peroxidase biotin.

    Article Snippet: After endogenous peroxidase was quenched with 3% hydrogen peroxide and blocked for 10 min, the sections were incubated overnight at 4°C with antibodies against CXCL12 (1:200; R & D Systems Inc.) or p-STAT3 (1:150; Cell Signaling Technology).

    Techniques: Immunohistochemistry, Expressing, Staining

    CXCL12 stimulates phosphorylation of STAT3 through pathways mediated by CXCR4 and JAK2. Notes: Cells were pretreated for 30 min with control buffer, 5 μg/mL AMD3100, or 50 μM AG490 before stimulation with CXCL12 (100 ng/mL). ( A and B ) Both AMD3100 and AG490 completely blocked CXCL12-induced phosphorylation of STAT3. β-Actin served as an internal control (Con) for normalization purposes. ( C ) Immunofluorescence staining analysis. Addition of AG490 or AMD3100 showed decreased p-STAT3 (Serine 727) in the nucleus. All experiments were repeated three times.

    Journal: OncoTargets and therapy

    Article Title: CXCL12 suppresses cisplatin-induced apoptosis through activation of JAK2/STAT3 signaling in human non-small-cell lung cancer cells

    doi: 10.2147/OTT.S133055

    Figure Lengend Snippet: CXCL12 stimulates phosphorylation of STAT3 through pathways mediated by CXCR4 and JAK2. Notes: Cells were pretreated for 30 min with control buffer, 5 μg/mL AMD3100, or 50 μM AG490 before stimulation with CXCL12 (100 ng/mL). ( A and B ) Both AMD3100 and AG490 completely blocked CXCL12-induced phosphorylation of STAT3. β-Actin served as an internal control (Con) for normalization purposes. ( C ) Immunofluorescence staining analysis. Addition of AG490 or AMD3100 showed decreased p-STAT3 (Serine 727) in the nucleus. All experiments were repeated three times.

    Article Snippet: After endogenous peroxidase was quenched with 3% hydrogen peroxide and blocked for 10 min, the sections were incubated overnight at 4°C with antibodies against CXCL12 (1:200; R & D Systems Inc.) or p-STAT3 (1:150; Cell Signaling Technology).

    Techniques: Immunofluorescence, Staining

    Lif-independent Stat3 phosphorylation occurred non-cell-autonomously

    Journal: Experimental cell research

    Article Title: Non-cell-autonomous stimulation of stem cell proliferation following ablation of Tcf3

    doi: 10.1016/j.yexcr.2009.12.005

    Figure Lengend Snippet: Lif-independent Stat3 phosphorylation occurred non-cell-autonomously

    Article Snippet: ESC were stained overnight at 4°C with primary antibodies: rabbit anti-phospho-STAT3 (1:150, #9131, Cell Signaling Technologies) or rabbit anti-Tcf3 (1:500, Merrill lab), followed by Cy5-conjugated anti-rabbit secondary antibody (1:150, Jackson ImmunoResearch Laboratories) and DAPI for nuclei.

    Techniques:

    Jak Kinase activity is necessary for Stat3 phosphorylation in adapted TCF3−/− ESC

    Journal: Experimental cell research

    Article Title: Non-cell-autonomous stimulation of stem cell proliferation following ablation of Tcf3

    doi: 10.1016/j.yexcr.2009.12.005

    Figure Lengend Snippet: Jak Kinase activity is necessary for Stat3 phosphorylation in adapted TCF3−/− ESC

    Article Snippet: ESC were stained overnight at 4°C with primary antibodies: rabbit anti-phospho-STAT3 (1:150, #9131, Cell Signaling Technologies) or rabbit anti-Tcf3 (1:500, Merrill lab), followed by Cy5-conjugated anti-rabbit secondary antibody (1:150, Jackson ImmunoResearch Laboratories) and DAPI for nuclei.

    Techniques: Activity Assay

    Adapted TCF3−/− ESC self renew under blockade of Jak phosphorylation of Stat3

    Journal: Experimental cell research

    Article Title: Non-cell-autonomous stimulation of stem cell proliferation following ablation of Tcf3

    doi: 10.1016/j.yexcr.2009.12.005

    Figure Lengend Snippet: Adapted TCF3−/− ESC self renew under blockade of Jak phosphorylation of Stat3

    Article Snippet: ESC were stained overnight at 4°C with primary antibodies: rabbit anti-phospho-STAT3 (1:150, #9131, Cell Signaling Technologies) or rabbit anti-Tcf3 (1:500, Merrill lab), followed by Cy5-conjugated anti-rabbit secondary antibody (1:150, Jackson ImmunoResearch Laboratories) and DAPI for nuclei.

    Techniques:

    Stat3 phosphorylation in adapted TCF3−/− ESC is partially LifR-independent

    Journal: Experimental cell research

    Article Title: Non-cell-autonomous stimulation of stem cell proliferation following ablation of Tcf3

    doi: 10.1016/j.yexcr.2009.12.005

    Figure Lengend Snippet: Stat3 phosphorylation in adapted TCF3−/− ESC is partially LifR-independent

    Article Snippet: ESC were stained overnight at 4°C with primary antibodies: rabbit anti-phospho-STAT3 (1:150, #9131, Cell Signaling Technologies) or rabbit anti-Tcf3 (1:500, Merrill lab), followed by Cy5-conjugated anti-rabbit secondary antibody (1:150, Jackson ImmunoResearch Laboratories) and DAPI for nuclei.

    Techniques:

    Long-term phosphorylation of Stat3 at tyrosine 705 in TCF3−/− ESC in the absence of exogenous Lif

    Journal: Experimental cell research

    Article Title: Non-cell-autonomous stimulation of stem cell proliferation following ablation of Tcf3

    doi: 10.1016/j.yexcr.2009.12.005

    Figure Lengend Snippet: Long-term phosphorylation of Stat3 at tyrosine 705 in TCF3−/− ESC in the absence of exogenous Lif

    Article Snippet: ESC were stained overnight at 4°C with primary antibodies: rabbit anti-phospho-STAT3 (1:150, #9131, Cell Signaling Technologies) or rabbit anti-Tcf3 (1:500, Merrill lab), followed by Cy5-conjugated anti-rabbit secondary antibody (1:150, Jackson ImmunoResearch Laboratories) and DAPI for nuclei.

    Techniques:

    Epha2 on oral epithelial cells binds β-glucan and primes the cells for an inflammatory response ( Left panel ) EphA2 (blue) and dectin-1 (green) bind to exposed β-glucan on the fungal surface. Binding to EphA2 is independent of Ca 2+ and activates mitogen-activated protein kinase (MAPK) and signal transducer and activator of transcription 3 (Stat3). Binding to dectin-1 requires Ca 2+ and activates nuclear factor ‘kappa-light-chain-enhancer’ of activated B-cells (NF-κB). ( Right panel ) During fungal proliferation, prolonged activation of EphA2 via EGFR (grey) induces the endocytosis of C. albicans and a pro-inflammatory response in the epithelial cells. EphA2-EGFR induces endocytosis and triggers MAPK signaling. EphA2 also activates Stat3 Activation of the Stat3 and MAPK pathways leads to the release of alarmins, cytokines, chemokines, and host defense peptides (HDPs, orange helix).

    Journal: Nature microbiology

    Article Title: EphA2 is an epithelial cell pattern recognition receptor for fungal β-glucans

    doi: 10.1038/s41564-017-0059-5

    Figure Lengend Snippet: Epha2 on oral epithelial cells binds β-glucan and primes the cells for an inflammatory response ( Left panel ) EphA2 (blue) and dectin-1 (green) bind to exposed β-glucan on the fungal surface. Binding to EphA2 is independent of Ca 2+ and activates mitogen-activated protein kinase (MAPK) and signal transducer and activator of transcription 3 (Stat3). Binding to dectin-1 requires Ca 2+ and activates nuclear factor ‘kappa-light-chain-enhancer’ of activated B-cells (NF-κB). ( Right panel ) During fungal proliferation, prolonged activation of EphA2 via EGFR (grey) induces the endocytosis of C. albicans and a pro-inflammatory response in the epithelial cells. EphA2-EGFR induces endocytosis and triggers MAPK signaling. EphA2 also activates Stat3 Activation of the Stat3 and MAPK pathways leads to the release of alarmins, cytokines, chemokines, and host defense peptides (HDPs, orange helix).

    Article Snippet: The lysates were separated by SDS/PAGE, and the phosphorylated proteins were detected by immunoblotting with phospho-specific antibodies, including anti-phospho-EphA2 (Cell signaling; #6347), anti-phospho-Stat3 (Cell signaling; #9134), anti-phospho-c-Fos (Cell signaling; #5348), anti-phospho-MEK1/2 (Cell signaling; #9154), anti-phospho-p65 (Cell signaling; # 3033).

    Techniques: Binding Assay, Activation Assay

    EphA2 signaling regulates the inflammatory response ( a ) Immunoblot demonstrating that C. albicans infection induces phosphorylation of Stat3. ( b ) Effects of the EphA2 depletion with siRNA on C. albicans -induced phosphorylation of Stat3. ( c . ( d ) Oral epithelial cells were incubated with inhibitors of EphA2 and Stat3 and then infected with C. albicans for 5 h, after which chemokines and the S100a8 alarmin mRNA levels were determined by real-time PCR. Box whisker plots show median and range of 2 experiments, each performed in triplicate and are presented as fold induction relative to uninfected epithelial cells. ( e ) EphA2 depletion with siRNA reduces epithelial cell production of human β defensin 2, cytokines and chemokines in response to 8 h of C. albicans infection. Box whisker plots show median and range of 3 experiments, each performed in duplicate. ( f ) Regulation of the oral epithelial cell pro-inflammatory response to C. albicans by Stat3 and dectin-1. Box whisker plots show median and range of 3 experiments, each performed in duplicate. ANT, EphA2 antagonist; ctrl, control; DAS, dasatinib; hBD2, human β defensin 2; MOI, multiplicity of infection; Stat3 INH, Stat3 inhibitor; UNINF, uninfected. ** P

    Journal: Nature microbiology

    Article Title: EphA2 is an epithelial cell pattern recognition receptor for fungal β-glucans

    doi: 10.1038/s41564-017-0059-5

    Figure Lengend Snippet: EphA2 signaling regulates the inflammatory response ( a ) Immunoblot demonstrating that C. albicans infection induces phosphorylation of Stat3. ( b ) Effects of the EphA2 depletion with siRNA on C. albicans -induced phosphorylation of Stat3. ( c . ( d ) Oral epithelial cells were incubated with inhibitors of EphA2 and Stat3 and then infected with C. albicans for 5 h, after which chemokines and the S100a8 alarmin mRNA levels were determined by real-time PCR. Box whisker plots show median and range of 2 experiments, each performed in triplicate and are presented as fold induction relative to uninfected epithelial cells. ( e ) EphA2 depletion with siRNA reduces epithelial cell production of human β defensin 2, cytokines and chemokines in response to 8 h of C. albicans infection. Box whisker plots show median and range of 3 experiments, each performed in duplicate. ( f ) Regulation of the oral epithelial cell pro-inflammatory response to C. albicans by Stat3 and dectin-1. Box whisker plots show median and range of 3 experiments, each performed in duplicate. ANT, EphA2 antagonist; ctrl, control; DAS, dasatinib; hBD2, human β defensin 2; MOI, multiplicity of infection; Stat3 INH, Stat3 inhibitor; UNINF, uninfected. ** P

    Article Snippet: The lysates were separated by SDS/PAGE, and the phosphorylated proteins were detected by immunoblotting with phospho-specific antibodies, including anti-phospho-EphA2 (Cell signaling; #6347), anti-phospho-Stat3 (Cell signaling; #9134), anti-phospho-c-Fos (Cell signaling; #5348), anti-phospho-MEK1/2 (Cell signaling; #9154), anti-phospho-p65 (Cell signaling; # 3033).

    Techniques: Infection, Incubation, Real-time Polymerase Chain Reaction, Whisker Assay

    Higher fungal inoculum induces stronger host response ( a ) Immunoblots showing the effects of increasing C. albicans . ( b ) Effects of C. albicans inoculum on epithelial cell secretion of IL-8 and hBD2. Box whisker plots show median and range of 3 independent experiments in duplicates. ctrl, control; hBD2, human β defensin 2; MOI, multiplicity of infection; Stat3 INH, Stat3 inhibitor; UNINF, uninfected. * P

    Journal: Nature microbiology

    Article Title: EphA2 is an epithelial cell pattern recognition receptor for fungal β-glucans

    doi: 10.1038/s41564-017-0059-5

    Figure Lengend Snippet: Higher fungal inoculum induces stronger host response ( a ) Immunoblots showing the effects of increasing C. albicans . ( b ) Effects of C. albicans inoculum on epithelial cell secretion of IL-8 and hBD2. Box whisker plots show median and range of 3 independent experiments in duplicates. ctrl, control; hBD2, human β defensin 2; MOI, multiplicity of infection; Stat3 INH, Stat3 inhibitor; UNINF, uninfected. * P

    Article Snippet: The lysates were separated by SDS/PAGE, and the phosphorylated proteins were detected by immunoblotting with phospho-specific antibodies, including anti-phospho-EphA2 (Cell signaling; #6347), anti-phospho-Stat3 (Cell signaling; #9134), anti-phospho-c-Fos (Cell signaling; #5348), anti-phospho-MEK1/2 (Cell signaling; #9154), anti-phospho-p65 (Cell signaling; # 3033).

    Techniques: Western Blot, Whisker Assay, Infection

    SDHB and IDH 2 protein levels are associated with Gleason grade SDHB protein expression levels in a TMA ( n = 83) detected by immunohistochemistry (IHC). Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. TMA, tissue microarray. Representative IHC staining of SDHB in normal prostate glands and Gleason grade (GL) 3–5 PCa glands. Scale bar = 100 μm. IDH2 protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. Representative IHC staining of IDH2 in normal prostate glands and GL 3–5 PCa glands. Scale bar = 100 μm. Nuclear (N) and cytoplasmic (C) STAT3 protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q = adj. P ‐value; n.s., not significant. Source data are available online for this figure.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: SDHB and IDH 2 protein levels are associated with Gleason grade SDHB protein expression levels in a TMA ( n = 83) detected by immunohistochemistry (IHC). Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. TMA, tissue microarray. Representative IHC staining of SDHB in normal prostate glands and Gleason grade (GL) 3–5 PCa glands. Scale bar = 100 μm. IDH2 protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q, adj. P ‐value; n.s., not significant. Representative IHC staining of IDH2 in normal prostate glands and GL 3–5 PCa glands. Scale bar = 100 μm. Nuclear (N) and cytoplasmic (C) STAT3 protein expression levels in a TMA ( n = 83) detected by IHC. Box‐plot shows median, 1 st and 3 rd quartiles, and whiskers extend to ± 1.5 interquartile range. Jitter represents single values in groups. Kruskal–Wallis test and Dunn's all‐pairs test were applied. Q = adj. P ‐value; n.s., not significant. Source data are available online for this figure.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Expressing, Immunohistochemistry, Microarray, Staining

    Scheme of down‐regulated KEGG pathways in low STAT 3 TCGA samples KEGG representation of the JAK‐STAT signaling pathway in low STAT3 versus high STAT3 TCGA samples after testing for signaling KEGG pathways. STAT3 and c‐Myc are encircled in yellow. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation. KEGG representation of the HIF‐1 signaling pathway in low STAT3 versus high STAT3 TCGA samples after testing for signaling KEGG pathways. STAT3 and HIF‐1α are encircled in yellow. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Scheme of down‐regulated KEGG pathways in low STAT 3 TCGA samples KEGG representation of the JAK‐STAT signaling pathway in low STAT3 versus high STAT3 TCGA samples after testing for signaling KEGG pathways. STAT3 and c‐Myc are encircled in yellow. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation. KEGG representation of the HIF‐1 signaling pathway in low STAT3 versus high STAT3 TCGA samples after testing for signaling KEGG pathways. STAT3 and HIF‐1α are encircled in yellow. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques:

    Low PDK 4 is significantly associated with earlier disease recurrence in PC a Simplified scheme of upstream regulation of the TCA cycle. Arrows indicate activation, and bar indicates repression. PDC, pyruvate dehydrogenase complex; PDK, pyruvate dehydrogenase kinase; TCA, tricarboxylic acid cycle. Genes of the hallmark gene set “Oxidative phosphorylation” that are differentially expressed in low STAT3 versus high STAT3 TCGA‐PRAD tumors. Dotted lines show Log2‐FC = ± 1 ( x ‐axis) and adj. P ‐value = −log10(0.05; y ‐axis). Orange, up‐regulated genes; green, down‐regulated genes. DE, differentially expressed. Kaplan–Meier plots showing time to biochemical recurrence in months for PDK4 in primary tumors (C) and in primary and metastatic tumors combined (D) in the MSKCC PCa GSE21032 data set. Groups were generated by a median split. P ‐values were estimated by log‐rank test (C, D) and adjusted with Benjamini–Hochberg method (D). + = censored.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Low PDK 4 is significantly associated with earlier disease recurrence in PC a Simplified scheme of upstream regulation of the TCA cycle. Arrows indicate activation, and bar indicates repression. PDC, pyruvate dehydrogenase complex; PDK, pyruvate dehydrogenase kinase; TCA, tricarboxylic acid cycle. Genes of the hallmark gene set “Oxidative phosphorylation” that are differentially expressed in low STAT3 versus high STAT3 TCGA‐PRAD tumors. Dotted lines show Log2‐FC = ± 1 ( x ‐axis) and adj. P ‐value = −log10(0.05; y ‐axis). Orange, up‐regulated genes; green, down‐regulated genes. DE, differentially expressed. Kaplan–Meier plots showing time to biochemical recurrence in months for PDK4 in primary tumors (C) and in primary and metastatic tumors combined (D) in the MSKCC PCa GSE21032 data set. Groups were generated by a median split. P ‐values were estimated by log‐rank test (C, D) and adjusted with Benjamini–Hochberg method (D). + = censored.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Activation Assay, Generated

    Correlation of PDK 4 with STAT 3 and STAT 3 target signatures Pearson correlation of PDK4 log counts per million (cpm) with STAT3 log cpm in three prostate cancer data sets. P ‐values were adjusted with Benjamini–Hochberg method. P . adj., adjusted P ‐value. NCI, The Netherlands Cancer Institute; VPC, The Vancouver Prostate Center; RAS, The Russian Academy of Science. Pearson correlation of PDK4 log cpm with “AZARE STAT3 TARGETS” gene signatures in three prostate cancer data sets. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. Pearson correlation of PDK4 log cpm with “AZARE STAT3 TARGETS” (left) and “STAT3 TARGETS UP” gene signatures (right) in TCGA PRAD. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. P . adj., adjusted P ‐value. Source data are available online for this figure.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Correlation of PDK 4 with STAT 3 and STAT 3 target signatures Pearson correlation of PDK4 log counts per million (cpm) with STAT3 log cpm in three prostate cancer data sets. P ‐values were adjusted with Benjamini–Hochberg method. P . adj., adjusted P ‐value. NCI, The Netherlands Cancer Institute; VPC, The Vancouver Prostate Center; RAS, The Russian Academy of Science. Pearson correlation of PDK4 log cpm with “AZARE STAT3 TARGETS” gene signatures in three prostate cancer data sets. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. Pearson correlation of PDK4 log cpm with “AZARE STAT3 TARGETS” (left) and “STAT3 TARGETS UP” gene signatures (right) in TCGA PRAD. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. P . adj., adjusted P ‐value. Source data are available online for this figure.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques:

    PDK 4 as putative STAT 3 target STAT3‐ and PDK4 ‐stratified subgroups were generated by median splits in MSKCC PCa GSE21032 data set. Pearson correlation between STAT3 and PDK4 is shown. Kaplan–Meier plot shows stratified subgroups. P ‐values were estimated by log‐rank test and adjusted with Benjamini–Hochberg method. Hi, high; lo, low. Western blot of STAT3, PDK4, and β‐TUBULIN proteins in 22Rv1 cells with or without knockdown of STAT3. Ctrl, scrambled control; shSTAT3, short hairpin knockdown of STAT3 . ChIP assay from IL‐6‐stimulated or non‐stimulated 22Rv1 cells with or without knockdown of STAT3 was immunoprecipitated with a STAT3‐specific antibody (blue shades) and IgG antibody as a negative control (orange shades) followed by qPCR with a promoter‐specific primer pair for the PDK4 gene. Bars represent mean ± SD from two technical replicates. Precipitated DNA is presented as % of input. One representative experiment is shown. Result of qPCR using primer pair 2 is shown. Ctrl = scrambled control; shSTAT3 = short hairpin knockdown of STAT3; +IL‐6 = IL‐6‐stimulated. Correlation of STAT3, c‐MYC , and HIF‐1α with PDK1‐4 , PDC genes ( PDHA1, PDHB, PDHX, DLAT, DLD ) and TCA/OXPHOS genes (CS, IDH2, IDH3A, SDHB, SDHC, ATP5A1, NDUFS1) in MSKCC PCa (GSE21032). Dot colors represent Pearson correlation (1 = red; −1 = blue); dot sizes represent adj. P ‐values ≤ 0.05. Only significant correlations are shown. P ‐values were adjusted with Benjamini–Hochberg method. Source data are available online for this figure.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: PDK 4 as putative STAT 3 target STAT3‐ and PDK4 ‐stratified subgroups were generated by median splits in MSKCC PCa GSE21032 data set. Pearson correlation between STAT3 and PDK4 is shown. Kaplan–Meier plot shows stratified subgroups. P ‐values were estimated by log‐rank test and adjusted with Benjamini–Hochberg method. Hi, high; lo, low. Western blot of STAT3, PDK4, and β‐TUBULIN proteins in 22Rv1 cells with or without knockdown of STAT3. Ctrl, scrambled control; shSTAT3, short hairpin knockdown of STAT3 . ChIP assay from IL‐6‐stimulated or non‐stimulated 22Rv1 cells with or without knockdown of STAT3 was immunoprecipitated with a STAT3‐specific antibody (blue shades) and IgG antibody as a negative control (orange shades) followed by qPCR with a promoter‐specific primer pair for the PDK4 gene. Bars represent mean ± SD from two technical replicates. Precipitated DNA is presented as % of input. One representative experiment is shown. Result of qPCR using primer pair 2 is shown. Ctrl = scrambled control; shSTAT3 = short hairpin knockdown of STAT3; +IL‐6 = IL‐6‐stimulated. Correlation of STAT3, c‐MYC , and HIF‐1α with PDK1‐4 , PDC genes ( PDHA1, PDHB, PDHX, DLAT, DLD ) and TCA/OXPHOS genes (CS, IDH2, IDH3A, SDHB, SDHC, ATP5A1, NDUFS1) in MSKCC PCa (GSE21032). Dot colors represent Pearson correlation (1 = red; −1 = blue); dot sizes represent adj. P ‐values ≤ 0.05. Only significant correlations are shown. P ‐values were adjusted with Benjamini–Hochberg method. Source data are available online for this figure.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Generated, Western Blot, Chromatin Immunoprecipitation, Immunoprecipitation, Negative Control, Real-time Polymerase Chain Reaction

    Identification of STAT 3‐associated pathways in prostate cancer Overview of transcriptomic (top) and proteomic (bottom) analyses. Overexpression analysis of enriched KEGG pathways of significantly differentially expressed genes between low STAT3 versus high STAT3 groups in TCGA PRAD. Dotted line: adj. P ‐value = −log10(0.05).

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Identification of STAT 3‐associated pathways in prostate cancer Overview of transcriptomic (top) and proteomic (bottom) analyses. Overexpression analysis of enriched KEGG pathways of significantly differentially expressed genes between low STAT3 versus high STAT3 groups in TCGA PRAD. Dotted line: adj. P ‐value = −log10(0.05).

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Over Expression

    Kaplan–Meier curves of additional candidate genes Time to BCR in months for STAT3 (A), HIF‐1α (B), c‐MYC (C), CNOT1 (D), IDH2 (E), and SDHB (F) in the MSKCC PCa GSE21032 data set. Groups were generated by a median split. P ‐values were estimated by log‐rank test and adjusted with Benjamini–Hochberg method. + = censored.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Kaplan–Meier curves of additional candidate genes Time to BCR in months for STAT3 (A), HIF‐1α (B), c‐MYC (C), CNOT1 (D), IDH2 (E), and SDHB (F) in the MSKCC PCa GSE21032 data set. Groups were generated by a median split. P ‐values were estimated by log‐rank test and adjusted with Benjamini–Hochberg method. + = censored.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Generated

    Correlation of STAT 3 with STAT 3 target, ribosome, and OXPHOS signatures Pearson correlation of STAT3 log counts per million (cpm) with tyrosine‐phosphorylated (pY) STAT3 Reverse Phase Protein Array (RPPA) protein levels (left, z ‐scored), “AZARE STAT3 TARGETS” (middle), and “STAT3 TARGETS UP” gene signatures (right) in TCGA PRAD. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. P . adj., adjusted P ‐value. Pearson correlation of STAT3 log cpm with KEGG “OXPHOS” gene signature in three prostate cancer data sets. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. NCI, The Netherlands Cancer Institute; VPC, The Vancouver Prostate Center; RAS, The Russian Academy of Science. Pearson correlation of STAT3 log cpm with KEGG “Ribosome” gene signature in three prostate cancer data sets. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. Source data are available online for this figure.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Correlation of STAT 3 with STAT 3 target, ribosome, and OXPHOS signatures Pearson correlation of STAT3 log counts per million (cpm) with tyrosine‐phosphorylated (pY) STAT3 Reverse Phase Protein Array (RPPA) protein levels (left, z ‐scored), “AZARE STAT3 TARGETS” (middle), and “STAT3 TARGETS UP” gene signatures (right) in TCGA PRAD. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. P . adj., adjusted P ‐value. Pearson correlation of STAT3 log cpm with KEGG “OXPHOS” gene signature in three prostate cancer data sets. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. NCI, The Netherlands Cancer Institute; VPC, The Vancouver Prostate Center; RAS, The Russian Academy of Science. Pearson correlation of STAT3 log cpm with KEGG “Ribosome” gene signature in three prostate cancer data sets. Gene signatures were assessed with ssGSEA. P ‐values were adjusted with Benjamini–Hochberg method. Source data are available online for this figure.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Protein Array

    Proteomics show TCA / OXPHOS up‐regulation in low STAT 3 human FFPE PC a STAT3 immunohistochemistry staining of low STAT3 and high STAT3 PCa samples. Red arrows indicate transformed PCa glands; black arrows indicate pre‐transformed normal prostate glands. Scale bar = 100 μm. #, sample‐IDs. Significantly enriched KEGG pathways in low STAT3 versus high STAT3 groups. Dotted line: adj. P ‐value = ‐log10(0.05). Significantly enriched hallmark gene sets in low STAT3 versus high STAT3 groups. Dotted line: adj. P ‐value = ‐log10(0.05). Red = up‐regulated; blue = down‐regulated. Simplified scheme of the TCA cycle and associated metabolic pathways. TCA cycle, tricarboxylic acid cycle; PDC, pyruvate dehydrogenase complex; PDK, pyruvate dehydrogenase kinase. Graphic adapted from Gray et al , 2014 and Jang et al , 2013 .

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Proteomics show TCA / OXPHOS up‐regulation in low STAT 3 human FFPE PC a STAT3 immunohistochemistry staining of low STAT3 and high STAT3 PCa samples. Red arrows indicate transformed PCa glands; black arrows indicate pre‐transformed normal prostate glands. Scale bar = 100 μm. #, sample‐IDs. Significantly enriched KEGG pathways in low STAT3 versus high STAT3 groups. Dotted line: adj. P ‐value = ‐log10(0.05). Significantly enriched hallmark gene sets in low STAT3 versus high STAT3 groups. Dotted line: adj. P ‐value = ‐log10(0.05). Red = up‐regulated; blue = down‐regulated. Simplified scheme of the TCA cycle and associated metabolic pathways. TCA cycle, tricarboxylic acid cycle; PDC, pyruvate dehydrogenase complex; PDK, pyruvate dehydrogenase kinase. Graphic adapted from Gray et al , 2014 and Jang et al , 2013 .

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques: Formalin-fixed Paraffin-Embedded, Immunohistochemistry, Staining, Transformation Assay

    Scheme of up‐regulated KEGG pathways in low STAT 3 TCGA samples KEGG representation of the ribosome in low STAT3 versus high STAT3 TCGA samples after testing for signaling KEGG pathways. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation. KEGG representation of oxidative phosphorylation in low STAT3 versus high STAT3 TCGA samples after testing for metabolic KEGG pathways. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation.

    Journal: Molecular Systems Biology

    Article Title: STAT3‐dependent analysis reveals PDK4 as independent predictor of recurrence in prostate cancer

    doi: 10.15252/msb.20199247

    Figure Lengend Snippet: Scheme of up‐regulated KEGG pathways in low STAT 3 TCGA samples KEGG representation of the ribosome in low STAT3 versus high STAT3 TCGA samples after testing for signaling KEGG pathways. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation. KEGG representation of oxidative phosphorylation in low STAT3 versus high STAT3 TCGA samples after testing for metabolic KEGG pathways. Color bar indicates z ‐scored deregulation of genes. Blue, down‐regulation; red, up‐regulation.

    Article Snippet: The following antibodies were used: anti‐IDH2 (Cat# 15932‐1‐AP, Proteintech), anti‐SDHB (Cat# ab14714, Abcam), and anti‐STAT3 (Cat# sc‐7179, Santa Cruz Biotechnology and Cat# 9139, Cell Signaling Technology).

    Techniques:

    α-Lipoic acid prevents zinc deficiency-induced impaired STAT1 and STAT3 nuclear import. Nuclear fraction and cytosolic fraction were isolated from IMR-32 cells incubated for 24 h in control (C), or zinc depleted (1.5Zn) medium with or without supplementation with 0.5mM α-lipoic acid (LA). Western blots for: (A) STAT1 and hnRNP as housekeeping protein in the nuclear fraction (top left), and STAT1 and β-actin as housekeeping protein in the cytosolic fraction (top right), and band quantification expressed as the ratio of total STAT1 nuclear/cytosolic (bottom); (B) STAT3 and hnRNP in the nuclear fraction (top left) and STAT3 and β-actin in the cytosolic fraction (top right), and band quantification expressed as the ratio total STAT3 nuclear/cytosolic fractions (bottom). Results were normalized to controls values, and shown as means±S.E.M. of three independent experiments. *, ** Significantly different compared to C groups ( P

    Journal: Redox Biology

    Article Title: Zinc deficiency affects the STAT1/3 signaling pathways in part through redox-mediated mechanisms

    doi: 10.1016/j.redox.2016.12.027

    Figure Lengend Snippet: α-Lipoic acid prevents zinc deficiency-induced impaired STAT1 and STAT3 nuclear import. Nuclear fraction and cytosolic fraction were isolated from IMR-32 cells incubated for 24 h in control (C), or zinc depleted (1.5Zn) medium with or without supplementation with 0.5mM α-lipoic acid (LA). Western blots for: (A) STAT1 and hnRNP as housekeeping protein in the nuclear fraction (top left), and STAT1 and β-actin as housekeeping protein in the cytosolic fraction (top right), and band quantification expressed as the ratio of total STAT1 nuclear/cytosolic (bottom); (B) STAT3 and hnRNP in the nuclear fraction (top left) and STAT3 and β-actin in the cytosolic fraction (top right), and band quantification expressed as the ratio total STAT3 nuclear/cytosolic fractions (bottom). Results were normalized to controls values, and shown as means±S.E.M. of three independent experiments. *, ** Significantly different compared to C groups ( P

    Article Snippet: Antibodies for STAT1, STAT3, β-actin, α-tubulin, β-tubulin and heterogeneous nuclear ribonucleoprotein A1 (hnRNP), and the oligonucleotides containing the consensus sequence for STAT1 and STAT3 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Isolation, Incubation, Western Blot

    Zinc deficiency affects total protein content and phosphorylation patterns of STAT1 and STAT3 in IMR-32 cell nuclear fractions. Nuclear fractions were isolated from IMR-32 cells incubated for 24 h in control (C) or 1.5Zn medium. STAT1 and STAT3 content and phosphorylations were measured by Western blot. (A) Representative images for pY 701 -STAT1, pS 727 -STAT1, STAT1, and hnRNP as the nuclear housekeeping protein (top), and their quantification expressed as pY 701 -STAT1/STAT1, pS 727 -STAT1/STAT1 and STAT1/hnRNP (bottom). (B) Representative images for pY 705 -STAT3, pS 727 -STAT3, STAT3, and hnRNP (top), and their quantification expressed as pY 705 -STAT3/STAT3, pS 727 -STAT3/STAT3, and STAT3/hnRNP (bottom). Results were normalized to control values (dotted lined) and shown as means±S.E.M. of four independent experiments. *, ** Significantly different compared to C groups ( P

    Journal: Redox Biology

    Article Title: Zinc deficiency affects the STAT1/3 signaling pathways in part through redox-mediated mechanisms

    doi: 10.1016/j.redox.2016.12.027

    Figure Lengend Snippet: Zinc deficiency affects total protein content and phosphorylation patterns of STAT1 and STAT3 in IMR-32 cell nuclear fractions. Nuclear fractions were isolated from IMR-32 cells incubated for 24 h in control (C) or 1.5Zn medium. STAT1 and STAT3 content and phosphorylations were measured by Western blot. (A) Representative images for pY 701 -STAT1, pS 727 -STAT1, STAT1, and hnRNP as the nuclear housekeeping protein (top), and their quantification expressed as pY 701 -STAT1/STAT1, pS 727 -STAT1/STAT1 and STAT1/hnRNP (bottom). (B) Representative images for pY 705 -STAT3, pS 727 -STAT3, STAT3, and hnRNP (top), and their quantification expressed as pY 705 -STAT3/STAT3, pS 727 -STAT3/STAT3, and STAT3/hnRNP (bottom). Results were normalized to control values (dotted lined) and shown as means±S.E.M. of four independent experiments. *, ** Significantly different compared to C groups ( P

    Article Snippet: Antibodies for STAT1, STAT3, β-actin, α-tubulin, β-tubulin and heterogeneous nuclear ribonucleoprotein A1 (hnRNP), and the oligonucleotides containing the consensus sequence for STAT1 and STAT3 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Isolation, Incubation, Western Blot

    Gestational MZD affects phosphorylations of STAT1 and STAT3 in E19 brain total fractions. From gestation day 0 through 19, dams were fed ad libitum control (C) or MZD diets. STAT1 and STAT3 contents and phosphorylations in E19 brain total homogenates were measured by Western blot. (A) Representative images for pY 701 -STAT1, pS 727 -STAT1, STAT1, and β-actin (top); and band quantifications expressed as pY 701 -STAT1/STAT1, pS 727 -STAT1/STAT1 and total STAT1/β-actin (bottom). (B) Representative images for pY 705 -STAT3, pS 727 -STAT3, STAT3, and β-actin (top), and band quantifications expressed as pY 705 -STAT3/STAT3, pS 727 -STAT3/STAT3 and STAT3/β-actin (bottom). Results were normalized to control values and are shown as means±S.E.M. of 6 animals per group. *, ** Significantly different compared to C groups ( P

    Journal: Redox Biology

    Article Title: Zinc deficiency affects the STAT1/3 signaling pathways in part through redox-mediated mechanisms

    doi: 10.1016/j.redox.2016.12.027

    Figure Lengend Snippet: Gestational MZD affects phosphorylations of STAT1 and STAT3 in E19 brain total fractions. From gestation day 0 through 19, dams were fed ad libitum control (C) or MZD diets. STAT1 and STAT3 contents and phosphorylations in E19 brain total homogenates were measured by Western blot. (A) Representative images for pY 701 -STAT1, pS 727 -STAT1, STAT1, and β-actin (top); and band quantifications expressed as pY 701 -STAT1/STAT1, pS 727 -STAT1/STAT1 and total STAT1/β-actin (bottom). (B) Representative images for pY 705 -STAT3, pS 727 -STAT3, STAT3, and β-actin (top), and band quantifications expressed as pY 705 -STAT3/STAT3, pS 727 -STAT3/STAT3 and STAT3/β-actin (bottom). Results were normalized to control values and are shown as means±S.E.M. of 6 animals per group. *, ** Significantly different compared to C groups ( P

    Article Snippet: Antibodies for STAT1, STAT3, β-actin, α-tubulin, β-tubulin and heterogeneous nuclear ribonucleoprotein A1 (hnRNP), and the oligonucleotides containing the consensus sequence for STAT1 and STAT3 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Western Blot

    Zinc deficiency affects total protein content and phosphorylation patterns of STAT1 and STAT3 in IMR-32 total fractions. Total cell fractions were isolated from IMR-32 cells incubated for 24 h in control (C) or zinc -depleted (1.5 μM zinc (1.5Zn)) medium. STAT1 and STAT3 contents and phosphorylations were measured by Western blot. (A) Representative images for pY 701 -STAT1, pS 727 -STAT1, STAT1, and β-tubulin as the housekeeping protein (top), and their quantification expressed as pY 701 -STAT1/STAT1, pS 727 -STAT1/STAT1 and STAT1/β-tubulin (bottom). (B) Representative images for pY 705 -STAT3, pS 727 -STAT3, STAT3, and β-tubulin (top), and their quantification expressed as pY 705 -STAT3/STAT3, pS 727 -STAT3/STAT3, and STAT3/β-tubulin (bottom). Results were normalized to control values (dotted lined) and shown as means±S.E.M. of four independent experiments. *, ** Significantly different compared to C groups ( P

    Journal: Redox Biology

    Article Title: Zinc deficiency affects the STAT1/3 signaling pathways in part through redox-mediated mechanisms

    doi: 10.1016/j.redox.2016.12.027

    Figure Lengend Snippet: Zinc deficiency affects total protein content and phosphorylation patterns of STAT1 and STAT3 in IMR-32 total fractions. Total cell fractions were isolated from IMR-32 cells incubated for 24 h in control (C) or zinc -depleted (1.5 μM zinc (1.5Zn)) medium. STAT1 and STAT3 contents and phosphorylations were measured by Western blot. (A) Representative images for pY 701 -STAT1, pS 727 -STAT1, STAT1, and β-tubulin as the housekeeping protein (top), and their quantification expressed as pY 701 -STAT1/STAT1, pS 727 -STAT1/STAT1 and STAT1/β-tubulin (bottom). (B) Representative images for pY 705 -STAT3, pS 727 -STAT3, STAT3, and β-tubulin (top), and their quantification expressed as pY 705 -STAT3/STAT3, pS 727 -STAT3/STAT3, and STAT3/β-tubulin (bottom). Results were normalized to control values (dotted lined) and shown as means±S.E.M. of four independent experiments. *, ** Significantly different compared to C groups ( P

    Article Snippet: Antibodies for STAT1, STAT3, β-actin, α-tubulin, β-tubulin and heterogeneous nuclear ribonucleoprotein A1 (hnRNP), and the oligonucleotides containing the consensus sequence for STAT1 and STAT3 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Isolation, Incubation, Western Blot

    Gestational MZD affects DNA binding and content of STAT1 and STAT3 in nuclear fractions isolated from E19 brains. From gestation day 0 through 19, dams were fed ad libitum control (C) or MZD diets. Nuclear and cytosolic fractions were prepared from E19 brains as described in the Materials and Methods section. (A) EMSA for STAT1 and STAT3 in nuclear and cytosolic fractions. To determine the specificity of each transcription factor-DNA complex, a control nuclear fraction was incubated in the presence of a 100-fold molar excess of unlabeled oligonucleotide containing the consensus sequence for either the specific (S) or an unspecific (U) transcription factor before the binding assay. Bands were quantified and the ratio nuclear/cytosolic DNA binding (NF/CF) was calculated. (B) Western blots for pY 701 -STAT1, pS 727 -STAT1, and STAT1 (left); and pY 705 -STAT3, pS 727 -STAT3, and STAT3 (right); and hnRNP as the nuclear housekeeping protein. After quantification, results were expressed as pY 701 -STAT1/STAT1, pS 727 -STAT1/STAT1 and STAT1/hnRNP (bottom left), or pY 705 -STAT3/STAT3, pS 727 -STAT3/STAT3, and STAT3/hnRNP (bottom right). Results were normalized to control values and are shown as means±S.E.M. of 6 animals per group. *, ** Significantly different compared to C groups ( P

    Journal: Redox Biology

    Article Title: Zinc deficiency affects the STAT1/3 signaling pathways in part through redox-mediated mechanisms

    doi: 10.1016/j.redox.2016.12.027

    Figure Lengend Snippet: Gestational MZD affects DNA binding and content of STAT1 and STAT3 in nuclear fractions isolated from E19 brains. From gestation day 0 through 19, dams were fed ad libitum control (C) or MZD diets. Nuclear and cytosolic fractions were prepared from E19 brains as described in the Materials and Methods section. (A) EMSA for STAT1 and STAT3 in nuclear and cytosolic fractions. To determine the specificity of each transcription factor-DNA complex, a control nuclear fraction was incubated in the presence of a 100-fold molar excess of unlabeled oligonucleotide containing the consensus sequence for either the specific (S) or an unspecific (U) transcription factor before the binding assay. Bands were quantified and the ratio nuclear/cytosolic DNA binding (NF/CF) was calculated. (B) Western blots for pY 701 -STAT1, pS 727 -STAT1, and STAT1 (left); and pY 705 -STAT3, pS 727 -STAT3, and STAT3 (right); and hnRNP as the nuclear housekeeping protein. After quantification, results were expressed as pY 701 -STAT1/STAT1, pS 727 -STAT1/STAT1 and STAT1/hnRNP (bottom left), or pY 705 -STAT3/STAT3, pS 727 -STAT3/STAT3, and STAT3/hnRNP (bottom right). Results were normalized to control values and are shown as means±S.E.M. of 6 animals per group. *, ** Significantly different compared to C groups ( P

    Article Snippet: Antibodies for STAT1, STAT3, β-actin, α-tubulin, β-tubulin and heterogeneous nuclear ribonucleoprotein A1 (hnRNP), and the oligonucleotides containing the consensus sequence for STAT1 and STAT3 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Binding Assay, Isolation, Incubation, Sequencing, Western Blot

    Zinc deficiency affects nuclear STAT1- and STAT3-DNA binding, and transactivation of STAT1 and STAT3-dependent genes in IMR-32 cells . Nuclear and total cell fractions were isolated after incubating IMR-32 cells for 24 h in control medium (C), or in chelated medium containing 1.5 μM zinc (1.5Zn), or 15 μM zinc (15Zn). (A) Representative image of an EMSA for STAT1 and STAT3 in nuclear fractions (top). A control nuclear fraction was incubated in the presence of a 100-fold molar excess of unlabeled oligonucleotide containing the consensus sequence for aspecific (S) transcription factor before the binding assay. Bands were quantified, results expressed as the ratio nuclear/total fraction binding (NF/TF) for STAT1 (white bars) and STAT3 (grey bars), and normalized to control values. Results are shown as means±S.E.M. of three independent experiments. (B) Transactivation of STAT1- and STAT3-driven luciferase was measured as described in Materials and Methods in cells incubated for 24 h in control, 1.5Zn or 15Zn medium. Data are expressed as the ratio luciferase activity/β-galactosidase activity. Results are shown as means±S.E.M of three independent experiments. *Significantly different compared to the C groups ( P

    Journal: Redox Biology

    Article Title: Zinc deficiency affects the STAT1/3 signaling pathways in part through redox-mediated mechanisms

    doi: 10.1016/j.redox.2016.12.027

    Figure Lengend Snippet: Zinc deficiency affects nuclear STAT1- and STAT3-DNA binding, and transactivation of STAT1 and STAT3-dependent genes in IMR-32 cells . Nuclear and total cell fractions were isolated after incubating IMR-32 cells for 24 h in control medium (C), or in chelated medium containing 1.5 μM zinc (1.5Zn), or 15 μM zinc (15Zn). (A) Representative image of an EMSA for STAT1 and STAT3 in nuclear fractions (top). A control nuclear fraction was incubated in the presence of a 100-fold molar excess of unlabeled oligonucleotide containing the consensus sequence for aspecific (S) transcription factor before the binding assay. Bands were quantified, results expressed as the ratio nuclear/total fraction binding (NF/TF) for STAT1 (white bars) and STAT3 (grey bars), and normalized to control values. Results are shown as means±S.E.M. of three independent experiments. (B) Transactivation of STAT1- and STAT3-driven luciferase was measured as described in Materials and Methods in cells incubated for 24 h in control, 1.5Zn or 15Zn medium. Data are expressed as the ratio luciferase activity/β-galactosidase activity. Results are shown as means±S.E.M of three independent experiments. *Significantly different compared to the C groups ( P

    Article Snippet: Antibodies for STAT1, STAT3, β-actin, α-tubulin, β-tubulin and heterogeneous nuclear ribonucleoprotein A1 (hnRNP), and the oligonucleotides containing the consensus sequence for STAT1 and STAT3 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Binding Assay, Isolation, Incubation, Sequencing, Luciferase, Activity Assay

    α-Lipoic acid differentially affects STAT1 and STAT3 phosphorylation in zinc deficient IMR-32 cells. Total fractions were prepared from IMR-32 cells incubated for 24 h in control (C), or zinc deficient (1.5Zn) medium with or without supplementation with 0.5mM α-lipoic acid (LA). STAT1 and STAT3 content and phosphorylation were measured by Western blot. (A) Representative images for pY 701 -STAT1, pS 727 -STAT1, STAT1, and β-actin and their quantification expressed as pY 701 -STAT1/STAT1, pS 727 -STAT1/STAT1, and STAT1/β-actin (bottom). (B) Representative images for pY 705 -STAT3, STAT3 and β-actin, and their quantification expressed as pY 705 -STAT3/STAT3, and STAT3/β-actin. Results were normalized to control values and shown as means±S.E.M. of four independent experiments. *, **, *** Significantly different compared to C groups ( P

    Journal: Redox Biology

    Article Title: Zinc deficiency affects the STAT1/3 signaling pathways in part through redox-mediated mechanisms

    doi: 10.1016/j.redox.2016.12.027

    Figure Lengend Snippet: α-Lipoic acid differentially affects STAT1 and STAT3 phosphorylation in zinc deficient IMR-32 cells. Total fractions were prepared from IMR-32 cells incubated for 24 h in control (C), or zinc deficient (1.5Zn) medium with or without supplementation with 0.5mM α-lipoic acid (LA). STAT1 and STAT3 content and phosphorylation were measured by Western blot. (A) Representative images for pY 701 -STAT1, pS 727 -STAT1, STAT1, and β-actin and their quantification expressed as pY 701 -STAT1/STAT1, pS 727 -STAT1/STAT1, and STAT1/β-actin (bottom). (B) Representative images for pY 705 -STAT3, STAT3 and β-actin, and their quantification expressed as pY 705 -STAT3/STAT3, and STAT3/β-actin. Results were normalized to control values and shown as means±S.E.M. of four independent experiments. *, **, *** Significantly different compared to C groups ( P

    Article Snippet: Antibodies for STAT1, STAT3, β-actin, α-tubulin, β-tubulin and heterogeneous nuclear ribonucleoprotein A1 (hnRNP), and the oligonucleotides containing the consensus sequence for STAT1 and STAT3 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Incubation, Western Blot

    STAT1 and STAT3 require a functional cytoskeleton for nuclear translocation in IMR-32 cells. Nuclear fractions and total fractions were prepared from IMR-32 cells incubated for 24 h in control medium (C) with or without the addition of 0.5 μM vinblastine (Vb), 0.5 μM colchicine (Col), or 0.5 μM cytochalasin D (Cyt D). (A) EMSA for STAT1 in nuclear and total fractions (top), and band quantifications (bottom). (B) EMSA for STAT3 in nuclear and total fractions (top), and band quantifications (bottom). Results were expressed as the ratio nuclear/total fractions of DNA binding (NF/TF) and normalized to their control levels. Results are shown as means±S.E.M. of three independent experiments. *Significantly different compared to C without inhibitors ( P

    Journal: Redox Biology

    Article Title: Zinc deficiency affects the STAT1/3 signaling pathways in part through redox-mediated mechanisms

    doi: 10.1016/j.redox.2016.12.027

    Figure Lengend Snippet: STAT1 and STAT3 require a functional cytoskeleton for nuclear translocation in IMR-32 cells. Nuclear fractions and total fractions were prepared from IMR-32 cells incubated for 24 h in control medium (C) with or without the addition of 0.5 μM vinblastine (Vb), 0.5 μM colchicine (Col), or 0.5 μM cytochalasin D (Cyt D). (A) EMSA for STAT1 in nuclear and total fractions (top), and band quantifications (bottom). (B) EMSA for STAT3 in nuclear and total fractions (top), and band quantifications (bottom). Results were expressed as the ratio nuclear/total fractions of DNA binding (NF/TF) and normalized to their control levels. Results are shown as means±S.E.M. of three independent experiments. *Significantly different compared to C without inhibitors ( P

    Article Snippet: Antibodies for STAT1, STAT3, β-actin, α-tubulin, β-tubulin and heterogeneous nuclear ribonucleoprotein A1 (hnRNP), and the oligonucleotides containing the consensus sequence for STAT1 and STAT3 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).

    Techniques: Functional Assay, Translocation Assay, Incubation, Binding Assay

    MPA induces Stat3 binding to the high-affinity mutant of the SIE from the human c- fos promoter. C4HD cells were treated for 15 min at 37°C with MPA or MPA-RU486 or were left untreated growing in ChFCS. Twenty micrograms of protein from nuclear extracts was incubated for 20 min at room temperature with 1 ng of 32 P-labeled double-stranded DNA containing the high-affinity mutant of the SIE from the human c- fos promoter (5′GTGCATTTCCCGTAAATCTTGTCTACA3′) (m67) used as a probe and analyzed by EMSA. The specificity of the Stat3-DNA complexes is shown by competition with 25- and 100-fold mass excesses unlabeled m67 oligonucleotide and by the lack of competition with a 100-fold mass excess of mutant m67 (100xm67 mut). The right panel shows a supershift analysis that was performed by including either anti-Stat3 or anti-Stat1 antibodies. An equivalent amount of preimmune rabbit serum was used as a control in the EMSA reaction mixture (NRS [normal rabbit serum]). This experiment was repeated six times with similar results. wt, wild type.

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: MPA induces Stat3 binding to the high-affinity mutant of the SIE from the human c- fos promoter. C4HD cells were treated for 15 min at 37°C with MPA or MPA-RU486 or were left untreated growing in ChFCS. Twenty micrograms of protein from nuclear extracts was incubated for 20 min at room temperature with 1 ng of 32 P-labeled double-stranded DNA containing the high-affinity mutant of the SIE from the human c- fos promoter (5′GTGCATTTCCCGTAAATCTTGTCTACA3′) (m67) used as a probe and analyzed by EMSA. The specificity of the Stat3-DNA complexes is shown by competition with 25- and 100-fold mass excesses unlabeled m67 oligonucleotide and by the lack of competition with a 100-fold mass excess of mutant m67 (100xm67 mut). The right panel shows a supershift analysis that was performed by including either anti-Stat3 or anti-Stat1 antibodies. An equivalent amount of preimmune rabbit serum was used as a control in the EMSA reaction mixture (NRS [normal rabbit serum]). This experiment was repeated six times with similar results. wt, wild type.

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Binding Assay, Mutagenesis, Incubation, Labeling

    MPA induces Stat3 nuclear translocation. C4HD cells were treated with 10 nM MPA for the time indicated or were pretreated with PP2 before MPA stimulation. Nuclear (nuc) and cytosolic (cyt) fractions were prepared, and 30 μg of protein from cell extracts was analyzed by Western blot assay for Stat3 expression level. Membranes were then stripped and hybridized with an anti-p85 PI-3K subunit antibody (middle) or an anti-retinoblastoma (Rb) antibody (bottom) in order to control cellular fractionation efficiency. W, Western blot assay.

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: MPA induces Stat3 nuclear translocation. C4HD cells were treated with 10 nM MPA for the time indicated or were pretreated with PP2 before MPA stimulation. Nuclear (nuc) and cytosolic (cyt) fractions were prepared, and 30 μg of protein from cell extracts was analyzed by Western blot assay for Stat3 expression level. Membranes were then stripped and hybridized with an anti-p85 PI-3K subunit antibody (middle) or an anti-retinoblastoma (Rb) antibody (bottom) in order to control cellular fractionation efficiency. W, Western blot assay.

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Translocation Assay, Western Blot, Expressing, Cell Fractionation

    MPA induces tyrosine phosphorylation by Stat3, Jak1, and Jak2. Cultures of C4HD (A) and T47D (B) cells were treated with 10 nM MPA or MPA-10 nM RU486 for the indicated times. Fifty micrograms of protein from cell lysates was electrophoresed, and Western blot assays were performed with antiphosphotyrosine 705 Stat3, antiphosphotyrosine 701 Stat1, antiphosphotyrosine 1022/1023 Jak1, and antiphosphotyrosine 1007/1008 Jak2 antibodies. Membranes were then stripped and hybridized with anti-Stat3, -Stat1, -Jak1, and -Jak2 antibodies. This experiment was repeated six times for C4HD cells and three times for T47D cells with similar results. LM3 (C) or T47D-Y (D) cells were transfected with PRB or with the empty pSG5 plasmidor remained untreated. Cells were then stimulated for 5 min with MPA or pretreated with RU486 before MPA stimulation. LM3 cells were also treated with heregulin for 10 min. Fifty micrograms of protein from cell lysates was electrophoresed, and Western blot assays were performed with antiphosphotyrosine 705 Stat3 (upper parts of panels C and D). Membranes were then stripped and hybridized with anti-Stat3 (middle panes of parts C and D) and anti-PR (lower parts of panels C and D) antibodies. This experiment was repeated three times with similar results. W, Western blot assay.

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: MPA induces tyrosine phosphorylation by Stat3, Jak1, and Jak2. Cultures of C4HD (A) and T47D (B) cells were treated with 10 nM MPA or MPA-10 nM RU486 for the indicated times. Fifty micrograms of protein from cell lysates was electrophoresed, and Western blot assays were performed with antiphosphotyrosine 705 Stat3, antiphosphotyrosine 701 Stat1, antiphosphotyrosine 1022/1023 Jak1, and antiphosphotyrosine 1007/1008 Jak2 antibodies. Membranes were then stripped and hybridized with anti-Stat3, -Stat1, -Jak1, and -Jak2 antibodies. This experiment was repeated six times for C4HD cells and three times for T47D cells with similar results. LM3 (C) or T47D-Y (D) cells were transfected with PRB or with the empty pSG5 plasmidor remained untreated. Cells were then stimulated for 5 min with MPA or pretreated with RU486 before MPA stimulation. LM3 cells were also treated with heregulin for 10 min. Fifty micrograms of protein from cell lysates was electrophoresed, and Western blot assays were performed with antiphosphotyrosine 705 Stat3 (upper parts of panels C and D). Membranes were then stripped and hybridized with anti-Stat3 (middle panes of parts C and D) and anti-PR (lower parts of panels C and D) antibodies. This experiment was repeated three times with similar results. W, Western blot assay.

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Western Blot, Transfection

    Stat3 is involved in MPA-induced proliferation of C4HD cells. (A) C4HD cells were transiently transfected with 2 μg DN Stat3 expression vector, Stat3Y705-F, with 2 μg constitutively activated Stat3 mutant, Stat3-C, or with 2 μg empty pRc/CMV vector, as a control, for 48 h. Cells were treated with MPA for another 48 h or remained untreated and were then stained with PI and analyzed for cell cycle distribution by flow cytometry. The percentages of total cells in the cell cycle phases are indicated. (B) C4HD cells were transiently transfected with 2 μg DN Stat3 expression vector or with 2 μg empty pRc/CMV vector, as a control, for 48 h. Cells were treated as described for panel A, and cell surface Annexin V binding was measured by flow cytometry. (C) Fifty micrograms of protein from lysates of cells transfected with Stat3Y705-F, Stat3-C, and empty pRc/CMV plasmids and from nontransfected cells, treated with MPA for 48 h or left untreated, was electrophoresed, and Western blot assays were performed with an anti Bcl-x L antibody (upper part). Membrane was then stripped and hybridized with an antiactin antibody (lower part). (D) Fifty micrograms of protein from lysates of cells treated as described for panel C and stimulated or not with MPA for 5 min was electrophoresed, and Western blot assays were performed with an anti-FLAG M2 antibody (upper part). Membrane was then stripped and hybridized with an anti-Stat3 antibody (lower part). (E) Fifty micrograms of protein from C4HD cells transfected with 2 μg Stat3Y705-F vector or with empty pRc/CMV plasmid and subsequently left untreated treated or with MPA for 5 min was electrophoresed, and Western blot assays were performed with antiphosphotyrosine Stat3 antibody (upper part). Membranes were then stripped and hybridized with anti-Stat3 antibodies (lower part). (F) Fifty micrograms of protein from C4HD cells transfected with 2 μg Stat3Y705-F vector and then treated with MPA for 5 min or left untreated was electrophoresed, and Western blot assays were performed with antiphosphotyrosine 701 Stat1 antibody (upper part). Membrane was then stripped and hybridized with anti-Stat1 antibody (lower part). Experiments described in panels A to F were repeated three times with similar results. W, Western blot assay. (G) C4HD cells were transiently transfected with 2 μg/well of the m67-Luc reporter plasmid and with 1 μg/well of a CMV-βgal expression vector as an internal control. In the indicated lanes, C4HD cells were cotransfected with either Stat3Y705-F or Stat3-C plasmid. The total amount of transfected DNA was standardized by adding the empty vector. After transfection, cells were treated when indicated with MPA for 48 h and were then harvested and lysed. Luciferase and β-galactosidase activities were measured as described in Materials and Methods. Results are presented as n -fold induction of luciferase activity with respect to cells growing in ChFCS. Data shown represent the mean of two independent experiments ± the standard error of the mean. For b versus a and c versus b, P

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: Stat3 is involved in MPA-induced proliferation of C4HD cells. (A) C4HD cells were transiently transfected with 2 μg DN Stat3 expression vector, Stat3Y705-F, with 2 μg constitutively activated Stat3 mutant, Stat3-C, or with 2 μg empty pRc/CMV vector, as a control, for 48 h. Cells were treated with MPA for another 48 h or remained untreated and were then stained with PI and analyzed for cell cycle distribution by flow cytometry. The percentages of total cells in the cell cycle phases are indicated. (B) C4HD cells were transiently transfected with 2 μg DN Stat3 expression vector or with 2 μg empty pRc/CMV vector, as a control, for 48 h. Cells were treated as described for panel A, and cell surface Annexin V binding was measured by flow cytometry. (C) Fifty micrograms of protein from lysates of cells transfected with Stat3Y705-F, Stat3-C, and empty pRc/CMV plasmids and from nontransfected cells, treated with MPA for 48 h or left untreated, was electrophoresed, and Western blot assays were performed with an anti Bcl-x L antibody (upper part). Membrane was then stripped and hybridized with an antiactin antibody (lower part). (D) Fifty micrograms of protein from lysates of cells treated as described for panel C and stimulated or not with MPA for 5 min was electrophoresed, and Western blot assays were performed with an anti-FLAG M2 antibody (upper part). Membrane was then stripped and hybridized with an anti-Stat3 antibody (lower part). (E) Fifty micrograms of protein from C4HD cells transfected with 2 μg Stat3Y705-F vector or with empty pRc/CMV plasmid and subsequently left untreated treated or with MPA for 5 min was electrophoresed, and Western blot assays were performed with antiphosphotyrosine Stat3 antibody (upper part). Membranes were then stripped and hybridized with anti-Stat3 antibodies (lower part). (F) Fifty micrograms of protein from C4HD cells transfected with 2 μg Stat3Y705-F vector and then treated with MPA for 5 min or left untreated was electrophoresed, and Western blot assays were performed with antiphosphotyrosine 701 Stat1 antibody (upper part). Membrane was then stripped and hybridized with anti-Stat1 antibody (lower part). Experiments described in panels A to F were repeated three times with similar results. W, Western blot assay. (G) C4HD cells were transiently transfected with 2 μg/well of the m67-Luc reporter plasmid and with 1 μg/well of a CMV-βgal expression vector as an internal control. In the indicated lanes, C4HD cells were cotransfected with either Stat3Y705-F or Stat3-C plasmid. The total amount of transfected DNA was standardized by adding the empty vector. After transfection, cells were treated when indicated with MPA for 48 h and were then harvested and lysed. Luciferase and β-galactosidase activities were measured as described in Materials and Methods. Results are presented as n -fold induction of luciferase activity with respect to cells growing in ChFCS. Data shown represent the mean of two independent experiments ± the standard error of the mean. For b versus a and c versus b, P

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Transfection, Expressing, Plasmid Preparation, Mutagenesis, Staining, Flow Cytometry, Cytometry, Binding Assay, Western Blot, Luciferase, Activity Assay

    MPA up-regulates Stat3 protein expression. Primary cultures of C4HD cells were treated for 48 h in medium with ChFCS supplemented with 10 nM MPA or MPA-10 nM RU486. Fifty micrograms of protein from cell lysates was electrophoresed and immunoblotted for Stat3 and Stat1. A Western blot assay using an antiactin antibody was carried out using identical protein lysates as a control for the specificity of the effect of MPA. This is a representative experiment of a total of four in which the standard error of the mean was within 10%. W, Western blot assay.

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: MPA up-regulates Stat3 protein expression. Primary cultures of C4HD cells were treated for 48 h in medium with ChFCS supplemented with 10 nM MPA or MPA-10 nM RU486. Fifty micrograms of protein from cell lysates was electrophoresed and immunoblotted for Stat3 and Stat1. A Western blot assay using an antiactin antibody was carried out using identical protein lysates as a control for the specificity of the effect of MPA. This is a representative experiment of a total of four in which the standard error of the mean was within 10%. W, Western blot assay.

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Expressing, Western Blot

    Jak1 and Jak2 are involved in MPA-induced Stat3 phosphorylation. C4HD cells were transiently transfected with 2 μg of DN Jak1 or DN Jak2 vector and then treated with MPA for 5 min or left untreated. Fifty micrograms of protein from cell lysates was electrophoresed, and Western blot assays were performed with antiphosphotyrosine Jak1 (A, upper part) or antiphosphotyrosine Jak2 (B, upper part) antibodies. Membranes were then stripped and hybridized with anti-Jak1 (A, lower part) and anti-Jak2 (B, lower part) antibodies. (C) Fifty micrograms of protein from cells transfected with the DN Jak1 (left part) or the DN Jak2 (right part) vector and subsequentlytreated with MPA for 5 min or left untreated was electrophoresed, and Western blot assays were performed with antiphosphotyrosine Stat3 (upper parts). Membranes were then stripped and hybridized with anti-Stat3 (lower parts) antibodies. (D) C4HD cells were treated with MPA for the indicated times or preincubated with the selective Src family kinase inhibitor PP2 or RU486 for 90 min and then treated with MPA. Fifty micrograms of protein from cell lysates was electrophoresed and immunoblotted with an antiphosphotyrosine c-Src antibody (upper part). Membrane was then stripped and hybridized with anti-c-Src antibody (lower part). (E) C4HD cells were preincubated with the selective Src family kinase inhibitor PP2 for 90 min and then treated with MPA for 5 min. Fifty micrograms of protein from cell lysates was electrophoresed and immunoblotted with antiphosphotyrosine Stat3, antiphosphotyrosine Jak1, and antiphosphotyrosine Jak2 antibodies. Membranes were then stripped and hybridized with anti-Stat3, anti-Jak1, and anti-Jak2 antibodies, respectively. These experiments were repeated three times with similar results. W, Western blot assay.

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: Jak1 and Jak2 are involved in MPA-induced Stat3 phosphorylation. C4HD cells were transiently transfected with 2 μg of DN Jak1 or DN Jak2 vector and then treated with MPA for 5 min or left untreated. Fifty micrograms of protein from cell lysates was electrophoresed, and Western blot assays were performed with antiphosphotyrosine Jak1 (A, upper part) or antiphosphotyrosine Jak2 (B, upper part) antibodies. Membranes were then stripped and hybridized with anti-Jak1 (A, lower part) and anti-Jak2 (B, lower part) antibodies. (C) Fifty micrograms of protein from cells transfected with the DN Jak1 (left part) or the DN Jak2 (right part) vector and subsequentlytreated with MPA for 5 min or left untreated was electrophoresed, and Western blot assays were performed with antiphosphotyrosine Stat3 (upper parts). Membranes were then stripped and hybridized with anti-Stat3 (lower parts) antibodies. (D) C4HD cells were treated with MPA for the indicated times or preincubated with the selective Src family kinase inhibitor PP2 or RU486 for 90 min and then treated with MPA. Fifty micrograms of protein from cell lysates was electrophoresed and immunoblotted with an antiphosphotyrosine c-Src antibody (upper part). Membrane was then stripped and hybridized with anti-c-Src antibody (lower part). (E) C4HD cells were preincubated with the selective Src family kinase inhibitor PP2 for 90 min and then treated with MPA for 5 min. Fifty micrograms of protein from cell lysates was electrophoresed and immunoblotted with antiphosphotyrosine Stat3, antiphosphotyrosine Jak1, and antiphosphotyrosine Jak2 antibodies. Membranes were then stripped and hybridized with anti-Stat3, anti-Jak1, and anti-Jak2 antibodies, respectively. These experiments were repeated three times with similar results. W, Western blot assay.

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Transfection, Plasmid Preparation, Western Blot

    MPA induces association of Stat3 with PR. (A) C4HD cells were treated with 10 nM MPA for the indicated times or preincubated with PP2 before MPA treatment for 5 min, and PR was immunoprecipitated from 500 μg of protein extracts. As a control, lysates were also immunoprecipitated with normal mouse serum (NMS). Immunocomplexes were subjected to SDS-PAGE and analyzed by Western blotting with an anti-Stat3 antibody (upper part). Twenty micrograms of protein from cell extracts was directly immunoblotted with the Stat3 antibody (last lane, upper part). Identical aliquots of each immunoprecipitate were subjected to immunoblot analysis with anti-PR antibody to verify that nearly equal amounts of immunoprecipitated proteins were loaded (lower part). (B) Protein lysates (500 μg) from cells treated as indicated in panel A were immunoprecipitated with an anti-Stat3 antibody or with normal rabbit serum (NRS). Immunocomplexes were subjected to SDS-PAGE and analyzed by Western blotting with an anti-PR antibody (upper part). Twenty micrograms of protein from cell extracts was directly immunoblotted with the PR antibody (last lane, upper part). Identical aliquots of each immunoprecipitate were subjected to immunoblot analysis with anti-Stat3 antibody to verify that nearly equal amounts of immunoprecipitated proteins were loaded (lower part). This is a representative experiment out of a total of three. W, Western blot assay; IP, immunoprecipitation.

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: MPA induces association of Stat3 with PR. (A) C4HD cells were treated with 10 nM MPA for the indicated times or preincubated with PP2 before MPA treatment for 5 min, and PR was immunoprecipitated from 500 μg of protein extracts. As a control, lysates were also immunoprecipitated with normal mouse serum (NMS). Immunocomplexes were subjected to SDS-PAGE and analyzed by Western blotting with an anti-Stat3 antibody (upper part). Twenty micrograms of protein from cell extracts was directly immunoblotted with the Stat3 antibody (last lane, upper part). Identical aliquots of each immunoprecipitate were subjected to immunoblot analysis with anti-PR antibody to verify that nearly equal amounts of immunoprecipitated proteins were loaded (lower part). (B) Protein lysates (500 μg) from cells treated as indicated in panel A were immunoprecipitated with an anti-Stat3 antibody or with normal rabbit serum (NRS). Immunocomplexes were subjected to SDS-PAGE and analyzed by Western blotting with an anti-PR antibody (upper part). Twenty micrograms of protein from cell extracts was directly immunoblotted with the PR antibody (last lane, upper part). Identical aliquots of each immunoprecipitate were subjected to immunoblot analysis with anti-Stat3 antibody to verify that nearly equal amounts of immunoprecipitated proteins were loaded (lower part). This is a representative experiment out of a total of three. W, Western blot assay; IP, immunoprecipitation.

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Immunoprecipitation, SDS Page, Western Blot

    MPA induces Stat3 transcriptional activation. C4HD (A) and T47D (B) cells were transiently transfected with 2 μg/well of a luciferase reporter plasmid containing four copies of the m67 high-affinity binding site and with 1 μg/well of a CMV-βgal expression vector as an internal control. In the indicated lanes, C4HD cells were cotransfected with the DN Jak1 and DN Jak2 expression vectors or pretreated with PP2. Cells were also transfected with a pTATA-Luc reporter lacking the m67 insertion. The total amount of transfected DNA was standardized by adding the empty vector. After transfection, cells were treated with MPA and MPA-RU486 at 37°C for 48 h or left untreated growing in ChFCS. C4HD cells were then harvested and lysed. Luciferase and β-galactosidase activities were measured as described in Materials and Methods. Results are presented as n -fold induction of luciferase activity with respect to cells growing in ChFCS. The data shown represent the mean of six independent experiments ± the standard error of the mean. For b versus a and c versus b, P

    Journal: Molecular and Cellular Biology

    Article Title: Progestins Induce Transcriptional Activation of Signal Transducer and Activator of Transcription 3 (Stat3) via a Jak- and Src-Dependent Mechanism in Breast Cancer Cells

    doi: 10.1128/MCB.25.12.4826-4840.2005

    Figure Lengend Snippet: MPA induces Stat3 transcriptional activation. C4HD (A) and T47D (B) cells were transiently transfected with 2 μg/well of a luciferase reporter plasmid containing four copies of the m67 high-affinity binding site and with 1 μg/well of a CMV-βgal expression vector as an internal control. In the indicated lanes, C4HD cells were cotransfected with the DN Jak1 and DN Jak2 expression vectors or pretreated with PP2. Cells were also transfected with a pTATA-Luc reporter lacking the m67 insertion. The total amount of transfected DNA was standardized by adding the empty vector. After transfection, cells were treated with MPA and MPA-RU486 at 37°C for 48 h or left untreated growing in ChFCS. C4HD cells were then harvested and lysed. Luciferase and β-galactosidase activities were measured as described in Materials and Methods. Results are presented as n -fold induction of luciferase activity with respect to cells growing in ChFCS. The data shown represent the mean of six independent experiments ± the standard error of the mean. For b versus a and c versus b, P

    Article Snippet: Proteins were electroblotted onto nitrocellulose and probed with an anti-Stat3 antibody (C-20; Santa Cruz).

    Techniques: Activation Assay, Transfection, Luciferase, Plasmid Preparation, Binding Assay, Expressing, Activity Assay

    Il6 activation contributes to activation of Stat3/Myc signaling in Pten Δ/Δ ; Trp53 Δ/Δ cells

    Journal: Cancer discovery

    Article Title: Myc drives Pten/p53-deficient proliferation and metastasis due to Il6-secretion and Akt-suppression via Phlpp2

    doi: 10.1158/2159-8290.CD-14-1113

    Figure Lengend Snippet: Il6 activation contributes to activation of Stat3/Myc signaling in Pten Δ/Δ ; Trp53 Δ/Δ cells

    Article Snippet: Antibodies used: beta-actin (1:3000, Sigma), pAkt(S473) (193H12, 1:2000, Cell Signaling), total Akt (40D4, 1:300, Cell Signaling), p44/p42 (1:1000, Cell Signaling), Myc (14721-1, 1:1000, Epitomics), pStat3(Tyr705) (9145, 1:2000, Cell Signaling), Pcna (Santa Cruz, 1:6000), Pten (6H2.1, Cascade Bioscience, 1:1000), total Stat3 (9139, 1:2000, Cell Signaling), and p16 (M-156, Santa Cruz, 1:1000), p21 (sc-397, 1:200, Santa Cruz), p53 (IMX25, 1:500, Leica).

    Techniques: Activation Assay

    Stat3/Myc signaling is downstream of Il6 signaling in Pten Δ/Δ ; Trp53 Δ/Δ cells and is responsible for proliferation

    Journal: Cancer discovery

    Article Title: Myc drives Pten/p53-deficient proliferation and metastasis due to Il6-secretion and Akt-suppression via Phlpp2

    doi: 10.1158/2159-8290.CD-14-1113

    Figure Lengend Snippet: Stat3/Myc signaling is downstream of Il6 signaling in Pten Δ/Δ ; Trp53 Δ/Δ cells and is responsible for proliferation

    Article Snippet: Antibodies used: beta-actin (1:3000, Sigma), pAkt(S473) (193H12, 1:2000, Cell Signaling), total Akt (40D4, 1:300, Cell Signaling), p44/p42 (1:1000, Cell Signaling), Myc (14721-1, 1:1000, Epitomics), pStat3(Tyr705) (9145, 1:2000, Cell Signaling), Pcna (Santa Cruz, 1:6000), Pten (6H2.1, Cascade Bioscience, 1:1000), total Stat3 (9139, 1:2000, Cell Signaling), and p16 (M-156, Santa Cruz, 1:1000), p21 (sc-397, 1:200, Santa Cruz), p53 (IMX25, 1:500, Leica).

    Techniques:

    Secretion of Il6 and Stat3/Myc signaling is specific to the in vivo Pten pc−/− ; Trp53 pc−/− genotype

    Journal: Cancer discovery

    Article Title: Myc drives Pten/p53-deficient proliferation and metastasis due to Il6-secretion and Akt-suppression via Phlpp2

    doi: 10.1158/2159-8290.CD-14-1113

    Figure Lengend Snippet: Secretion of Il6 and Stat3/Myc signaling is specific to the in vivo Pten pc−/− ; Trp53 pc−/− genotype

    Article Snippet: Antibodies used: beta-actin (1:3000, Sigma), pAkt(S473) (193H12, 1:2000, Cell Signaling), total Akt (40D4, 1:300, Cell Signaling), p44/p42 (1:1000, Cell Signaling), Myc (14721-1, 1:1000, Epitomics), pStat3(Tyr705) (9145, 1:2000, Cell Signaling), Pcna (Santa Cruz, 1:6000), Pten (6H2.1, Cascade Bioscience, 1:1000), total Stat3 (9139, 1:2000, Cell Signaling), and p16 (M-156, Santa Cruz, 1:1000), p21 (sc-397, 1:200, Santa Cruz), p53 (IMX25, 1:500, Leica).

    Techniques: In Vivo

    Western blot analyses showing phosphorylation of a STAT3 Tyr705 , b AKT Ser473 and c ERK1/2 Thr202/Tyr204 in human vascular endothelial cells treated with IL-6 alone (50 ng/ml) or in combination with sIL-6R (100 ng/ml). One representative blot containing the phosphorylated protein, total protein and β-tubulin (loading control) is shown for each pathway (left column). The signals from the phosphorylated proteins and total proteins are first normalized to β-tubulin, and the ratio of the phosphorylated proteins and the total proteins are calculated. The graphs show arbitrary units (a.u., control is set to 1) compiled from 3 independent experiments presented as mean ± SEM for each pathway (right column). * p

    Journal: Cell Communication and Signaling : CCS

    Article Title: Activation of the JAK/STAT3 and PI3K/AKT pathways are crucial for IL-6 trans-signaling-mediated pro-inflammatory response in human vascular endothelial cells

    doi: 10.1186/s12964-018-0268-4

    Figure Lengend Snippet: Western blot analyses showing phosphorylation of a STAT3 Tyr705 , b AKT Ser473 and c ERK1/2 Thr202/Tyr204 in human vascular endothelial cells treated with IL-6 alone (50 ng/ml) or in combination with sIL-6R (100 ng/ml). One representative blot containing the phosphorylated protein, total protein and β-tubulin (loading control) is shown for each pathway (left column). The signals from the phosphorylated proteins and total proteins are first normalized to β-tubulin, and the ratio of the phosphorylated proteins and the total proteins are calculated. The graphs show arbitrary units (a.u., control is set to 1) compiled from 3 independent experiments presented as mean ± SEM for each pathway (right column). * p

    Article Snippet: For detecting signaling proteins, membranes were incubated with the following primary antibodies: anti-phospho-Stat3Tyr705 antibody (Cell Signaling Technology, USA, #9131; 1:1000 dilution), anti-phospho-AKTSer473 antibody (Cell Signaling Technology, USA, #4060; 1:2000 dilution), anti-phospho-ERK1/2 antibody (Cell Signaling Technology, USA, #9106; 1:2000 dilution), anti-STAT3 antibody (Cell Signaling Technology, USA, #4904; 1:2000 dilution), anti-AKT antibody (Cell Signaling Technology, USA, #2920; 1:2000 dilution), anti-ERK1/2 antibody (Cell Signaling Technology, USA, #4695; 1:1000 dilution), anti-phospho IκBαSer32 antibody (Cell Signaling Technology, USA, #2859; 1:1000 dilution), anti-phospho-NFκB p65Ser536 antibody (Cell Signaling Technology, USA, #3033; 1:1000 dilution), anti-NFκB p65 antibody (Cell Signaling Technology, USA, #6956; 1:1000 dilution), anti-IκBα antibody (Santa Cruz Biotechnology, USA, SC-371; 1:750 dilution), anti-p52 antibody (Millipore, USA, #05–361; 1:1000 dilution), and anti-β-Tubulin antibody (Millipore, USA, #05–661; 1:2000 dilution).

    Techniques: Western Blot

    Effects of rh-TSG-6 and TSG-6 siRNA treatments on SOCS3/STAT3 axis. a Effect of exogenous TSG-6 on STAT3 pathway expression was evaluated by western blot and the relative IL-6, IL-10, SOCS3, p-STAT3, and STAT3 densities were quantificationally evaluated. b The representative western blot analysis of STAT3 axis in SAH rats accepted intracerebroventricular injection of siRNA as indicated and quantification of the level of IL-6, IL-10, SOCS3, p-STAT3 and STAT3 after deficiency of TSG-6. Data are expressed as the mean ± SD from six rats. ** P

    Journal: Journal of Neuroinflammation

    Article Title: TSG-6 attenuates inflammation-induced brain injury via modulation of microglial polarization in SAH rats through the SOCS3/STAT3 pathway

    doi: 10.1186/s12974-018-1279-1

    Figure Lengend Snippet: Effects of rh-TSG-6 and TSG-6 siRNA treatments on SOCS3/STAT3 axis. a Effect of exogenous TSG-6 on STAT3 pathway expression was evaluated by western blot and the relative IL-6, IL-10, SOCS3, p-STAT3, and STAT3 densities were quantificationally evaluated. b The representative western blot analysis of STAT3 axis in SAH rats accepted intracerebroventricular injection of siRNA as indicated and quantification of the level of IL-6, IL-10, SOCS3, p-STAT3 and STAT3 after deficiency of TSG-6. Data are expressed as the mean ± SD from six rats. ** P

    Article Snippet: The following primary antibodies were used for WB: mouse anti-TSG-6 (Santa Cruz Biotechnology; 1:800), rabbit anti-STAT3 (Cell Signaling Technology; 1:2000), rabbit anti-phosphorylated STAT3 at Tyr705 (Cell Signaling Technology; 1:1000), rabbit anti-SOCS3 (Abcam; 1:1000), mouse anti-CD163 (AbD Serotec; 1:500), rabbit anti-CD86 (ProteinTech; 1:600), rabbit anti-IL-6 (PeproTech; 1:800), rabbit anti-IL-10 (ProteinTech; 1:600), and rabbit anti-β-actin (Cell Signaling Technology; 1:1000).

    Techniques: Expressing, Western Blot, Injection

    The effects of rh-TSG-6 on phosphorylation of Stat3 and cellular location of p-STAT3. The phosphorylation of STAT3 was assessed by immunofluorescent double-labeling. Immunoreactivity for p-STAT3 is attenuated at 24 h in the SAH + rh-TSG-6 group, as compared with the SAH + vehicle group. TSG-6 deficiency increased the expression of p-STAT3 and more translocation from the cytosol to the nucleus occurs was observed. Scale bar = 20 μm

    Journal: Journal of Neuroinflammation

    Article Title: TSG-6 attenuates inflammation-induced brain injury via modulation of microglial polarization in SAH rats through the SOCS3/STAT3 pathway

    doi: 10.1186/s12974-018-1279-1

    Figure Lengend Snippet: The effects of rh-TSG-6 on phosphorylation of Stat3 and cellular location of p-STAT3. The phosphorylation of STAT3 was assessed by immunofluorescent double-labeling. Immunoreactivity for p-STAT3 is attenuated at 24 h in the SAH + rh-TSG-6 group, as compared with the SAH + vehicle group. TSG-6 deficiency increased the expression of p-STAT3 and more translocation from the cytosol to the nucleus occurs was observed. Scale bar = 20 μm

    Article Snippet: The following primary antibodies were used for WB: mouse anti-TSG-6 (Santa Cruz Biotechnology; 1:800), rabbit anti-STAT3 (Cell Signaling Technology; 1:2000), rabbit anti-phosphorylated STAT3 at Tyr705 (Cell Signaling Technology; 1:1000), rabbit anti-SOCS3 (Abcam; 1:1000), mouse anti-CD163 (AbD Serotec; 1:500), rabbit anti-CD86 (ProteinTech; 1:600), rabbit anti-IL-6 (PeproTech; 1:800), rabbit anti-IL-10 (ProteinTech; 1:600), and rabbit anti-β-actin (Cell Signaling Technology; 1:1000).

    Techniques: Labeling, Expressing, Translocation Assay

    Uck2 regulated MMPs expression and Stat3 activation according to Western blotting analysis. Notes: The results of Western blotting analysis are shown by raw photos and densitometry analysis. β-actin was used as the housekeeping gene to normalize expression levels in the densitometry analysis by ImageJ software (1.48 version; NIH, Bethesda, MD, USA). ( A ) Raw photos and densitometry analysis: stable expression of Uck2 in Bel-7402 cells increased the protein levels of MMP2 and MMP9. ( B ) Raw photos and densitometry analysis: stable expression of Uck2 in Bel-7402 cells increased the protein level of N-cadherin and decreased the protein level of E-cadherin. ( C ) Raw photos and densitometry analysis: transient downregulation of Uck2 by siRNA in Sk-hep-1 cells decreased the protein levels of MMP2, MMP9, and N-cadherin and increased the protein level of E-cadherin. ( D ) Raw photos and densitometry analysis: exploration of the oncogenic pathways regulated by the Uck2 gene. Stable expression of Uck2 in Bel-7402 cells increased the protein level of p-Stat3. ( E ) Raw photos and densitometry analysis: the stable expression of Uck2 in SMMC-7721 cells increased the protein level of p-Stat3. ( F1 and F2 ) Raw photos and densitometry analysis: transient downregulation of Uck2 by siRNA in HCCLM6 cells and Sk-hep-1 cells decreased the protein level of p-Stat3. The experiments were repeated three times, and the results are shown as the mean ± SD; * P

    Journal: Cancer Management and Research

    Article Title: Uridine-cytidine kinase 2 promotes metastasis of hepatocellular carcinoma cells via the Stat3 pathway

    doi: 10.2147/CMAR.S182859

    Figure Lengend Snippet: Uck2 regulated MMPs expression and Stat3 activation according to Western blotting analysis. Notes: The results of Western blotting analysis are shown by raw photos and densitometry analysis. β-actin was used as the housekeeping gene to normalize expression levels in the densitometry analysis by ImageJ software (1.48 version; NIH, Bethesda, MD, USA). ( A ) Raw photos and densitometry analysis: stable expression of Uck2 in Bel-7402 cells increased the protein levels of MMP2 and MMP9. ( B ) Raw photos and densitometry analysis: stable expression of Uck2 in Bel-7402 cells increased the protein level of N-cadherin and decreased the protein level of E-cadherin. ( C ) Raw photos and densitometry analysis: transient downregulation of Uck2 by siRNA in Sk-hep-1 cells decreased the protein levels of MMP2, MMP9, and N-cadherin and increased the protein level of E-cadherin. ( D ) Raw photos and densitometry analysis: exploration of the oncogenic pathways regulated by the Uck2 gene. Stable expression of Uck2 in Bel-7402 cells increased the protein level of p-Stat3. ( E ) Raw photos and densitometry analysis: the stable expression of Uck2 in SMMC-7721 cells increased the protein level of p-Stat3. ( F1 and F2 ) Raw photos and densitometry analysis: transient downregulation of Uck2 by siRNA in HCCLM6 cells and Sk-hep-1 cells decreased the protein level of p-Stat3. The experiments were repeated three times, and the results are shown as the mean ± SD; * P

    Article Snippet: The following anti-Homo sapiens primary antibodies were used for Western blotting: mouse anti-β-actin (1:5,000 dilution, Proteintech, 60008-1-Ig); rabbit anti-Uck2 (1:1,000 dilution, Proteintech, 10511-1-AP); rabbit anti-MMP2 (1:1,000 dilution, ImmunoWay, YT2798); rabbit anti-MMP7 (1:1,000 dilution, Immuno-Way, YT2663); rabbit anti-MMP9 (1:1,000 dilution, Immu-noWay, YT1892); rabbit anti-E-cadherin (1:500 dilution, Abcam, ab15148); rabbit anti-N-cadherin (1:1,000 dilution, Abcam, ab76057); mouse anti-Viomentin (1:1,000 dilution, Abcam, ab8978); rabbit anti-fibronectin (1:1,000 dilution, Abcam, ab32419); rabbit anti-p44/42 MAPK (Erk1/2) (1:2,000 dilution, CST, #4695); rabbit anti-phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (1:2,000 dilution, CST, #4370); mouse anti-Stat3 (1:2,000 dilution, CST, #9139); rabbit anti-phospho-Stat3 (Try705) (1:2,000 dilution, CST, #9145); mouse anti-Akt (1:2,000 dilution, CST, #2920); and rabbit anti-phospho-Akt (Ser473) (1:2,000 dilution, CST, #4060).

    Techniques: Expressing, Activation Assay, Western Blot, Software

    Uck2 regulated the expression of MMPs and EMT progression via the Stat3 signaling pathway. Notes: ( A ) Raw photos and densitometry analysis of Western blotting analysis: treatment with the Stat3 inhibitor WP1066 neutralized the upregulation of MMP2 and MMP9 and reversed the EMT progression caused by the overexpression of Uck2 in Bel-7402 cells. ( B and C ) After treatment with a Stat3 inhibitor (3 µM WP1066) for 24 hours, Bel-7402/Uck2 cells showed decreased migration ability and decreased invasion ability by a transwell assay. β-actin was used as the housekeeping gene to normalize expression levels in the densitometry analysis by ImageJ software (1.48 version; NIH, Bethesda, MD, USA). The experiments were repeated three times, and the results are shown as the mean ± SD; * P

    Journal: Cancer Management and Research

    Article Title: Uridine-cytidine kinase 2 promotes metastasis of hepatocellular carcinoma cells via the Stat3 pathway

    doi: 10.2147/CMAR.S182859

    Figure Lengend Snippet: Uck2 regulated the expression of MMPs and EMT progression via the Stat3 signaling pathway. Notes: ( A ) Raw photos and densitometry analysis of Western blotting analysis: treatment with the Stat3 inhibitor WP1066 neutralized the upregulation of MMP2 and MMP9 and reversed the EMT progression caused by the overexpression of Uck2 in Bel-7402 cells. ( B and C ) After treatment with a Stat3 inhibitor (3 µM WP1066) for 24 hours, Bel-7402/Uck2 cells showed decreased migration ability and decreased invasion ability by a transwell assay. β-actin was used as the housekeeping gene to normalize expression levels in the densitometry analysis by ImageJ software (1.48 version; NIH, Bethesda, MD, USA). The experiments were repeated three times, and the results are shown as the mean ± SD; * P

    Article Snippet: The following anti-Homo sapiens primary antibodies were used for Western blotting: mouse anti-β-actin (1:5,000 dilution, Proteintech, 60008-1-Ig); rabbit anti-Uck2 (1:1,000 dilution, Proteintech, 10511-1-AP); rabbit anti-MMP2 (1:1,000 dilution, ImmunoWay, YT2798); rabbit anti-MMP7 (1:1,000 dilution, Immuno-Way, YT2663); rabbit anti-MMP9 (1:1,000 dilution, Immu-noWay, YT1892); rabbit anti-E-cadherin (1:500 dilution, Abcam, ab15148); rabbit anti-N-cadherin (1:1,000 dilution, Abcam, ab76057); mouse anti-Viomentin (1:1,000 dilution, Abcam, ab8978); rabbit anti-fibronectin (1:1,000 dilution, Abcam, ab32419); rabbit anti-p44/42 MAPK (Erk1/2) (1:2,000 dilution, CST, #4695); rabbit anti-phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (1:2,000 dilution, CST, #4370); mouse anti-Stat3 (1:2,000 dilution, CST, #9139); rabbit anti-phospho-Stat3 (Try705) (1:2,000 dilution, CST, #9145); mouse anti-Akt (1:2,000 dilution, CST, #2920); and rabbit anti-phospho-Akt (Ser473) (1:2,000 dilution, CST, #4060).

    Techniques: Expressing, Western Blot, Over Expression, Migration, Transwell Assay, Software

    Nuclear translocation of STAT3 was suppressed by ursolic acid in HCT116 cells. The localization of STAT3 (red) and 4,6-diamidino-2-phenylindole (DAPI) (blue) in HCT116 cells. HCT116 cells were treated by ursolic acid for 24 h. STAT3 was probed with primary antibody and labelled using secondary antibody conjugated. Scale bar = 40 μm. Corresponding zoomed images of the STAT3, DAPI, and Merge (indicated by the yellow box).

    Journal: International Journal of Molecular Sciences

    Article Title: Ursolic Acid Induces Apoptosis in Colorectal Cancer Cells Partially via Upregulation of MicroRNA-4500 and Inhibition of JAK2/STAT3 Phosphorylation

    doi: 10.3390/ijms20010114

    Figure Lengend Snippet: Nuclear translocation of STAT3 was suppressed by ursolic acid in HCT116 cells. The localization of STAT3 (red) and 4,6-diamidino-2-phenylindole (DAPI) (blue) in HCT116 cells. HCT116 cells were treated by ursolic acid for 24 h. STAT3 was probed with primary antibody and labelled using secondary antibody conjugated. Scale bar = 40 μm. Corresponding zoomed images of the STAT3, DAPI, and Merge (indicated by the yellow box).

    Article Snippet: Fixed cells were incubated with the specific primary antibody of STAT3 antibody (Cell signaling, Boston, MA, USA) overnight at 4 °C.

    Techniques: Translocation Assay

    Down-regulation of miR-4500 attenuated cytotoxic and anti-proliferative effects of ursolic acid in HCT116 and HT29 cells. ( a ) Matched sequence (yellow box) of with mature miR-4500 and the STAT3. ( b ) Effect of ursolic acid on mRNA level of miR-4500 in HCT117 cells by qRT-PCR. ( c ) Effect of miR-4500 inhibitor on the cytotoxicity of ursolic acid in HCT116 and HT29 cells. The miR-4500 inhibitor and control plasmids were transfected into HCT116 and HT29 cells for 48 h and then exposed to ursolic acid for 24 h. Cell viability was determined by MTT assay. ( d ) Effect of miR-4500 on antiproliferative effect of ursolic acid by colony formation in HCT116 and HT29 cells for 2 weeks and colony formation assay was performed. ** p

    Journal: International Journal of Molecular Sciences

    Article Title: Ursolic Acid Induces Apoptosis in Colorectal Cancer Cells Partially via Upregulation of MicroRNA-4500 and Inhibition of JAK2/STAT3 Phosphorylation

    doi: 10.3390/ijms20010114

    Figure Lengend Snippet: Down-regulation of miR-4500 attenuated cytotoxic and anti-proliferative effects of ursolic acid in HCT116 and HT29 cells. ( a ) Matched sequence (yellow box) of with mature miR-4500 and the STAT3. ( b ) Effect of ursolic acid on mRNA level of miR-4500 in HCT117 cells by qRT-PCR. ( c ) Effect of miR-4500 inhibitor on the cytotoxicity of ursolic acid in HCT116 and HT29 cells. The miR-4500 inhibitor and control plasmids were transfected into HCT116 and HT29 cells for 48 h and then exposed to ursolic acid for 24 h. Cell viability was determined by MTT assay. ( d ) Effect of miR-4500 on antiproliferative effect of ursolic acid by colony formation in HCT116 and HT29 cells for 2 weeks and colony formation assay was performed. ** p

    Article Snippet: Fixed cells were incubated with the specific primary antibody of STAT3 antibody (Cell signaling, Boston, MA, USA) overnight at 4 °C.

    Techniques: Sequencing, Quantitative RT-PCR, Transfection, MTT Assay, Colony Assay

    Critical role of miR-4500 in apoptotic effect of ursolic acid in HCT116 cells. ( a ) Effect of miR-4500 inhibitor on the number of TUNEL positive cells in ursolic acid treated HCT116 cells by TUNEL assay. Scale bar = 40 μm. Bar graphs showed quantification of TUNEL-positive cells (%). ( b ) Effect of miR-4500 inhibitor on PARP, p-STAT3, and STAT3 in ursolic acid treated HCT116 cells. ( c ). * p

    Journal: International Journal of Molecular Sciences

    Article Title: Ursolic Acid Induces Apoptosis in Colorectal Cancer Cells Partially via Upregulation of MicroRNA-4500 and Inhibition of JAK2/STAT3 Phosphorylation

    doi: 10.3390/ijms20010114

    Figure Lengend Snippet: Critical role of miR-4500 in apoptotic effect of ursolic acid in HCT116 cells. ( a ) Effect of miR-4500 inhibitor on the number of TUNEL positive cells in ursolic acid treated HCT116 cells by TUNEL assay. Scale bar = 40 μm. Bar graphs showed quantification of TUNEL-positive cells (%). ( b ) Effect of miR-4500 inhibitor on PARP, p-STAT3, and STAT3 in ursolic acid treated HCT116 cells. ( c ). * p

    Article Snippet: Fixed cells were incubated with the specific primary antibody of STAT3 antibody (Cell signaling, Boston, MA, USA) overnight at 4 °C.

    Techniques: TUNEL Assay

    FEZF1-AS1 promotes STAT3 expression. ( A ) FEZF1-AS1 knockdown inhibited the protein levels of p-STAT3 and STAT3 in ES2 cells. ( B ) Expression correlation between STAT3 and FEZF1-AS1 was determined by qRT-PCR in ovarian cancer tissues. * P

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    Article Title: Long Noncoding RNA FEZF1-AS1 Promotes Proliferation and Inhibits Apoptosis in Ovarian Cancer by Activation of JAK-STAT3 Pathway

    doi: 10.12659/MSM.911194

    Figure Lengend Snippet: FEZF1-AS1 promotes STAT3 expression. ( A ) FEZF1-AS1 knockdown inhibited the protein levels of p-STAT3 and STAT3 in ES2 cells. ( B ) Expression correlation between STAT3 and FEZF1-AS1 was determined by qRT-PCR in ovarian cancer tissues. * P

    Article Snippet: Then, the membranes were blocked with 5% nonfat milk and incubated with primary antibody against STAT3 (1: 2000, CST, #12460S), p-STAT3 (1: 2000, CST, #9145S) or GAPDH (1: 1,000; cat. no. sc-293335).

    Techniques: Expressing, Quantitative RT-PCR

    STAT3 knockdown suppresses ovarian cancer cell proliferation and induced apoptosis. ( A ) Western blot result indicated that STAT3 was effectively downregulated in ES2 cells transfected with siSTAT3. ( B ) CCK8 assays showed that STAT3 knockdown inhibited ES2 cell proliferation. ( C ) Cell cycle distribution was determined by FACS in ES2 cells transfected with siSTAT3 or control siRNA (NC). ( D ) STAT3 knockdown significantly promoted ES2 cell apoptosis. Cells were stained with Annexin V/PI. * P

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    Article Title: Long Noncoding RNA FEZF1-AS1 Promotes Proliferation and Inhibits Apoptosis in Ovarian Cancer by Activation of JAK-STAT3 Pathway

    doi: 10.12659/MSM.911194

    Figure Lengend Snippet: STAT3 knockdown suppresses ovarian cancer cell proliferation and induced apoptosis. ( A ) Western blot result indicated that STAT3 was effectively downregulated in ES2 cells transfected with siSTAT3. ( B ) CCK8 assays showed that STAT3 knockdown inhibited ES2 cell proliferation. ( C ) Cell cycle distribution was determined by FACS in ES2 cells transfected with siSTAT3 or control siRNA (NC). ( D ) STAT3 knockdown significantly promoted ES2 cell apoptosis. Cells were stained with Annexin V/PI. * P

    Article Snippet: Then, the membranes were blocked with 5% nonfat milk and incubated with primary antibody against STAT3 (1: 2000, CST, #12460S), p-STAT3 (1: 2000, CST, #9145S) or GAPDH (1: 1,000; cat. no. sc-293335).

    Techniques: Western Blot, Transfection, FACS, Staining

    The gemcitabine-erlotinib (E+G) combination group inhibits the activity of the JAK-STAT pathway, as well as the expression of downstream HIF-1α, cyclin D1 and p53. (A and B) The protein levels of phosphorylated STAT3 Tyr 705 (p-STAT3 Tyr 705 ), HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells were analyzed by western blotting, respectively. (C and D) The protein expression of p-STAT3 Tyr 705 , HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells was calculated using one-way ANOVA. *P

    Journal: Oncology Reports

    Article Title: Combination of gemcitabine and erlotinib inhibits recurrent pancreatic cancer growth in mice via the JAK-STAT pathway

    doi: 10.3892/or.2018.6198

    Figure Lengend Snippet: The gemcitabine-erlotinib (E+G) combination group inhibits the activity of the JAK-STAT pathway, as well as the expression of downstream HIF-1α, cyclin D1 and p53. (A and B) The protein levels of phosphorylated STAT3 Tyr 705 (p-STAT3 Tyr 705 ), HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells were analyzed by western blotting, respectively. (C and D) The protein expression of p-STAT3 Tyr 705 , HIF-1α, p53, cyclin D1 in BxPC-3 and PANC-1 cells was calculated using one-way ANOVA. *P

    Article Snippet: The following primary antibodies were used: anti-JAK1 (rabbit polyclonal; cat. no. AF5012), phospho-JAK1 (Tyr1022 ) (rabbit polyclonal; cat. no. AF2012), anti-JAK2 (rabbit polyclonal; cat. no. AF6022), phospho-JAK2 (Tyr221 ) (rabbit polyclonal; cat. no. AF3023), anti-JAK3 (mouse monoclonal; cat. no. BF0256), phospho-JAK3 (Tyr981 ) (rabbit polyclonal; cat. no. AF8160), phospho-STAT1 (Tyr701 ) (rabbit polyclonal; cat. no. AF3300) and anti-STAT1 (rabbit polyclonal; cat. no. AF6300) were all purchased from Affinity Biosciences (Cambridge, UK); anti-STAT3 (rabbit monoclonal; cat. no. ab76315), and anti-pSTAT3 Try705 (rabbit monoclonal; cat. no. ab68153) were obtained from Abcam (Cambridge, MA, USA); anti-HIF-1α (rabbit polyclonal; cat. no. BS3514) and anti-cyclin D1 (rabbit polyclonal; cat. no. BS6532) were purchased from Bioworld Technology Co., Ltd. (Nanjing, China); anti-p53 (rabbit, monoclonal; cat. no. 2527) was acquired from Cell Signaling Technology, Inc. (Danvers, MA, USA); while GAPDH was purchased from EarthOx Life Sciences (Millbrae, CA, USA).

    Techniques: Activity Assay, Expressing, Western Blot

    Schematic representation indicates that gemcitabine-erlotinib combination inhibits recurrent pancreatic tumor growth via JAK/STAT signaling. The gemcitabine-erlotinib combination significantly suppressed the phosphorylation levels of JAK1, JAK2, JAK3 as well as downstream STAT3 and STAT1 and eventually inhibited the growth of recurrent pancreatic tumors.

    Journal: Oncology Reports

    Article Title: Combination of gemcitabine and erlotinib inhibits recurrent pancreatic cancer growth in mice via the JAK-STAT pathway

    doi: 10.3892/or.2018.6198

    Figure Lengend Snippet: Schematic representation indicates that gemcitabine-erlotinib combination inhibits recurrent pancreatic tumor growth via JAK/STAT signaling. The gemcitabine-erlotinib combination significantly suppressed the phosphorylation levels of JAK1, JAK2, JAK3 as well as downstream STAT3 and STAT1 and eventually inhibited the growth of recurrent pancreatic tumors.

    Article Snippet: The following primary antibodies were used: anti-JAK1 (rabbit polyclonal; cat. no. AF5012), phospho-JAK1 (Tyr1022 ) (rabbit polyclonal; cat. no. AF2012), anti-JAK2 (rabbit polyclonal; cat. no. AF6022), phospho-JAK2 (Tyr221 ) (rabbit polyclonal; cat. no. AF3023), anti-JAK3 (mouse monoclonal; cat. no. BF0256), phospho-JAK3 (Tyr981 ) (rabbit polyclonal; cat. no. AF8160), phospho-STAT1 (Tyr701 ) (rabbit polyclonal; cat. no. AF3300) and anti-STAT1 (rabbit polyclonal; cat. no. AF6300) were all purchased from Affinity Biosciences (Cambridge, UK); anti-STAT3 (rabbit monoclonal; cat. no. ab76315), and anti-pSTAT3 Try705 (rabbit monoclonal; cat. no. ab68153) were obtained from Abcam (Cambridge, MA, USA); anti-HIF-1α (rabbit polyclonal; cat. no. BS3514) and anti-cyclin D1 (rabbit polyclonal; cat. no. BS6532) were purchased from Bioworld Technology Co., Ltd. (Nanjing, China); anti-p53 (rabbit, monoclonal; cat. no. 2527) was acquired from Cell Signaling Technology, Inc. (Danvers, MA, USA); while GAPDH was purchased from EarthOx Life Sciences (Millbrae, CA, USA).

    Techniques: