alpha-sarcoglycan Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    Vector Laboratories alpha sarcoglycan adhalin
    Broad sarcolemmal distribution of compensatory proteins upon Akt activation. Immunohistochemical analyses on transverse quadriceps sections in WT STG, WT DTG, mdx STG and mdx DTG mice. Sections were stained with antibodies to dystrophin (Dys), utrophin (Utrn), β1D integrin, <t>alpha-</t> and beta-dystroglycan (α-DG, β-DG), alpha-, beta- and <t>gamma-sarcoglycan</t> (α-SG, β-SG, γ-SG) and sarcospan (SSPN), and visualized using indirect immunofluorescence. Increased expression of the DGC and UGC in WT mice was observed upon constitutive activation of Akt1. Akt activation increased expression of only the UGC in mdx mice. An increase in utrophin levels was observed in mdx mice relative to levels in WT mice. In both WT mice and in mdx mice, Akt activation increased the expression of β1D integrin. Bar, 50 µm.
    Alpha Sarcoglycan Adhalin, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 89/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alpha sarcoglycan adhalin/product/Vector Laboratories
    Average 89 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    alpha sarcoglycan adhalin - by Bioz Stars, 2019-08
    89/100 stars
      Buy from Supplier

    83
    Novocastra sarcoglycans
    The biglycan core polypeptide is sufficient for binding to both immobilized and soluble α- and γ-sarcoglycan A. Purified recombinant biglycan core polypeptide (1μg) was separated by SDS-PAGE and either silver stained or blotted and probed as described above. α-Dystroglycan did not bind to this GAG-free biglycan. In contrast, both α- and γ- sarcoglycan bind to the biglycan core polypeptide. B. Co-immunoprecipitation of purified recombinant biglycan to recombinant <t>sarcoglycans.</t> His-tagged biglycan core polypeptide (0.5μg/ml) was incubated with the indicated 35 S-methionine-labeled, in vitro translated sarcoglycan for 1 hr followed by either anti-biglycan (a), anti-poly-His (b) or normal rabbit Ig (c). Immune complexes were then precipitated with protein G beads and analyzed by SDS-PAGE and autoradiography. Note that both α- and γ- sarcoglycan co-immunoprecipitate with biglycan, while β- and δ- sarcoglycan do not. The labelling of the various sarcoglycans is shown by direct autoradiography of SDS-PAGE-separated in vitro translated polypeptides (‘Input’).
    Sarcoglycans, supplied by Novocastra, used in various techniques. Bioz Stars score: 83/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sarcoglycans/product/Novocastra
    Average 83 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    sarcoglycans - by Bioz Stars, 2019-08
    83/100 stars
      Buy from Supplier

    76
    Santa Cruz Biotechnology alpha sarcoglycan
    Isolation of <t>alpha-sarcoglycan</t> + EVs from plasma using immunoaffinity capturing. Anti-alpha-sarcoglycan antibodies were conjugated to magnetic beads to isolate muscle EVs from plasma. Western blot analysis confirmed the presence of the exosomal marker Tsg101 in isolated EVs. Ponceau S Staining has been used as loading control (a). MicroRNA quantifications showed an increase in the miR-206/miR-16 ratio in the SGCA + sub-population of EVs (SGCA-Beads) compared to total (total plasma EVs) or uncaptured EVs (Supernatant). MiR-206 expression levels were normalized versus the endogenous reference miR-16 and expressed as -ΔCq (where ΔCq = Cq miR-206 -Cq miR-16 ) (b). Moreover, the quantification of miR-16 ratio in the SGCA + sub-population of EVs compared to total or uncaptured EVs shows that SGCA-conjugated beads retained about 2–5% of the total amount of EVs, miR-16 expression levels were normalized versus the spike-in reference cel-miR-39 and expressed as -ΔCq (where ΔCq = Cq miR-16 -Cq cel-miR-39 ) (c). Asterisks denote significant changes ( p
    Alpha Sarcoglycan, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 76/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alpha sarcoglycan/product/Santa Cruz Biotechnology
    Average 76 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    alpha sarcoglycan - by Bioz Stars, 2019-08
    76/100 stars
      Buy from Supplier

    76
    Leica Biosystems Nussloch Gmbh alpha sarcoglycan
    Analysis of patient material. Microscopical investigations (1A): (I) M. vastus lateralis biopsy of patient 1 showing a myopathic pattern with minor muscle fiber atrophy and hypertrophy as well as frequent nonsubsarcolemmal nuclei (arrows). Cryostat section, H E. Scale bar: 80 μm. (II) Low‐grade muscle fiber atrophy and solitary rimmed vacuole (arrow) in cryostat section of the rectus femoris muscle biopsy of patient 2. Cryostat section, H E. Scale bar: 50 μm. (III) M. quadriceps femoris biopsy of patient 3 showing minor atrophic as well as hypertrophic muscle fibers. Cryostat section, H E. Scale bar: 80 μm Electron microscopic studies (1B): (I) Subsarcolemmal membrane‐bound vacuoles, presumably corresponding to enlarged caveolae (arrows) in the muscle biopsy of patient 1. Scale bar: 250 nm. (II–VI) Patient 2; (II) subsarcolemmal membrane‐bound vacuoles (arrows) similar to the one depicted in Fig. 1 A. Scale bar: 200 nm. (III) Further abnormal membrane bound subsarcolemmal vacuoles as well as tubular structures (arrows). Scale bar: 2 μm. (IV) Large vacuole (asterisk) associated with a myonucleus. Scale bar: 4 μm. (V) Large (asterisk) and small (arrowheads) vacuoles in the vicinity of a myonucleus. Scale bar: 2 μm. (VI) Large vacuole containing autophagic material (arrows) associated with a deformed, possibly degenerating myonucleus. Arrowheads: Membranous material, presumably corresponding to a focal outfolding of the sarcoplasmic reticulum. Scale bar: 4 μm. (VII) Patient 3: subsarcolemmal membrane‐bound vacuoles (arrows). Scale bar: 800 nm. Immunoblots of myopathy‐associated proteins (1C): comparison of beta‐Spectrin, Calpain‐3, Lamin A/C, Myotilin, <t>alpha‐</t> and <t>gamma‐Sarcoglycan,</t> beta‐Dystroglycan and Emerin in G56S Caveolin‐3 patient and control muscle revealed no significant changes in protein abundances. Confirmation of proteome data via immunoblotting (1D): immunoblot analyses of HSP75, SNX1, CSTF2, Sec63, HNRA3, and Rab1A revealed same changes in protein abundances upon G56S Caveolin‐3 expression like in the G56S Caveolin‐3 in vitro model. Tubulin was used as loading control.
    Alpha Sarcoglycan, supplied by Leica Biosystems Nussloch Gmbh, used in various techniques. Bioz Stars score: 76/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alpha sarcoglycan/product/Leica Biosystems Nussloch Gmbh
    Average 76 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    alpha sarcoglycan - by Bioz Stars, 2019-08
    76/100 stars
      Buy from Supplier

    88
    Leica Biosystems mouse monoclonal beta sarcoglycan antibodies
    Morphological and molecular evidences of myocardial hypertrophy progression. (A) Immunohistochemical staining of <t>beta-</t> <t>sarcoglycan</t> allowing to detect outer membrane showing clear increase of cells size in transverse orientation by 10-weeks group compared to intact. (B) Increase in cell diameter (Dmin) illustrating progressive cardiomyocytes enlargement, and significant increase after 8 and 10 weeks of aortic banding performing. Nppa expression was upregulated in LV (C) and IVS (D) after 1, 2, 8, and 10 weeks of model duration compared to intact or sham-control groups. (E) Positive linear correlation was found for Nppa mRNA level and left ventricular mass (LVM) indexed to body weight. The analysis included experimental groups after 8 and 10 weeks of aortic constriction, 8 week’s sham-operated and intact animals, r indicates Pearson coefficient; for all ∗ P
    Mouse Monoclonal Beta Sarcoglycan Antibodies, supplied by Leica Biosystems, used in various techniques. Bioz Stars score: 88/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse monoclonal beta sarcoglycan antibodies/product/Leica Biosystems
    Average 88 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    mouse monoclonal beta sarcoglycan antibodies - by Bioz Stars, 2019-08
    88/100 stars
      Buy from Supplier

    81
    Developmental Studies Hybridoma Bank sarcoglycan complex antibodies rabbit anti α sarcoglycan
    Morphological and molecular evidences of myocardial hypertrophy progression. (A) Immunohistochemical staining of <t>beta-</t> <t>sarcoglycan</t> allowing to detect outer membrane showing clear increase of cells size in transverse orientation by 10-weeks group compared to intact. (B) Increase in cell diameter (Dmin) illustrating progressive cardiomyocytes enlargement, and significant increase after 8 and 10 weeks of aortic banding performing. Nppa expression was upregulated in LV (C) and IVS (D) after 1, 2, 8, and 10 weeks of model duration compared to intact or sham-control groups. (E) Positive linear correlation was found for Nppa mRNA level and left ventricular mass (LVM) indexed to body weight. The analysis included experimental groups after 8 and 10 weeks of aortic constriction, 8 week’s sham-operated and intact animals, r indicates Pearson coefficient; for all ∗ P
    Sarcoglycan Complex Antibodies Rabbit Anti α Sarcoglycan, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 81/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sarcoglycan complex antibodies rabbit anti α sarcoglycan/product/Developmental Studies Hybridoma Bank
    Average 81 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    sarcoglycan complex antibodies rabbit anti α sarcoglycan - by Bioz Stars, 2019-08
    81/100 stars
      Buy from Supplier

    81
    Novocastra alpha sarcoglycan antibody ad1 20a6
    Morphological and molecular evidences of myocardial hypertrophy progression. (A) Immunohistochemical staining of <t>beta-</t> <t>sarcoglycan</t> allowing to detect outer membrane showing clear increase of cells size in transverse orientation by 10-weeks group compared to intact. (B) Increase in cell diameter (Dmin) illustrating progressive cardiomyocytes enlargement, and significant increase after 8 and 10 weeks of aortic banding performing. Nppa expression was upregulated in LV (C) and IVS (D) after 1, 2, 8, and 10 weeks of model duration compared to intact or sham-control groups. (E) Positive linear correlation was found for Nppa mRNA level and left ventricular mass (LVM) indexed to body weight. The analysis included experimental groups after 8 and 10 weeks of aortic constriction, 8 week’s sham-operated and intact animals, r indicates Pearson coefficient; for all ∗ P
    Alpha Sarcoglycan Antibody Ad1 20a6, supplied by Novocastra, used in various techniques. Bioz Stars score: 81/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alpha sarcoglycan antibody ad1 20a6/product/Novocastra
    Average 81 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    alpha sarcoglycan antibody ad1 20a6 - by Bioz Stars, 2019-08
    81/100 stars
      Buy from Supplier

    79
    MONOSAN biotinylated anti alpha sarcoglycan
    Isolation of <t>alpha-sarcoglycan</t> + EVs from plasma using immunoaffinity capturing. Anti-alpha-sarcoglycan antibodies were conjugated to magnetic beads to isolate muscle EVs from plasma. Western blot analysis confirmed the presence of the exosomal marker Tsg101 in isolated EVs. Ponceau S Staining has been used as loading control (a). MicroRNA quantifications showed an increase in the miR-206/miR-16 ratio in the SGCA + sub-population of EVs (SGCA-Beads) compared to total (total plasma EVs) or uncaptured EVs (Supernatant). MiR-206 expression levels were normalized versus the endogenous reference miR-16 and expressed as -ΔCq (where ΔCq = Cq miR-206 -Cq miR-16 ) (b). Moreover, the quantification of miR-16 ratio in the SGCA + sub-population of EVs compared to total or uncaptured EVs shows that SGCA-conjugated beads retained about 2–5% of the total amount of EVs, miR-16 expression levels were normalized versus the spike-in reference cel-miR-39 and expressed as -ΔCq (where ΔCq = Cq miR-16 -Cq cel-miR-39 ) (c). Asterisks denote significant changes ( p
    Biotinylated Anti Alpha Sarcoglycan, supplied by MONOSAN, used in various techniques. Bioz Stars score: 79/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/biotinylated anti alpha sarcoglycan/product/MONOSAN
    Average 79 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    biotinylated anti alpha sarcoglycan - by Bioz Stars, 2019-08
    79/100 stars
      Buy from Supplier

    75
    MONOSAN anti alpha sarcoglycan
    Isolation of <t>alpha-sarcoglycan</t> + EVs from plasma using immunoaffinity capturing. Anti-alpha-sarcoglycan antibodies were conjugated to magnetic beads to isolate muscle EVs from plasma. Western blot analysis confirmed the presence of the exosomal marker Tsg101 in isolated EVs. Ponceau S Staining has been used as loading control (a). MicroRNA quantifications showed an increase in the miR-206/miR-16 ratio in the SGCA + sub-population of EVs (SGCA-Beads) compared to total (total plasma EVs) or uncaptured EVs (Supernatant). MiR-206 expression levels were normalized versus the endogenous reference miR-16 and expressed as -ΔCq (where ΔCq = Cq miR-206 -Cq miR-16 ) (b). Moreover, the quantification of miR-16 ratio in the SGCA + sub-population of EVs compared to total or uncaptured EVs shows that SGCA-conjugated beads retained about 2–5% of the total amount of EVs, miR-16 expression levels were normalized versus the spike-in reference cel-miR-39 and expressed as -ΔCq (where ΔCq = Cq miR-16 -Cq cel-miR-39 ) (c). Asterisks denote significant changes ( p
    Anti Alpha Sarcoglycan, supplied by MONOSAN, used in various techniques. Bioz Stars score: 75/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti alpha sarcoglycan/product/MONOSAN
    Average 75 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti alpha sarcoglycan - by Bioz Stars, 2019-08
    75/100 stars
      Buy from Supplier

    86
    Thermo Fisher gene exp sgcd hs01087180 m1
    Expression of <t>S151A-SGCD</t> precedes cardiac function changes in adult Drosophila expressing <t>S151A-SGCD.</t> (A).Temperature shift from 18°C to 26°C results in deterioration in cardiac function and induction of S151A-SGCD expression. After a temperature shift to 26°C, the induction of transgene expression precedes the development of dilated cardiomyopathy by 48 hours as demonstrated by QRT-PCR measurements of S151A-SGCD mRNA levels compared to cardiac function by serial OCT. A second temperature shift back to 18°C represses S151A-SGCD mRNA expression and results in restoration of cardiac function by 48 hours. We performed three independent experiments using different batches of flies each time. The summary data for QRT-PCR at the indicated times and temperatures are expressed as the mean +/− SE of three independent experiments, each performed in triplicate. * p
    Gene Exp Sgcd Hs01087180 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp sgcd hs01087180 m1/product/Thermo Fisher
    Average 86 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    gene exp sgcd hs01087180 m1 - by Bioz Stars, 2019-08
    86/100 stars
      Buy from Supplier

    77
    Thermo Fisher sgca
    Spectrum and location of mutations in <t>SGCA</t> , SGCB , and SGCG . SGCA , SGCB , and SGCG were represented by their exons. To accommodate the distribution of mutations, the size of the exons was not represented at scale. To illustrate the reading frame, the exons are schematically represented by boxes with blunt, protrusive or intrusive ends. Nucleotide numbering for all mutations was designated according to the coding <t>DNA</t> reference sequence (CDS) in GenBank Accession number NM_000023.2 ( SGCA ), NM_000232.4 ( SGCB ), and NM_000231.2( SGCG ). Information for the different protein domains is available in https://www.uniprot.org/ . Numerals within parentheses indicate, for each mutation, the number of patients harboring the mutation. c.158-10_160del, c.158-10_160delCTTCCACCAGCTG; c.273_292del, c.273_292delCATTGGACCAAATGGCTGTG
    Sgca, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sgca/product/Thermo Fisher
    Average 77 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    sgca - by Bioz Stars, 2019-08
    77/100 stars
      Buy from Supplier

    Image Search Results


    Broad sarcolemmal distribution of compensatory proteins upon Akt activation. Immunohistochemical analyses on transverse quadriceps sections in WT STG, WT DTG, mdx STG and mdx DTG mice. Sections were stained with antibodies to dystrophin (Dys), utrophin (Utrn), β1D integrin, alpha- and beta-dystroglycan (α-DG, β-DG), alpha-, beta- and gamma-sarcoglycan (α-SG, β-SG, γ-SG) and sarcospan (SSPN), and visualized using indirect immunofluorescence. Increased expression of the DGC and UGC in WT mice was observed upon constitutive activation of Akt1. Akt activation increased expression of only the UGC in mdx mice. An increase in utrophin levels was observed in mdx mice relative to levels in WT mice. In both WT mice and in mdx mice, Akt activation increased the expression of β1D integrin. Bar, 50 µm.

    Journal: Human Molecular Genetics

    Article Title: Myogenic Akt signaling upregulates the utrophin-glycoprotein complex and promotes sarcolemma stability in muscular dystrophy

    doi: 10.1093/hmg/ddn358

    Figure Lengend Snippet: Broad sarcolemmal distribution of compensatory proteins upon Akt activation. Immunohistochemical analyses on transverse quadriceps sections in WT STG, WT DTG, mdx STG and mdx DTG mice. Sections were stained with antibodies to dystrophin (Dys), utrophin (Utrn), β1D integrin, alpha- and beta-dystroglycan (α-DG, β-DG), alpha-, beta- and gamma-sarcoglycan (α-SG, β-SG, γ-SG) and sarcospan (SSPN), and visualized using indirect immunofluorescence. Increased expression of the DGC and UGC in WT mice was observed upon constitutive activation of Akt1. Akt activation increased expression of only the UGC in mdx mice. An increase in utrophin levels was observed in mdx mice relative to levels in WT mice. In both WT mice and in mdx mice, Akt activation increased the expression of β1D integrin. Bar, 50 µm.

    Article Snippet: Primary antibodies against proteins in the DGC and UGC and their respective concentrations include dystrophin (Vector Laboratories, Burlingame, CA, USA; VP-D507, 1:2), utrophin (University of Iowa, Hybridoma Facility; MANCHO3, 1:200), α-DG (Upstate Cell Signaling Solutions, Lake Placid, NY, USA; IIH6, 1:700), β-DG (University of Iowa, Hybridoma Facility; MANDAG2, 1:10), α-SG (Vector Laboratories; VP-A105, 1:20), β-SG (Vector Laboratories; VP-B206, 1:100), γ-SG (Vector Laboratories; VP-G803, 1:200) and SSPN [Rabbit 3 (described previously in ), 1:50]. α7 Integrin antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA; L-17) was diluted 1:100 and α5 integrin (Abcam, Cambridge, UK; ab55988) was diluted 1:50.

    Techniques: Activation Assay, Immunohistochemistry, Mouse Assay, Staining, Immunofluorescence, Expressing

    Akt increases expression of compensatory proteins in mdx mice. Immunoblotting for several glycoprotein complexes (DGC, UGC, integrin) on skeletal muscle lysates from six-week-old WT STG, WT DTG, mdx STG, and mdx DTG mice. Identical membranes were probed with antibodies against dystrophin (Dys), utrophin (Utrn), alpha- and beta-dystroglycan (α-DG, β-DG), alpha-, beta- and gamma-sarcoglycan (α-SG, β-SG, γ-SG), β1D integrin and dysferlin (Dysf). GADPH immunoblotting and Coomassie blue (CB) staining of total protein are shown on the bottom panels as a loading controls. Constitutive Akt activation increased the expression of the DGC and UGC in WT mice. Utrophin levels increased in mdx mice compared to those of WT mice. Increased expression of β1D integrin and dysferlin was observed upon Akt activation in both WT mice and in mdx mice.

    Journal: Human Molecular Genetics

    Article Title: Myogenic Akt signaling upregulates the utrophin-glycoprotein complex and promotes sarcolemma stability in muscular dystrophy

    doi: 10.1093/hmg/ddn358

    Figure Lengend Snippet: Akt increases expression of compensatory proteins in mdx mice. Immunoblotting for several glycoprotein complexes (DGC, UGC, integrin) on skeletal muscle lysates from six-week-old WT STG, WT DTG, mdx STG, and mdx DTG mice. Identical membranes were probed with antibodies against dystrophin (Dys), utrophin (Utrn), alpha- and beta-dystroglycan (α-DG, β-DG), alpha-, beta- and gamma-sarcoglycan (α-SG, β-SG, γ-SG), β1D integrin and dysferlin (Dysf). GADPH immunoblotting and Coomassie blue (CB) staining of total protein are shown on the bottom panels as a loading controls. Constitutive Akt activation increased the expression of the DGC and UGC in WT mice. Utrophin levels increased in mdx mice compared to those of WT mice. Increased expression of β1D integrin and dysferlin was observed upon Akt activation in both WT mice and in mdx mice.

    Article Snippet: Primary antibodies against proteins in the DGC and UGC and their respective concentrations include dystrophin (Vector Laboratories, Burlingame, CA, USA; VP-D507, 1:2), utrophin (University of Iowa, Hybridoma Facility; MANCHO3, 1:200), α-DG (Upstate Cell Signaling Solutions, Lake Placid, NY, USA; IIH6, 1:700), β-DG (University of Iowa, Hybridoma Facility; MANDAG2, 1:10), α-SG (Vector Laboratories; VP-A105, 1:20), β-SG (Vector Laboratories; VP-B206, 1:100), γ-SG (Vector Laboratories; VP-G803, 1:200) and SSPN [Rabbit 3 (described previously in ), 1:50]. α7 Integrin antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA; L-17) was diluted 1:100 and α5 integrin (Abcam, Cambridge, UK; ab55988) was diluted 1:50.

    Techniques: Expressing, Mouse Assay, Staining, Activation Assay

    The biglycan core polypeptide is sufficient for binding to both immobilized and soluble α- and γ-sarcoglycan A. Purified recombinant biglycan core polypeptide (1μg) was separated by SDS-PAGE and either silver stained or blotted and probed as described above. α-Dystroglycan did not bind to this GAG-free biglycan. In contrast, both α- and γ- sarcoglycan bind to the biglycan core polypeptide. B. Co-immunoprecipitation of purified recombinant biglycan to recombinant sarcoglycans. His-tagged biglycan core polypeptide (0.5μg/ml) was incubated with the indicated 35 S-methionine-labeled, in vitro translated sarcoglycan for 1 hr followed by either anti-biglycan (a), anti-poly-His (b) or normal rabbit Ig (c). Immune complexes were then precipitated with protein G beads and analyzed by SDS-PAGE and autoradiography. Note that both α- and γ- sarcoglycan co-immunoprecipitate with biglycan, while β- and δ- sarcoglycan do not. The labelling of the various sarcoglycans is shown by direct autoradiography of SDS-PAGE-separated in vitro translated polypeptides (‘Input’).

    Journal:

    Article Title: Biglycan binds to ?- and ?- sarcoglycan and regulates their expression during development

    doi: 10.1002/jcp.20740

    Figure Lengend Snippet: The biglycan core polypeptide is sufficient for binding to both immobilized and soluble α- and γ-sarcoglycan A. Purified recombinant biglycan core polypeptide (1μg) was separated by SDS-PAGE and either silver stained or blotted and probed as described above. α-Dystroglycan did not bind to this GAG-free biglycan. In contrast, both α- and γ- sarcoglycan bind to the biglycan core polypeptide. B. Co-immunoprecipitation of purified recombinant biglycan to recombinant sarcoglycans. His-tagged biglycan core polypeptide (0.5μg/ml) was incubated with the indicated 35 S-methionine-labeled, in vitro translated sarcoglycan for 1 hr followed by either anti-biglycan (a), anti-poly-His (b) or normal rabbit Ig (c). Immune complexes were then precipitated with protein G beads and analyzed by SDS-PAGE and autoradiography. Note that both α- and γ- sarcoglycan co-immunoprecipitate with biglycan, while β- and δ- sarcoglycan do not. The labelling of the various sarcoglycans is shown by direct autoradiography of SDS-PAGE-separated in vitro translated polypeptides (‘Input’).

    Article Snippet: Antibodies to the sarcoglycans and other DAPC components were obtained from NovoCastra (Newcastle upon Tyne, UK).

    Techniques: Binding Assay, Purification, Recombinant, SDS Page, Staining, Immunoprecipitation, Incubation, Labeling, In Vitro, Autoradiography

    Biglycan binds to α- and γ- sarcoglycan A. Sarcoglycan binding to native biglycan. Postsynaptic membrane fractions from Torpedo electric organ (TEOM; 0.8 μg) were separated on SDS-PAGE gels, blotted onto nitrocellulose then probed with either 35 S-methionine-labelled in vitro translated α-dystroglycan or sarcoglycans (α, β, γ, or δ) and analyzed by autoradiography. α-Dystroglycan as well as α- and γ-sarcoglycan bound to a polydisperse band whose center of migration was ∼125kD. In previous work a polypeptide with identical mobility, appearance and α–dystroglycan binding capacity was purified from these fractions and shown to be the proteoglycan biglycan . No binding of β– or δ– sarcoglycan to this or any other polypeptide in these fractions was detected. B. Binding of α-dystroglycan and sarcoglycans to purified recombinant biglycan proteoglycan (Biglycan-PG). One microgram of biglycan was separated by SDS-PAGE and either stained with silver or blotted onto nitrocellulose (‘Overlay’) and probed as described above. α-Dystroglycan and α- and γ-sarcoglycan bind to this recombinant, GAG-containing biglycan proteoglycan, while no binding of β– or δ– sarcoglycan is detected.

    Journal:

    Article Title: Biglycan binds to ?- and ?- sarcoglycan and regulates their expression during development

    doi: 10.1002/jcp.20740

    Figure Lengend Snippet: Biglycan binds to α- and γ- sarcoglycan A. Sarcoglycan binding to native biglycan. Postsynaptic membrane fractions from Torpedo electric organ (TEOM; 0.8 μg) were separated on SDS-PAGE gels, blotted onto nitrocellulose then probed with either 35 S-methionine-labelled in vitro translated α-dystroglycan or sarcoglycans (α, β, γ, or δ) and analyzed by autoradiography. α-Dystroglycan as well as α- and γ-sarcoglycan bound to a polydisperse band whose center of migration was ∼125kD. In previous work a polypeptide with identical mobility, appearance and α–dystroglycan binding capacity was purified from these fractions and shown to be the proteoglycan biglycan . No binding of β– or δ– sarcoglycan to this or any other polypeptide in these fractions was detected. B. Binding of α-dystroglycan and sarcoglycans to purified recombinant biglycan proteoglycan (Biglycan-PG). One microgram of biglycan was separated by SDS-PAGE and either stained with silver or blotted onto nitrocellulose (‘Overlay’) and probed as described above. α-Dystroglycan and α- and γ-sarcoglycan bind to this recombinant, GAG-containing biglycan proteoglycan, while no binding of β– or δ– sarcoglycan is detected.

    Article Snippet: Antibodies to the sarcoglycans and other DAPC components were obtained from NovoCastra (Newcastle upon Tyne, UK).

    Techniques: Binding Assay, SDS Page, In Vitro, Autoradiography, Migration, Purification, Recombinant, Staining

    Distinct binding sites for α- and γ- sarcoglycan on the biglycan core polypeptide A. Domain structure of biglycan, decorin and a biglycan-decorin chimera. The location of the pre-pro peptide (‘prepro’), 6-His tag, cysteine-rich amino- and carboxyl- domains, LRRs (ten open rectangles in the central domain; some schemes predict an 11th in the carboxyl-terminal cysteine-rich region) and GAG attachment sites (asterisks) are indicated. Note that these sites are present in the recombinant proteins used in this experiment, but they are not substituted with GAGs. B. Binding of sarcoglycans to biglycan, decorin and a chimera. One microgram of each of the purified recombinant proteins was separated by SDS-PAGE and either directly stained (‘silver’) or blotted and probed with 35 S-methionine-labelled, in vitro-translated sarcoglycans as indicated. Both α- and γ- sarcoglycan bind to the immobilized biglycan core but not to decorin core. In contrast, only α-sarcoglycan binds to the biglycan-decorin chimeric protein. Thus the first 30 amino acids of biglycan is necessary for its binding to α-sarcoglycan. Neither β- nor δ- sarcoglycan bind to biglycan, decorin or the chimera. C. Competition studies. Sarcoglycan binding to purified recombinant biglycan core polypeptide in the presence of excess MBP-Bgn38-77 (amino acids 38 to 77 of biglycan) or MBP-Dcn31-71 (amino acids 31 to 71 of decorin). These sequences correspond to the first 40 amino acids of the mature biglycan and decorin polypeptides, respectively. Four micrograms of biglycan were separated by SDS-PAGE and either directly stained with Coomassie Blue (CB) or blotted and probed with biotinylated (BT), in vitro-translated α- or γ-sarcoglycan as indicated. Binding of α-sarcoglycan to full-length biglycan was inhibited in the presence of MBP-Bgn38-77 , while binding between γ-sarcoglycan and biglycan binding remained unchanged. The decorin fusion protein did not inhibit this interaction.

    Journal:

    Article Title: Biglycan binds to ?- and ?- sarcoglycan and regulates their expression during development

    doi: 10.1002/jcp.20740

    Figure Lengend Snippet: Distinct binding sites for α- and γ- sarcoglycan on the biglycan core polypeptide A. Domain structure of biglycan, decorin and a biglycan-decorin chimera. The location of the pre-pro peptide (‘prepro’), 6-His tag, cysteine-rich amino- and carboxyl- domains, LRRs (ten open rectangles in the central domain; some schemes predict an 11th in the carboxyl-terminal cysteine-rich region) and GAG attachment sites (asterisks) are indicated. Note that these sites are present in the recombinant proteins used in this experiment, but they are not substituted with GAGs. B. Binding of sarcoglycans to biglycan, decorin and a chimera. One microgram of each of the purified recombinant proteins was separated by SDS-PAGE and either directly stained (‘silver’) or blotted and probed with 35 S-methionine-labelled, in vitro-translated sarcoglycans as indicated. Both α- and γ- sarcoglycan bind to the immobilized biglycan core but not to decorin core. In contrast, only α-sarcoglycan binds to the biglycan-decorin chimeric protein. Thus the first 30 amino acids of biglycan is necessary for its binding to α-sarcoglycan. Neither β- nor δ- sarcoglycan bind to biglycan, decorin or the chimera. C. Competition studies. Sarcoglycan binding to purified recombinant biglycan core polypeptide in the presence of excess MBP-Bgn38-77 (amino acids 38 to 77 of biglycan) or MBP-Dcn31-71 (amino acids 31 to 71 of decorin). These sequences correspond to the first 40 amino acids of the mature biglycan and decorin polypeptides, respectively. Four micrograms of biglycan were separated by SDS-PAGE and either directly stained with Coomassie Blue (CB) or blotted and probed with biotinylated (BT), in vitro-translated α- or γ-sarcoglycan as indicated. Binding of α-sarcoglycan to full-length biglycan was inhibited in the presence of MBP-Bgn38-77 , while binding between γ-sarcoglycan and biglycan binding remained unchanged. The decorin fusion protein did not inhibit this interaction.

    Article Snippet: Antibodies to the sarcoglycans and other DAPC components were obtained from NovoCastra (Newcastle upon Tyne, UK).

    Techniques: Binding Assay, Recombinant, Purification, SDS Page, Staining, In Vitro

    The muscle biopsy of the patient with the genetically confirmed LGMD2D showing no sign of dystrophy (A) and normal expression of all sarcoglycans (B, C, D, E) . The biopsy was taken at the age of 8 years.

    Journal: Acta Myologica

    Article Title: Childhood onset limb-girdle muscular dystrophies in the Aegean part of Turkey

    doi:

    Figure Lengend Snippet: The muscle biopsy of the patient with the genetically confirmed LGMD2D showing no sign of dystrophy (A) and normal expression of all sarcoglycans (B, C, D, E) . The biopsy was taken at the age of 8 years.

    Article Snippet: Spectrin (Novo-castra, UK, NCL-spec1), dystrophin N-terminus (Novo-castra, UK, NCL-dys3), adhalin (Novocastra, UK, NCL-a-sarc), other sarcoglycans (beta, delta, gamma; Novo-castra, UK, NCL-b-d-g-sarc), laminin alpha-2 chain (Novo-castra, UK, NCL-merosin), myotilin (Novo-castra, UK, NCL-myotilin), collagen VI (Novocastra, UK, NCL-COLL-vI), β-dystroglycan (Novocastra, UK, NCL-b-DG), HLA Class 1 (Novo-castra, UK, NCL-HLA-ABC), NCAM (ThermoScientific, CA, USA, CD56), nitric oxide synthase-1 (Novo-castra, UK, NCLNOS-1), emerin (Novo-castra, UK, NCL-emerin), caveolin 3 (Novus Biologicals, CA, USA, NB110-5029), calpain 3 (Abcam, Cambridge, UK, ab103250) and dysferlin (Novo-castra, UK, NCL-Hamlet-2) antibodies were used by standard techniques for immunohistochemical analyses.

    Techniques: Expressing

    Cross-sectional profiles of regenerating fibres. Three serial frozen cross sections of a biopsy obtained from regenerating vastus lateralis skeletal muscle 7 days after injury induced by electrical stimulation-elicited eccentric contractions (right). Three serial cross sections from the control (uninjured) leg of the same individual are shown (left) for comparison. The sections have been stained with alpha-sarcoglycan, beta-dystroglycan or dystrophin to label the sarcolemma, along with a basement membrane protein (laminin or collagen IV) and a myogenic marker (desmin or neonatal/embryonic myosin; MHCn/e). Each column of images contains single channel and combined images for each staining. In the injured muscle, dystrophin staining is completely absent in several fibres, while the basement membrane (laminin) is preserved. MHCn/e staining is evident in some small dystrophin-negative fibres. A similar pattern is evident from the alpha-sarcoglycan and beta-dystroglycan staining, with negative fibres, together with desmin+ cells, contained within a preserved basement membrane (collagen IV). Asterisk indicates some of the necrotic fibres. Note the different profiles of the injured fibres, such as varying fibre size, and infiltrating cells either confined to the fibre periphery or dispersed throughout the fibre. Scale bar, 100 μm

    Journal: Skeletal Muscle

    Article Title: The breaking and making of healthy adult human skeletal muscle in vivo

    doi: 10.1186/s13395-017-0142-x

    Figure Lengend Snippet: Cross-sectional profiles of regenerating fibres. Three serial frozen cross sections of a biopsy obtained from regenerating vastus lateralis skeletal muscle 7 days after injury induced by electrical stimulation-elicited eccentric contractions (right). Three serial cross sections from the control (uninjured) leg of the same individual are shown (left) for comparison. The sections have been stained with alpha-sarcoglycan, beta-dystroglycan or dystrophin to label the sarcolemma, along with a basement membrane protein (laminin or collagen IV) and a myogenic marker (desmin or neonatal/embryonic myosin; MHCn/e). Each column of images contains single channel and combined images for each staining. In the injured muscle, dystrophin staining is completely absent in several fibres, while the basement membrane (laminin) is preserved. MHCn/e staining is evident in some small dystrophin-negative fibres. A similar pattern is evident from the alpha-sarcoglycan and beta-dystroglycan staining, with negative fibres, together with desmin+ cells, contained within a preserved basement membrane (collagen IV). Asterisk indicates some of the necrotic fibres. Note the different profiles of the injured fibres, such as varying fibre size, and infiltrating cells either confined to the fibre periphery or dispersed throughout the fibre. Scale bar, 100 μm

    Article Snippet: Sections were stained with various combinations of antibodies against laminin, CD56, desmin and embryonic myosin (F1.652; Developmental Studies Hybridoma Bank); neonatal myosin (NCL-MHCn; Novocastra, Leica Microsystems A/S, Ballerup, Denmark); alpha-sarcoglycan (NCL-L-a-SARC, Novocastra); beta-dystroglycan (NCL-L-a-SARC, Novocastra); myogenin (F5d, Developmental Studies Hybridoma Bank); nestin, CD68, collagen IV and dystrophin (cat. no. D8168, Sigma-Aldrich Denmark A/S, Copenhagen, Denmark); myosin type I (BA.D5, Developmental Studies Hybridoma Bank) and myosin type II (A4.74, Developmental Studies Hybridoma Bank).

    Techniques: Staining, Marker

    Isolation of alpha-sarcoglycan + EVs from plasma using immunoaffinity capturing. Anti-alpha-sarcoglycan antibodies were conjugated to magnetic beads to isolate muscle EVs from plasma. Western blot analysis confirmed the presence of the exosomal marker Tsg101 in isolated EVs. Ponceau S Staining has been used as loading control (a). MicroRNA quantifications showed an increase in the miR-206/miR-16 ratio in the SGCA + sub-population of EVs (SGCA-Beads) compared to total (total plasma EVs) or uncaptured EVs (Supernatant). MiR-206 expression levels were normalized versus the endogenous reference miR-16 and expressed as -ΔCq (where ΔCq = Cq miR-206 -Cq miR-16 ) (b). Moreover, the quantification of miR-16 ratio in the SGCA + sub-population of EVs compared to total or uncaptured EVs shows that SGCA-conjugated beads retained about 2–5% of the total amount of EVs, miR-16 expression levels were normalized versus the spike-in reference cel-miR-39 and expressed as -ΔCq (where ΔCq = Cq miR-16 -Cq cel-miR-39 ) (c). Asterisks denote significant changes ( p

    Journal: PLoS ONE

    Article Title: Muscle Releases Alpha-Sarcoglycan Positive Extracellular Vesicles Carrying miRNAs in the Bloodstream

    doi: 10.1371/journal.pone.0125094

    Figure Lengend Snippet: Isolation of alpha-sarcoglycan + EVs from plasma using immunoaffinity capturing. Anti-alpha-sarcoglycan antibodies were conjugated to magnetic beads to isolate muscle EVs from plasma. Western blot analysis confirmed the presence of the exosomal marker Tsg101 in isolated EVs. Ponceau S Staining has been used as loading control (a). MicroRNA quantifications showed an increase in the miR-206/miR-16 ratio in the SGCA + sub-population of EVs (SGCA-Beads) compared to total (total plasma EVs) or uncaptured EVs (Supernatant). MiR-206 expression levels were normalized versus the endogenous reference miR-16 and expressed as -ΔCq (where ΔCq = Cq miR-206 -Cq miR-16 ) (b). Moreover, the quantification of miR-16 ratio in the SGCA + sub-population of EVs compared to total or uncaptured EVs shows that SGCA-conjugated beads retained about 2–5% of the total amount of EVs, miR-16 expression levels were normalized versus the spike-in reference cel-miR-39 and expressed as -ΔCq (where ΔCq = Cq miR-16 -Cq cel-miR-39 ) (c). Asterisks denote significant changes ( p

    Article Snippet: Primary antibodies were used against Tsg101 (1:2,000 dilution, clone 4A10 Abcam) and alpha-sarcoglycan (1:300 dilution, clone H-82 Santa Cruz).

    Techniques: Isolation, Magnetic Beads, Western Blot, Marker, Staining, Expressing

    Analysis of patient material. Microscopical investigations (1A): (I) M. vastus lateralis biopsy of patient 1 showing a myopathic pattern with minor muscle fiber atrophy and hypertrophy as well as frequent nonsubsarcolemmal nuclei (arrows). Cryostat section, H E. Scale bar: 80 μm. (II) Low‐grade muscle fiber atrophy and solitary rimmed vacuole (arrow) in cryostat section of the rectus femoris muscle biopsy of patient 2. Cryostat section, H E. Scale bar: 50 μm. (III) M. quadriceps femoris biopsy of patient 3 showing minor atrophic as well as hypertrophic muscle fibers. Cryostat section, H E. Scale bar: 80 μm Electron microscopic studies (1B): (I) Subsarcolemmal membrane‐bound vacuoles, presumably corresponding to enlarged caveolae (arrows) in the muscle biopsy of patient 1. Scale bar: 250 nm. (II–VI) Patient 2; (II) subsarcolemmal membrane‐bound vacuoles (arrows) similar to the one depicted in Fig. 1 A. Scale bar: 200 nm. (III) Further abnormal membrane bound subsarcolemmal vacuoles as well as tubular structures (arrows). Scale bar: 2 μm. (IV) Large vacuole (asterisk) associated with a myonucleus. Scale bar: 4 μm. (V) Large (asterisk) and small (arrowheads) vacuoles in the vicinity of a myonucleus. Scale bar: 2 μm. (VI) Large vacuole containing autophagic material (arrows) associated with a deformed, possibly degenerating myonucleus. Arrowheads: Membranous material, presumably corresponding to a focal outfolding of the sarcoplasmic reticulum. Scale bar: 4 μm. (VII) Patient 3: subsarcolemmal membrane‐bound vacuoles (arrows). Scale bar: 800 nm. Immunoblots of myopathy‐associated proteins (1C): comparison of beta‐Spectrin, Calpain‐3, Lamin A/C, Myotilin, alpha‐ and gamma‐Sarcoglycan, beta‐Dystroglycan and Emerin in G56S Caveolin‐3 patient and control muscle revealed no significant changes in protein abundances. Confirmation of proteome data via immunoblotting (1D): immunoblot analyses of HSP75, SNX1, CSTF2, Sec63, HNRA3, and Rab1A revealed same changes in protein abundances upon G56S Caveolin‐3 expression like in the G56S Caveolin‐3 in vitro model. Tubulin was used as loading control.

    Journal: Proteomics. Clinical Applications

    Article Title: The Caveolin‐3 G56S sequence variant of unknown significance: Muscle biopsy findings and functional cell biological analysis

    doi: 10.1002/prca.201600007

    Figure Lengend Snippet: Analysis of patient material. Microscopical investigations (1A): (I) M. vastus lateralis biopsy of patient 1 showing a myopathic pattern with minor muscle fiber atrophy and hypertrophy as well as frequent nonsubsarcolemmal nuclei (arrows). Cryostat section, H E. Scale bar: 80 μm. (II) Low‐grade muscle fiber atrophy and solitary rimmed vacuole (arrow) in cryostat section of the rectus femoris muscle biopsy of patient 2. Cryostat section, H E. Scale bar: 50 μm. (III) M. quadriceps femoris biopsy of patient 3 showing minor atrophic as well as hypertrophic muscle fibers. Cryostat section, H E. Scale bar: 80 μm Electron microscopic studies (1B): (I) Subsarcolemmal membrane‐bound vacuoles, presumably corresponding to enlarged caveolae (arrows) in the muscle biopsy of patient 1. Scale bar: 250 nm. (II–VI) Patient 2; (II) subsarcolemmal membrane‐bound vacuoles (arrows) similar to the one depicted in Fig. 1 A. Scale bar: 200 nm. (III) Further abnormal membrane bound subsarcolemmal vacuoles as well as tubular structures (arrows). Scale bar: 2 μm. (IV) Large vacuole (asterisk) associated with a myonucleus. Scale bar: 4 μm. (V) Large (asterisk) and small (arrowheads) vacuoles in the vicinity of a myonucleus. Scale bar: 2 μm. (VI) Large vacuole containing autophagic material (arrows) associated with a deformed, possibly degenerating myonucleus. Arrowheads: Membranous material, presumably corresponding to a focal outfolding of the sarcoplasmic reticulum. Scale bar: 4 μm. (VII) Patient 3: subsarcolemmal membrane‐bound vacuoles (arrows). Scale bar: 800 nm. Immunoblots of myopathy‐associated proteins (1C): comparison of beta‐Spectrin, Calpain‐3, Lamin A/C, Myotilin, alpha‐ and gamma‐Sarcoglycan, beta‐Dystroglycan and Emerin in G56S Caveolin‐3 patient and control muscle revealed no significant changes in protein abundances. Confirmation of proteome data via immunoblotting (1D): immunoblot analyses of HSP75, SNX1, CSTF2, Sec63, HNRA3, and Rab1A revealed same changes in protein abundances upon G56S Caveolin‐3 expression like in the G56S Caveolin‐3 in vitro model. Tubulin was used as loading control.

    Article Snippet: The following proteins were investigated: Lamin A/C (Vector Laboratories, Burlingame, CA, USA), beta‐Spectrin, Calpain‐3, Myotilin, alpha‐Sarcoglycan, gamma‐Sarcoglycan, beta‐Dystroglycan, and Emerin (all Leica Biosystems, Nussloch, Germany).

    Techniques: Western Blot, Expressing, In Vitro

    Morphological and molecular evidences of myocardial hypertrophy progression. (A) Immunohistochemical staining of beta- sarcoglycan allowing to detect outer membrane showing clear increase of cells size in transverse orientation by 10-weeks group compared to intact. (B) Increase in cell diameter (Dmin) illustrating progressive cardiomyocytes enlargement, and significant increase after 8 and 10 weeks of aortic banding performing. Nppa expression was upregulated in LV (C) and IVS (D) after 1, 2, 8, and 10 weeks of model duration compared to intact or sham-control groups. (E) Positive linear correlation was found for Nppa mRNA level and left ventricular mass (LVM) indexed to body weight. The analysis included experimental groups after 8 and 10 weeks of aortic constriction, 8 week’s sham-operated and intact animals, r indicates Pearson coefficient; for all ∗ P

    Journal: Frontiers in Genetics

    Article Title: Time- and Ventricular-Specific Expression Profiles of Genes Encoding Z-Disk Proteins in Pressure Overload Model of Left Ventricular Hypertrophy

    doi: 10.3389/fgene.2018.00684

    Figure Lengend Snippet: Morphological and molecular evidences of myocardial hypertrophy progression. (A) Immunohistochemical staining of beta- sarcoglycan allowing to detect outer membrane showing clear increase of cells size in transverse orientation by 10-weeks group compared to intact. (B) Increase in cell diameter (Dmin) illustrating progressive cardiomyocytes enlargement, and significant increase after 8 and 10 weeks of aortic banding performing. Nppa expression was upregulated in LV (C) and IVS (D) after 1, 2, 8, and 10 weeks of model duration compared to intact or sham-control groups. (E) Positive linear correlation was found for Nppa mRNA level and left ventricular mass (LVM) indexed to body weight. The analysis included experimental groups after 8 and 10 weeks of aortic constriction, 8 week’s sham-operated and intact animals, r indicates Pearson coefficient; for all ∗ P

    Article Snippet: After blocking in 15% fetal calf serum (FCS) for 30 min at room temperature, samples were incubated overnight at +4°C with mouse monoclonal beta-sarcoglycan antibodies (Leica Biosystems, NCL-L-b-SARC).

    Techniques: Immunohistochemistry, Staining, Expressing

    Morphological and molecular evidences of myocardial hypertrophy progression. (A) Immunohistochemical staining of beta- sarcoglycan allowing to detect outer membrane showing clear increase of cells size in transverse orientation by 10-weeks group compared to intact. (B) Increase in cell diameter (Dmin) illustrating progressive cardiomyocytes enlargement, and significant increase after 8 and 10 weeks of aortic banding performing. Nppa expression was upregulated in LV (C) and IVS (D) after 1, 2, 8, and 10 weeks of model duration compared to intact or sham-control groups. (E) Positive linear correlation was found for Nppa mRNA level and left ventricular mass (LVM) indexed to body weight. The analysis included experimental groups after 8 and 10 weeks of aortic constriction, 8 week’s sham-operated and intact animals, r indicates Pearson coefficient; for all ∗ P < 0.05.

    Journal: Frontiers in Genetics

    Article Title: Time- and Ventricular-Specific Expression Profiles of Genes Encoding Z-Disk Proteins in Pressure Overload Model of Left Ventricular Hypertrophy

    doi: 10.3389/fgene.2018.00684

    Figure Lengend Snippet: Morphological and molecular evidences of myocardial hypertrophy progression. (A) Immunohistochemical staining of beta- sarcoglycan allowing to detect outer membrane showing clear increase of cells size in transverse orientation by 10-weeks group compared to intact. (B) Increase in cell diameter (Dmin) illustrating progressive cardiomyocytes enlargement, and significant increase after 8 and 10 weeks of aortic banding performing. Nppa expression was upregulated in LV (C) and IVS (D) after 1, 2, 8, and 10 weeks of model duration compared to intact or sham-control groups. (E) Positive linear correlation was found for Nppa mRNA level and left ventricular mass (LVM) indexed to body weight. The analysis included experimental groups after 8 and 10 weeks of aortic constriction, 8 week’s sham-operated and intact animals, r indicates Pearson coefficient; for all ∗ P < 0.05.

    Article Snippet: After blocking in 15% fetal calf serum (FCS) for 30 min at room temperature, samples were incubated overnight at +4°C with mouse monoclonal beta-sarcoglycan antibodies (Leica Biosystems, NCL-L-b-SARC).

    Techniques: Immunohistochemistry, Staining, Expressing

    Isolation of alpha-sarcoglycan + EVs from plasma using immunoaffinity capturing. Anti-alpha-sarcoglycan antibodies were conjugated to magnetic beads to isolate muscle EVs from plasma. Western blot analysis confirmed the presence of the exosomal marker Tsg101 in isolated EVs. Ponceau S Staining has been used as loading control (a). MicroRNA quantifications showed an increase in the miR-206/miR-16 ratio in the SGCA + sub-population of EVs (SGCA-Beads) compared to total (total plasma EVs) or uncaptured EVs (Supernatant). MiR-206 expression levels were normalized versus the endogenous reference miR-16 and expressed as -ΔCq (where ΔCq = Cq miR-206 -Cq miR-16 ) (b). Moreover, the quantification of miR-16 ratio in the SGCA + sub-population of EVs compared to total or uncaptured EVs shows that SGCA-conjugated beads retained about 2–5% of the total amount of EVs, miR-16 expression levels were normalized versus the spike-in reference cel-miR-39 and expressed as -ΔCq (where ΔCq = Cq miR-16 -Cq cel-miR-39 ) (c). Asterisks denote significant changes ( p

    Journal: PLoS ONE

    Article Title: Muscle Releases Alpha-Sarcoglycan Positive Extracellular Vesicles Carrying miRNAs in the Bloodstream

    doi: 10.1371/journal.pone.0125094

    Figure Lengend Snippet: Isolation of alpha-sarcoglycan + EVs from plasma using immunoaffinity capturing. Anti-alpha-sarcoglycan antibodies were conjugated to magnetic beads to isolate muscle EVs from plasma. Western blot analysis confirmed the presence of the exosomal marker Tsg101 in isolated EVs. Ponceau S Staining has been used as loading control (a). MicroRNA quantifications showed an increase in the miR-206/miR-16 ratio in the SGCA + sub-population of EVs (SGCA-Beads) compared to total (total plasma EVs) or uncaptured EVs (Supernatant). MiR-206 expression levels were normalized versus the endogenous reference miR-16 and expressed as -ΔCq (where ΔCq = Cq miR-206 -Cq miR-16 ) (b). Moreover, the quantification of miR-16 ratio in the SGCA + sub-population of EVs compared to total or uncaptured EVs shows that SGCA-conjugated beads retained about 2–5% of the total amount of EVs, miR-16 expression levels were normalized versus the spike-in reference cel-miR-39 and expressed as -ΔCq (where ΔCq = Cq miR-16 -Cq cel-miR-39 ) (c). Asterisks denote significant changes ( p

    Article Snippet: Exosome-Dynabeads Streptavidin (Life technologies) in PBS + 0.1% BSA were mixed with biotinylated anti-alpha-sarcoglycan (clone AD1/20A6 Monosan) according to the manufacturer’s instructions.

    Techniques: Isolation, Magnetic Beads, Western Blot, Marker, Staining, Expressing

    Isolation of alpha-sarcoglycan + EVs from plasma using immunoaffinity capturing. Anti-alpha-sarcoglycan antibodies were conjugated to magnetic beads to isolate muscle EVs from plasma. Western blot analysis confirmed the presence of the exosomal marker Tsg101 in isolated EVs. Ponceau S Staining has been used as loading control (a). MicroRNA quantifications showed an increase in the miR-206/miR-16 ratio in the SGCA + sub-population of EVs (SGCA-Beads) compared to total (total plasma EVs) or uncaptured EVs (Supernatant). MiR-206 expression levels were normalized versus the endogenous reference miR-16 and expressed as -ΔCq (where ΔCq = Cq miR-206 -Cq miR-16 ) (b). Moreover, the quantification of miR-16 ratio in the SGCA + sub-population of EVs compared to total or uncaptured EVs shows that SGCA-conjugated beads retained about 2–5% of the total amount of EVs, miR-16 expression levels were normalized versus the spike-in reference cel-miR-39 and expressed as -ΔCq (where ΔCq = Cq miR-16 -Cq cel-miR-39 ) (c). Asterisks denote significant changes ( p

    Journal: PLoS ONE

    Article Title: Muscle Releases Alpha-Sarcoglycan Positive Extracellular Vesicles Carrying miRNAs in the Bloodstream

    doi: 10.1371/journal.pone.0125094

    Figure Lengend Snippet: Isolation of alpha-sarcoglycan + EVs from plasma using immunoaffinity capturing. Anti-alpha-sarcoglycan antibodies were conjugated to magnetic beads to isolate muscle EVs from plasma. Western blot analysis confirmed the presence of the exosomal marker Tsg101 in isolated EVs. Ponceau S Staining has been used as loading control (a). MicroRNA quantifications showed an increase in the miR-206/miR-16 ratio in the SGCA + sub-population of EVs (SGCA-Beads) compared to total (total plasma EVs) or uncaptured EVs (Supernatant). MiR-206 expression levels were normalized versus the endogenous reference miR-16 and expressed as -ΔCq (where ΔCq = Cq miR-206 -Cq miR-16 ) (b). Moreover, the quantification of miR-16 ratio in the SGCA + sub-population of EVs compared to total or uncaptured EVs shows that SGCA-conjugated beads retained about 2–5% of the total amount of EVs, miR-16 expression levels were normalized versus the spike-in reference cel-miR-39 and expressed as -ΔCq (where ΔCq = Cq miR-16 -Cq cel-miR-39 ) (c). Asterisks denote significant changes ( p

    Article Snippet: The EVs were resuspended in PBS + 0.1% BSA and then stained with an anti-CD81 PE (clone BD Pharmingen, clone JS-81) or anti-alpha-sarcoglycan (clone AD1/20A6 Monosan) and labelled by goat anti-mouse (GaM) FITC.

    Techniques: Isolation, Magnetic Beads, Western Blot, Marker, Staining, Expressing

    Expression of S151A-SGCD precedes cardiac function changes in adult Drosophila expressing S151A-SGCD. (A).Temperature shift from 18°C to 26°C results in deterioration in cardiac function and induction of S151A-SGCD expression. After a temperature shift to 26°C, the induction of transgene expression precedes the development of dilated cardiomyopathy by 48 hours as demonstrated by QRT-PCR measurements of S151A-SGCD mRNA levels compared to cardiac function by serial OCT. A second temperature shift back to 18°C represses S151A-SGCD mRNA expression and results in restoration of cardiac function by 48 hours. We performed three independent experiments using different batches of flies each time. The summary data for QRT-PCR at the indicated times and temperatures are expressed as the mean +/− SE of three independent experiments, each performed in triplicate. * p

    Journal: PLoS ONE

    Article Title: Serial Examination of an Inducible and Reversible Dilated Cardiomyopathy in Individual Adult Drosophila

    doi: 10.1371/journal.pone.0007132

    Figure Lengend Snippet: Expression of S151A-SGCD precedes cardiac function changes in adult Drosophila expressing S151A-SGCD. (A).Temperature shift from 18°C to 26°C results in deterioration in cardiac function and induction of S151A-SGCD expression. After a temperature shift to 26°C, the induction of transgene expression precedes the development of dilated cardiomyopathy by 48 hours as demonstrated by QRT-PCR measurements of S151A-SGCD mRNA levels compared to cardiac function by serial OCT. A second temperature shift back to 18°C represses S151A-SGCD mRNA expression and results in restoration of cardiac function by 48 hours. We performed three independent experiments using different batches of flies each time. The summary data for QRT-PCR at the indicated times and temperatures are expressed as the mean +/− SE of three independent experiments, each performed in triplicate. * p

    Article Snippet: Applied Biosystems Taqman Gene expression assays were used to perform quantitative (real time) RT-PCR (human delta-sarcoglycan, Hs01087180_m1 and fly ribosomal protein L32, Dm02151827_g1 for endogenous control).

    Techniques: Expressing, Quantitative RT-PCR

    Expression of human mutant S151A-SGCD causes an inducible and reversible dilated cardiomyopathy in adult Drosophila . (A) Temperature shift from 18°C to 26°C causes the induction of S151A-SGCD expression and subsequent deterioration in cardiac function. At 96 hours post induction, flies expressing S151A-SGCD demonstrate an enlargement in EDD and ESD with a resultant impairment in FS. At 96 hours, a temperature shift back to 18°C results in a repression of S151A-SGCD expression and subsequent improvement in cardiac function with return of EDD, ESD and FS to near baseline. A similar level of wt-SGCD expression after temperature shift from 18°C to 26°C does not result in deterioration in cardiac function. Each graph represents the summary data for serial OCT measurements of EDD, ESD and FS and are expressed as the mean +/− SE (n = 16 for wt-SGCD and n = 16 for S151A-SGCD). * P

    Journal: PLoS ONE

    Article Title: Serial Examination of an Inducible and Reversible Dilated Cardiomyopathy in Individual Adult Drosophila

    doi: 10.1371/journal.pone.0007132

    Figure Lengend Snippet: Expression of human mutant S151A-SGCD causes an inducible and reversible dilated cardiomyopathy in adult Drosophila . (A) Temperature shift from 18°C to 26°C causes the induction of S151A-SGCD expression and subsequent deterioration in cardiac function. At 96 hours post induction, flies expressing S151A-SGCD demonstrate an enlargement in EDD and ESD with a resultant impairment in FS. At 96 hours, a temperature shift back to 18°C results in a repression of S151A-SGCD expression and subsequent improvement in cardiac function with return of EDD, ESD and FS to near baseline. A similar level of wt-SGCD expression after temperature shift from 18°C to 26°C does not result in deterioration in cardiac function. Each graph represents the summary data for serial OCT measurements of EDD, ESD and FS and are expressed as the mean +/− SE (n = 16 for wt-SGCD and n = 16 for S151A-SGCD). * P

    Article Snippet: Applied Biosystems Taqman Gene expression assays were used to perform quantitative (real time) RT-PCR (human delta-sarcoglycan, Hs01087180_m1 and fly ribosomal protein L32, Dm02151827_g1 for endogenous control).

    Techniques: Expressing, Mutagenesis

    Spectrum and location of mutations in SGCA , SGCB , and SGCG . SGCA , SGCB , and SGCG were represented by their exons. To accommodate the distribution of mutations, the size of the exons was not represented at scale. To illustrate the reading frame, the exons are schematically represented by boxes with blunt, protrusive or intrusive ends. Nucleotide numbering for all mutations was designated according to the coding DNA reference sequence (CDS) in GenBank Accession number NM_000023.2 ( SGCA ), NM_000232.4 ( SGCB ), and NM_000231.2( SGCG ). Information for the different protein domains is available in https://www.uniprot.org/ . Numerals within parentheses indicate, for each mutation, the number of patients harboring the mutation. c.158-10_160del, c.158-10_160delCTTCCACCAGCTG; c.273_292del, c.273_292delCATTGGACCAAATGGCTGTG

    Journal: Orphanet Journal of Rare Diseases

    Article Title: Clinical and genetic spectrum of sarcoglycanopathies in a large cohort of Chinese patients

    doi: 10.1186/s13023-019-1021-9

    Figure Lengend Snippet: Spectrum and location of mutations in SGCA , SGCB , and SGCG . SGCA , SGCB , and SGCG were represented by their exons. To accommodate the distribution of mutations, the size of the exons was not represented at scale. To illustrate the reading frame, the exons are schematically represented by boxes with blunt, protrusive or intrusive ends. Nucleotide numbering for all mutations was designated according to the coding DNA reference sequence (CDS) in GenBank Accession number NM_000023.2 ( SGCA ), NM_000232.4 ( SGCB ), and NM_000231.2( SGCG ). Information for the different protein domains is available in https://www.uniprot.org/ . Numerals within parentheses indicate, for each mutation, the number of patients harboring the mutation. c.158-10_160del, c.158-10_160delCTTCCACCAGCTG; c.273_292del, c.273_292delCATTGGACCAAATGGCTGTG

    Article Snippet: Variants were described according to the Human Genome Variation Society (HGVS) nomenclature using nucleotide and amino acid numbering based on published coding DNA reference sequences (SGCA , NM_000023.2; SGCB , NM_000232.4; SGCG , NM_000231.2; and PMP22 , NM_000304.2) and protein reference sequences (SGCA , NP_000014.1; SGCB , NP_000223.1; SGCG , NP_000222.1; and PMP22 , NP_000295.1).

    Techniques: Sequencing, Mutagenesis