Journal: Frontiers in Bioengineering and Biotechnology

Article Title: Flavokawain A alleviates the progression of mouse osteoarthritis: An in vitro and in vivo study

doi: 10.3389/fbioe.2022.1071776

Figure Lengend Snippet: Protective effects of FKA against IL-1β-induced inflammation and ECM destruction in mouse chondrocytes. Chondrocyte cell treatment with 5 ng/ml of IL-1β only or with FKA (20 and 40 μM) for a period of 24 h. Western blot analysis of inflammatory cytokines (COX2 and iNOS), catabolic (ADAMTS5, MMP3, and MMP13), and anabolic markers (Col2, Aggrecan, and Sox9) (A,C and E) . Quantitative analysis of protein expression (B,D and F) . (G and H) 5 ng/ml of IL-1β was added for treating the cells for 24 h in the absence or presence of 40 µM FKA. Confocal microscopy showing the expression of MMP13 and Aggrecan in immunofluorescence experiments (scale bar 10 μm). (I) Relative quantification of fluorescence intensity. The values are presented as means ± SD ( n = 3). # p < 0.05 vs the control group; * p < 0.05 and ** p < 0.01 vs the IL-1β group.

Article Snippet: ADAMTS5 primary antibody, secondary antibody, phosphate-buffered saline (PBS), trypsin, collagenase type II, the CCK8 assay kit, bovine serum albumin (BSA), and protein extraction kit were ordered and acquired from Boster Biological Technology (Wuhan, Hubei, China).

Techniques: Western Blot, Expressing, Confocal Microscopy, Immunofluorescence, Quantitative Proteomics, Fluorescence, Control

Journal: Nature Communications

Article Title: An injectable liposome-anchored teriparatide incorporated gallic acid-grafted gelatin hydrogel for osteoarthritis treatment

doi: 10.1038/s41467-023-38597-0

Figure Lengend Snippet: a , d Live/dead stained fluorescent images and statistical analysis for cells’ cytotoxicity, green stand for the live cells and red is the dead cells. b , e EdU/DAPI stained fluorescent images to evaluate the cell proliferation (red represents the newly proliferated cells (EdU staining), blue represents all cells (DAPI staining)). c , f Flow cytometry (FCM) results and G2/M rate calculated from FCM results. g – l Immunofluorescent images for Ki-67, c-Fos, and PTH1R expression for the ATDC5 cells cultured with hydrogels and the statistical stained positively area for the expression of such genes. m , n Western Blot results for the expression of proliferation proteins (PTH1R, SOX9, MMP13, ADAMTS5) of ATDC5 cells when cultured with hydrogels and the corresponding statistical analysis results. Data are presented as means ± SD of at least three replicate experiments. Unpaired two-tailed Student’s t tests was used to calculate significant difference, * p < 0.05, ** p < 0.01. GGA gallic acid-grafted gelatin, GLP GGA@Lipo@PTH (1–34).

Article Snippet: The immunohistochemical stainings including PTH1R (Cat#BS2710, 1:400, Bioword Technology, US), SOX9 (Cat#ab185966, 1:1000, abcam, UK), ACAN (Cat#13880-1-AP, 1:500, Proteintech, China), COLIIA1 (Cat#28459-1-AP, 1:500, Proteintech, China), MMP13 (Cat#18165-1-AP, 1:500, Proteintech, China); ADAMTS5 (Cat#bs-3573R, 1:200, Bioss, China), Bcl-2 (Cat#68103-1-Ig, 1:500, Proteintech, China), and BAX (Cat#AF0057, 1:200, Beyotime Biotechnology, China). were performed with 4 μm in thick sections.

Techniques: Staining, Flow Cytometry, Expressing, Cell Culture, Western Blot, Two Tailed Test

Journal: Nature Communications

Article Title: An injectable liposome-anchored teriparatide incorporated gallic acid-grafted gelatin hydrogel for osteoarthritis treatment

doi: 10.1038/s41467-023-38597-0

Figure Lengend Snippet: a , b The FCM results and statistical analysis results for the percentage of apoptosis. c – h Immunofluorescent images for SOX9, Bcl-2, and BAX protein expression as well as the statistical stained positively area from the images. Sox9 is the characteristic gene to indicate the ECM expression, Bcl-2 and Bax genes are the anti-apoptosis and the apoptosis-promoting genes of the cells. i – n The RT-qPCR results of the mRNA expression levels for Sox9, Col2a1, Acan, Adamts5, iNOS, and COX2. o , p The ELISA results for inflammatory mediators, IL-6 and TNF-α. q , r The Western Blot results for the expression of proteins (p-PI3K, PI3K, p-AKT/AKT, ADAMTS5) of IL-1β-induced ATDC5 cells cultured with hydrogels and the corresponding statistical analysis results. Data are presented as means ± SD of at least three replicate experiments. Unpaired two-tailed Student’s t tests was used to calculate significant difference, * p < 0.05, ** p < 0.01. GGA gallic acid-grafted gelatin, GLP GGA@Lipo@PTH (1–34).

Article Snippet: The immunohistochemical stainings including PTH1R (Cat#BS2710, 1:400, Bioword Technology, US), SOX9 (Cat#ab185966, 1:1000, abcam, UK), ACAN (Cat#13880-1-AP, 1:500, Proteintech, China), COLIIA1 (Cat#28459-1-AP, 1:500, Proteintech, China), MMP13 (Cat#18165-1-AP, 1:500, Proteintech, China); ADAMTS5 (Cat#bs-3573R, 1:200, Bioss, China), Bcl-2 (Cat#68103-1-Ig, 1:500, Proteintech, China), and BAX (Cat#AF0057, 1:200, Beyotime Biotechnology, China). were performed with 4 μm in thick sections.

Techniques: Expressing, Staining, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Western Blot, Cell Culture, Two Tailed Test

Journal: Nature Communications

Article Title: An injectable liposome-anchored teriparatide incorporated gallic acid-grafted gelatin hydrogel for osteoarthritis treatment

doi: 10.1038/s41467-023-38597-0

Figure Lengend Snippet: The GLP hydrogel would promote ATDC5 cells proliferation by up-regulating the expression of cell proliferation and anti-apoptosis genes (Ki-67, c-Fos), and this hydrogel would protect IL-1β-induced ATDC5 cells from further progression by up-regulating the expression of key anabolic genes (Sox9, Bcl-2, Col2a1, Acan) and down-regulating the expression of key catabolic genes (Bax, Adamts5), which potentially suggested regulating the PI3K/AKT signaling pathway. GLP GGA@Lipo@PTH (1–34).

Article Snippet: The immunohistochemical stainings including PTH1R (Cat#BS2710, 1:400, Bioword Technology, US), SOX9 (Cat#ab185966, 1:1000, abcam, UK), ACAN (Cat#13880-1-AP, 1:500, Proteintech, China), COLIIA1 (Cat#28459-1-AP, 1:500, Proteintech, China), MMP13 (Cat#18165-1-AP, 1:500, Proteintech, China); ADAMTS5 (Cat#bs-3573R, 1:200, Bioss, China), Bcl-2 (Cat#68103-1-Ig, 1:500, Proteintech, China), and BAX (Cat#AF0057, 1:200, Beyotime Biotechnology, China). were performed with 4 μm in thick sections.

Techniques: Expressing

Journal: Frontiers in Pharmacology

Article Title: Physalin A Inhibits MAPK and NF-κB Signal Transduction Through Integrin αVβ3 and Exerts Chondroprotective Effect

doi: 10.3389/fphar.2021.761922

Figure Lengend Snippet: PA suppressed excess expression of the catabolic indicators of chondrocytes induced by IL-1β, including ADAMTS5, MMP1, MMP3, and MMP13. Mice chondrocytes were treated with 5 ng/ml of IL-1β, alone or with PA (2.5, 5, and 10 μM) for 24 h (A) Western blotting results and (B–E) quantitative analysis of ADAMTS5, MMP1, MMP3, and MMP13. (F) MMP13 expression was observed by immunofluorescence staining when chondrocytes were treated with 5 ng/ml of IL-1β, alone or with 10 μM of PA (scale bar 200 μm). (G–I) Relative mRNA levels of ADAMTS5, MMP3, and MMP13 in chondrocytes stimulated with 5 ng/ml of IL-1β, alone or with PA (2.5, 5, and 10 μM) for 24 h. GAPDH was used as an internal reference. Data are presented as means ± SD ( n = 3). The exact p value was marked in the corresponding figure and p < 0.05 was considered statistically significant.

Article Snippet: Primary antibody against ADAMTS5 (A02802-1) was got from Boster (Wuhan, Hubei, China) and was applied at a 1:500 dilution.

Techniques: Expressing, Western Blot, Immunofluorescence, Staining

Journal: Frontiers in Pharmacology

Article Title: Physalin A Inhibits MAPK and NF-κB Signal Transduction Through Integrin αVβ3 and Exerts Chondroprotective Effect

doi: 10.3389/fphar.2021.761922

Figure Lengend Snippet: Knockdown of integrin αVβ3 weakened the anti-inflammatory, anabolism enhancing, and catabolism inhibiting effect of PA on IL-1β-induced chondrocytes. (A,B) Relative mRNA levels of integrin αV (Itg αV) and integrin β3 (Itg β3) in chondrocytes stimulated with 5 ng/ml of IL-1β, alone or with PA (2.5, 5, and 10 μM) for 24 h (C,D) Itg αV and Itg β3 were knocked down by siRNA transfection, and the knockdown efficiency was verified by RT-PCR. (E,F) Inflammatory markers (COX2, iNOS) were detected by western blotting and the band density of protein levels were quantified after mice chondrocytes were added with or without 5 ng/ml of IL-1β, 10 μM of PA, and Itg αVβ3 siRNA. (G–I) Western blotting was applied to measure the anabolic (aggrecan, collagen II) and catabolic markers (MMP1, MMP3, MMP13, and ADAMTS5) in the Itg αVβ3-deficiency mice chondrocytes along with or without the administration of 5 ng/ml of IL-1β and 10 μM of PA, and the band density of these protein levels were quantified in the histogram. GAPDH was used as an internal reference. Data are presented as means ± SD ( n = 3). The exact p value was marked in the corresponding figure and p < 0.05 was considered statistically significant.

Article Snippet: Primary antibody against ADAMTS5 (A02802-1) was got from Boster (Wuhan, Hubei, China) and was applied at a 1:500 dilution.

Techniques: Knockdown, Transfection, Reverse Transcription Polymerase Chain Reaction, Western Blot

Journal: Frontiers in Pharmacology

Article Title: Physalin A Inhibits MAPK and NF-κB Signal Transduction Through Integrin αVβ3 and Exerts Chondroprotective Effect

doi: 10.3389/fphar.2021.761922

Figure Lengend Snippet: Primer sequence used in the RT-qPCR experiment.

Article Snippet: Primary antibody against ADAMTS5 (A02802-1) was got from Boster (Wuhan, Hubei, China) and was applied at a 1:500 dilution.

Techniques: Sequencing

Journal: Epilepsy research

Article Title: Increased metalloproteinase activity in the hippocampus following status epilepticus

doi: 10.1016/j.eplepsyres.2017.02.021

Figure Lengend Snippet: RNA was extracted from the hippocampi harvested from the SE and control (CT) rats at different time points. Quantitative PCR was performed to check the expression level of ADAMTS4 and ADAMTS5. Graphs were plotted for fold change normalized to control values as mean ± SEM. (A) ADAMTS4 mRNA does not show any difference in expression level between SE and CT animals at 48 hours and 1 week post-SE. (B) Similar to ADAMTS4, ADAMTS5 did not show a difference in mRNA expression level between SE and CT animals across the three time points tested. ANOVA with Bonferroni multiple comparison was performed for ADMATS4 and 5 mRNA. SE (N=7–9) and CT (N=10–7)

Article Snippet: Each master mix was prepared using the Taqman Universal Master Mix (Life Technologies, NY) and a probe for MMP3 (RN00591740_m1), MMP13 (Rn01448194_m1), ADAMTS4 (AIRR82F: GTCCCCCTGCAGTGCCCGATTCATCACTGACTTCCTGGACAATGGCTATGGACACTGCCTCTTAGACAAACCAGAGGCTCCCCTGCATCTGCCAGTGACT), or ADAMTS5 (Rn01458488_m1) (Thermo Fisher Scientific, Waltham, MA).

Techniques: Control, Real-time Polymerase Chain Reaction, Expressing, Comparison

Journal: Epilepsy research

Article Title: Increased metalloproteinase activity in the hippocampus following status epilepticus

doi: 10.1016/j.eplepsyres.2017.02.021

Figure Lengend Snippet: Immunostaining using ADAMTS4 or ADAMTS5 antibody was done and the representative fluorescent images are shown. (A) ADAMTS4 staining in the dentate gyrus (hilar region) of the status epilepticus- induced (SE) and control rats is shown at different magnifications (10X and 40X) at one week post-SE. Brighter staining was detected in the brains of some SE animals; however, this pattern was not consistent in all animals tested. ADAMTS5 staining did not show any difference in the staining pattern between SE and control rats at the time point tested in the dentate gyrus (hilar and CA4 regions). Scale bar 100 μm (marked in black). (B) Equal amounts of proteins were loaded to perform western blot analysis and the protein levels were determined by the band intensity on the blot. The intensities were plotted after normalization with tubulin as mean ± SEM. Representative western blots were shown below the graphs. ADAMTS4 protein did not show any significant difference in the protein levels between SE (N =4) and CT animals (N=3–4) across different time points.

Article Snippet: Each master mix was prepared using the Taqman Universal Master Mix (Life Technologies, NY) and a probe for MMP3 (RN00591740_m1), MMP13 (Rn01448194_m1), ADAMTS4 (AIRR82F: GTCCCCCTGCAGTGCCCGATTCATCACTGACTTCCTGGACAATGGCTATGGACACTGCCTCTTAGACAAACCAGAGGCTCCCCTGCATCTGCCAGTGACT), or ADAMTS5 (Rn01458488_m1) (Thermo Fisher Scientific, Waltham, MA).

Techniques: Immunostaining, Staining, Control, Western Blot

Journal: Epilepsy research

Article Title: Increased metalloproteinase activity in the hippocampus following status epilepticus

doi: 10.1016/j.eplepsyres.2017.02.021

Figure Lengend Snippet: Anaesthetized rats were perfused and the brain were harvested and immunostained for (A) ADAMTS4 (red) localized in the glial cells in CA1 (Stratum oriens) and dentate gyrus (subgranular zone) regions and shows colocalization with the GFAP (green), a marker for glia. (B) ADAMTS5 (red) which localized in the neuropil regions of CA1 and dentate gyrus (hilar region) and colocalized with the MAP2 (green), a marker for dendrites as shown in the overlay. Scale bar 20 μm.

Article Snippet: Each master mix was prepared using the Taqman Universal Master Mix (Life Technologies, NY) and a probe for MMP3 (RN00591740_m1), MMP13 (Rn01448194_m1), ADAMTS4 (AIRR82F: GTCCCCCTGCAGTGCCCGATTCATCACTGACTTCCTGGACAATGGCTATGGACACTGCCTCTTAGACAAACCAGAGGCTCCCCTGCATCTGCCAGTGACT), or ADAMTS5 (Rn01458488_m1) (Thermo Fisher Scientific, Waltham, MA).

Techniques: Marker