M3019 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    Accession Number MIMAT0028449 Mature Sequence CGCCGUUGGUCCUCUCCAACA mmu miR 7240 3p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor structures miRNAs
      Buy from Supplier

    99
    Thermo Fisher igm
    Igm, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 4146 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igm/product/Thermo Fisher
    Average 99 stars, based on 4146 article reviews
    Price from $9.99 to $1999.99
    igm - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    93
    Millipore igm
    Kinetics of LPS-specific (A) and β-Gal-specific (B) serum <t>IgG</t> (solid symbols) and <t>IgM</t> (open symbols) antibody responses in mice ( n = 5) after oral immunization with either MvP101(pAH97) (●), HH104(pAH97) (▴), SL7207(pAH97) (■), or carrier alone (⧫). Results are expressed as the reciprocal log 2 of the geometric mean endpoint titer (GMT). Standard deviations are indicated by vertical lines. Immunizations are indicated by arrows.
    Igm, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 2807 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igm/product/Millipore
    Average 93 stars, based on 2807 article reviews
    Price from $9.99 to $1999.99
    igm - by Bioz Stars, 2021-01
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher anti igm
    Transgenic mice expressing MDM2-ALT1 in B cells show significantly reduced populations of cells with B cell markers and defects in proliferation in spleens compared to controls A. Spleens of age-matched control ( MDM2-ALT1 −/− ; CD19-Cre +/− ; p53 +/+ ) and experimental ( 2C12-MDM2-ALT1 +/− ; CD19-Cre +/− ; p53 +/+ ) mice were harvested at 18 months and the splenocytes were stained for B cell markers CD19, <t>B220,</t> IgG or <t>IgM</t> or T cell markers CD3e or CD5. Compared to MDM2-ALT1-negative control mice ( n = 18) the MDM2-ALT1-positive experimental ( n = 15) mice showed a statistically significant decrease in the population of cells expressing B cell markers but no changes in T cell population. B. Splenocytes isolated from control ( n = 4) and experimental ( n = 5) mice were labeled with a fluorescence marker, CFSE, and stimulated for 72 hours with lipopolysaccharides (LPS), CD40 ligand, or anti-IgM molecules. When stimulated with CD40, the MDM2-ALT1 expressing experimental cohort showed a significantly lower proliferative response compared to splenocytes from control mice. The proliferating population was measured by gating for cells displaying low CFSE fluorescence intensity, indicative of dilution of the dye upon cell division. The percent proliferating population from each group was normalized to the respective non-stimulated control set (No stim). * indicates p
    Anti Igm, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 841 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti igm/product/Thermo Fisher
    Average 99 stars, based on 841 article reviews
    Price from $9.99 to $1999.99
    anti igm - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    99
    Millipore anti human igm mu chain specific f ab 2 fragment peroxidase antibody
    Transgenic mice expressing MDM2-ALT1 in B cells show significantly reduced populations of cells with B cell markers and defects in proliferation in spleens compared to controls A. Spleens of age-matched control ( MDM2-ALT1 −/− ; CD19-Cre +/− ; p53 +/+ ) and experimental ( 2C12-MDM2-ALT1 +/− ; CD19-Cre +/− ; p53 +/+ ) mice were harvested at 18 months and the splenocytes were stained for B cell markers CD19, <t>B220,</t> IgG or <t>IgM</t> or T cell markers CD3e or CD5. Compared to MDM2-ALT1-negative control mice ( n = 18) the MDM2-ALT1-positive experimental ( n = 15) mice showed a statistically significant decrease in the population of cells expressing B cell markers but no changes in T cell population. B. Splenocytes isolated from control ( n = 4) and experimental ( n = 5) mice were labeled with a fluorescence marker, CFSE, and stimulated for 72 hours with lipopolysaccharides (LPS), CD40 ligand, or anti-IgM molecules. When stimulated with CD40, the MDM2-ALT1 expressing experimental cohort showed a significantly lower proliferative response compared to splenocytes from control mice. The proliferating population was measured by gating for cells displaying low CFSE fluorescence intensity, indicative of dilution of the dye upon cell division. The percent proliferating population from each group was normalized to the respective non-stimulated control set (No stim). * indicates p
    Anti Human Igm Mu Chain Specific F Ab 2 Fragment Peroxidase Antibody, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti human igm mu chain specific f ab 2 fragment peroxidase antibody/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti human igm mu chain specific f ab 2 fragment peroxidase antibody - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    92
    Pointe Scientific chu
    Transgenic mice expressing MDM2-ALT1 in B cells show significantly reduced populations of cells with B cell markers and defects in proliferation in spleens compared to controls A. Spleens of age-matched control ( MDM2-ALT1 −/− ; CD19-Cre +/− ; p53 +/+ ) and experimental ( 2C12-MDM2-ALT1 +/− ; CD19-Cre +/− ; p53 +/+ ) mice were harvested at 18 months and the splenocytes were stained for B cell markers CD19, <t>B220,</t> IgG or <t>IgM</t> or T cell markers CD3e or CD5. Compared to MDM2-ALT1-negative control mice ( n = 18) the MDM2-ALT1-positive experimental ( n = 15) mice showed a statistically significant decrease in the population of cells expressing B cell markers but no changes in T cell population. B. Splenocytes isolated from control ( n = 4) and experimental ( n = 5) mice were labeled with a fluorescence marker, CFSE, and stimulated for 72 hours with lipopolysaccharides (LPS), CD40 ligand, or anti-IgM molecules. When stimulated with CD40, the MDM2-ALT1 expressing experimental cohort showed a significantly lower proliferative response compared to splenocytes from control mice. The proliferating population was measured by gating for cells displaying low CFSE fluorescence intensity, indicative of dilution of the dye upon cell division. The percent proliferating population from each group was normalized to the respective non-stimulated control set (No stim). * indicates p
    Chu, supplied by Pointe Scientific, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chu/product/Pointe Scientific
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    chu - by Bioz Stars, 2021-01
    92/100 stars
      Buy from Supplier

    94
    SouthernBiotech anti igm
    Antigen binding by tumor cells of patient 1152 correlates positively with BCR expression. A single-cell suspension of the tumor biopsy was analyzed by flow cytometry to assess antigen binding by individual cells. Recombinant myoferlin with an HA tag or fused to mouse IgG2a FC was used to stain the cells. Antigen binding was detected with goat anti-HA or goat anti–mouse IgG2a. Lysate from untransfected 293T cells served as a negative control (UT). Cells are gated on CD3 − CD20 + B cells; tumor B cells and nontumor B cells were identified with CD20 hi <t>IgM</t> − and CD20 int IgM + gates, respectively.
    Anti Igm, supplied by SouthernBiotech, used in various techniques. Bioz Stars score: 94/100, based on 653 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti igm/product/SouthernBiotech
    Average 94 stars, based on 653 article reviews
    Price from $9.99 to $1999.99
    anti igm - by Bioz Stars, 2021-01
    94/100 stars
      Buy from Supplier

    89
    Pharmingen igm specific antibody
    Effect of gramicidin on ceramide abundance. ( A ) Original histogram of ceramide abundance at the erythrocyte surface following exposure for 24 h to Ringer solution without (grey shadow) and with (black line) presence of 2.5 µg/mL gramicidin; ( B ) Arithmetic means ± SD ( n = 4) of ceramide abundance after a 24 h incubation in Ringer solution without (white bars) or with 2.5 µg/mL gramicidin (black bars). Shown is the respective fluorescence intensity utilizing ceramide antibody (left bars) or isotype <t>IgM</t> (middle bars) or <t>IgG</t> (right bars) antibodies. ** ( p
    Igm Specific Antibody, supplied by Pharmingen, used in various techniques. Bioz Stars score: 89/100, based on 95 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igm specific antibody/product/Pharmingen
    Average 89 stars, based on 95 article reviews
    Price from $9.99 to $1999.99
    igm specific antibody - by Bioz Stars, 2021-01
    89/100 stars
      Buy from Supplier

    89
    Medical Scientific and Chemicals Inc lsam
    Effect of gramicidin on ceramide abundance. ( A ) Original histogram of ceramide abundance at the erythrocyte surface following exposure for 24 h to Ringer solution without (grey shadow) and with (black line) presence of 2.5 µg/mL gramicidin; ( B ) Arithmetic means ± SD ( n = 4) of ceramide abundance after a 24 h incubation in Ringer solution without (white bars) or with 2.5 µg/mL gramicidin (black bars). Shown is the respective fluorescence intensity utilizing ceramide antibody (left bars) or isotype <t>IgM</t> (middle bars) or <t>IgG</t> (right bars) antibodies. ** ( p
    Lsam, supplied by Medical Scientific and Chemicals Inc, used in various techniques. Bioz Stars score: 89/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lsam/product/Medical Scientific and Chemicals Inc
    Average 89 stars, based on 55 article reviews
    Price from $9.99 to $1999.99
    lsam - by Bioz Stars, 2021-01
    89/100 stars
      Buy from Supplier

    99
    Thermo Fisher goat anti mouse igm heavy chain cross adsorbed secondary antibody
    Effect of gramicidin on ceramide abundance. ( A ) Original histogram of ceramide abundance at the erythrocyte surface following exposure for 24 h to Ringer solution without (grey shadow) and with (black line) presence of 2.5 µg/mL gramicidin; ( B ) Arithmetic means ± SD ( n = 4) of ceramide abundance after a 24 h incubation in Ringer solution without (white bars) or with 2.5 µg/mL gramicidin (black bars). Shown is the respective fluorescence intensity utilizing ceramide antibody (left bars) or isotype <t>IgM</t> (middle bars) or <t>IgG</t> (right bars) antibodies. ** ( p
    Goat Anti Mouse Igm Heavy Chain Cross Adsorbed Secondary Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 534 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/goat anti mouse igm heavy chain cross adsorbed secondary antibody/product/Thermo Fisher
    Average 99 stars, based on 534 article reviews
    Price from $9.99 to $1999.99
    goat anti mouse igm heavy chain cross adsorbed secondary antibody - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc akt
    Effect of gramicidin on ceramide abundance. ( A ) Original histogram of ceramide abundance at the erythrocyte surface following exposure for 24 h to Ringer solution without (grey shadow) and with (black line) presence of 2.5 µg/mL gramicidin; ( B ) Arithmetic means ± SD ( n = 4) of ceramide abundance after a 24 h incubation in Ringer solution without (white bars) or with 2.5 µg/mL gramicidin (black bars). Shown is the respective fluorescence intensity utilizing ceramide antibody (left bars) or isotype <t>IgM</t> (middle bars) or <t>IgG</t> (right bars) antibodies. ** ( p
    Akt, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 48620 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/akt/product/Cell Signaling Technology Inc
    Average 99 stars, based on 48620 article reviews
    Price from $9.99 to $1999.99
    akt - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher bsa
    Effect of gramicidin on ceramide abundance. ( A ) Original histogram of ceramide abundance at the erythrocyte surface following exposure for 24 h to Ringer solution without (grey shadow) and with (black line) presence of 2.5 µg/mL gramicidin; ( B ) Arithmetic means ± SD ( n = 4) of ceramide abundance after a 24 h incubation in Ringer solution without (white bars) or with 2.5 µg/mL gramicidin (black bars). Shown is the respective fluorescence intensity utilizing ceramide antibody (left bars) or isotype <t>IgM</t> (middle bars) or <t>IgG</t> (right bars) antibodies. ** ( p
    Bsa, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 25730 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bsa/product/Thermo Fisher
    Average 99 stars, based on 25730 article reviews
    Price from $9.99 to $1999.99
    bsa - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    91
    Thermo Fisher igm fitc
    Effect of gramicidin on ceramide abundance. ( A ) Original histogram of ceramide abundance at the erythrocyte surface following exposure for 24 h to Ringer solution without (grey shadow) and with (black line) presence of 2.5 µg/mL gramicidin; ( B ) Arithmetic means ± SD ( n = 4) of ceramide abundance after a 24 h incubation in Ringer solution without (white bars) or with 2.5 µg/mL gramicidin (black bars). Shown is the respective fluorescence intensity utilizing ceramide antibody (left bars) or isotype <t>IgM</t> (middle bars) or <t>IgG</t> (right bars) antibodies. ** ( p
    Igm Fitc, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 229 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igm fitc/product/Thermo Fisher
    Average 91 stars, based on 229 article reviews
    Price from $9.99 to $1999.99
    igm fitc - by Bioz Stars, 2021-01
    91/100 stars
      Buy from Supplier

    89
    Thermo Fisher goat anti mouse igm heavy chain secondary antibody
    Effect of gramicidin on ceramide abundance. ( A ) Original histogram of ceramide abundance at the erythrocyte surface following exposure for 24 h to Ringer solution without (grey shadow) and with (black line) presence of 2.5 µg/mL gramicidin; ( B ) Arithmetic means ± SD ( n = 4) of ceramide abundance after a 24 h incubation in Ringer solution without (white bars) or with 2.5 µg/mL gramicidin (black bars). Shown is the respective fluorescence intensity utilizing ceramide antibody (left bars) or isotype <t>IgM</t> (middle bars) or <t>IgG</t> (right bars) antibodies. ** ( p
    Goat Anti Mouse Igm Heavy Chain Secondary Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 272 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/goat anti mouse igm heavy chain secondary antibody/product/Thermo Fisher
    Average 89 stars, based on 272 article reviews
    Price from $9.99 to $1999.99
    goat anti mouse igm heavy chain secondary antibody - by Bioz Stars, 2021-01
    89/100 stars
      Buy from Supplier

    89
    Thermo Fisher alexa fluor 488 goat anti mouse igm
    Effect of gramicidin on ceramide abundance. ( A ) Original histogram of ceramide abundance at the erythrocyte surface following exposure for 24 h to Ringer solution without (grey shadow) and with (black line) presence of 2.5 µg/mL gramicidin; ( B ) Arithmetic means ± SD ( n = 4) of ceramide abundance after a 24 h incubation in Ringer solution without (white bars) or with 2.5 µg/mL gramicidin (black bars). Shown is the respective fluorescence intensity utilizing ceramide antibody (left bars) or isotype <t>IgM</t> (middle bars) or <t>IgG</t> (right bars) antibodies. ** ( p
    Alexa Fluor 488 Goat Anti Mouse Igm, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 227 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alexa fluor 488 goat anti mouse igm/product/Thermo Fisher
    Average 89 stars, based on 227 article reviews
    Price from $9.99 to $1999.99
    alexa fluor 488 goat anti mouse igm - by Bioz Stars, 2021-01
    89/100 stars
      Buy from Supplier

    99
    Thermo Fisher igm antibody
    Co-localization of PAB-reactive PLTA antigen, <t>IgA,</t> <t>IgM,</t> and C3c detected by double fluorescence immunohistochemistry. A: Anti-IgA antibody (red) vs PAB antibody (green) after MT treatment, B: anti-IgM antibody (red) vs PAB antibody (green) after MT treatment, C: anti-IgM antibody (red) vs anti-IgA antibody (green), and D: anti-C3c antibody (red) vs PAB antibody (green) after MT treatment. Many PAB-reactive SRBs were also positive for IgA, IgM, and C3c, showing yellow-colored double-positive signals (A, B, and D, respectively). Both IgA and IgM colocalized with these SRBs, indicated by yellow-colored double-positive signals (C).
    Igm Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 104 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igm antibody/product/Thermo Fisher
    Average 99 stars, based on 104 article reviews
    Price from $9.99 to $1999.99
    igm antibody - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    92
    Agilent technologies igm
    (A-C) The majority of the lymphoma cells are positive for IgG (A) but negative for <t>IgM</t> (B) and <t>IgA</t> (C) (original magnification for (A-C) are 200x, 100x, and 100x, respectively). Please note, the IgM highlights the mantle zone B-cells (B). (D) Very rare CD138(+) plasma cells are noted (original magnification 200x).
    Igm, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 92/100, based on 1695 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/igm/product/Agilent technologies
    Average 92 stars, based on 1695 article reviews
    Price from $9.99 to $1999.99
    igm - by Bioz Stars, 2021-01
    92/100 stars
      Buy from Supplier

    89
    EUROIMMUN euroimmun igm
    (A-C) The majority of the lymphoma cells are positive for IgG (A) but negative for <t>IgM</t> (B) and <t>IgA</t> (C) (original magnification for (A-C) are 200x, 100x, and 100x, respectively). Please note, the IgM highlights the mantle zone B-cells (B). (D) Very rare CD138(+) plasma cells are noted (original magnification 200x).
    Euroimmun Igm, supplied by EUROIMMUN, used in various techniques. Bioz Stars score: 89/100, based on 107 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/euroimmun igm/product/EUROIMMUN
    Average 89 stars, based on 107 article reviews
    Price from $9.99 to $1999.99
    euroimmun igm - by Bioz Stars, 2021-01
    89/100 stars
      Buy from Supplier

    88
    BOC Sciences n boc l methionine
    (A-C) The majority of the lymphoma cells are positive for IgG (A) but negative for <t>IgM</t> (B) and <t>IgA</t> (C) (original magnification for (A-C) are 200x, 100x, and 100x, respectively). Please note, the IgM highlights the mantle zone B-cells (B). (D) Very rare CD138(+) plasma cells are noted (original magnification 200x).
    N Boc L Methionine, supplied by BOC Sciences, used in various techniques. Bioz Stars score: 88/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/n boc l methionine/product/BOC Sciences
    Average 88 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    n boc l methionine - by Bioz Stars, 2021-01
    88/100 stars
      Buy from Supplier

    89
    BOC Sciences n boc l selenomethionine
    (A-C) The majority of the lymphoma cells are positive for IgG (A) but negative for <t>IgM</t> (B) and <t>IgA</t> (C) (original magnification for (A-C) are 200x, 100x, and 100x, respectively). Please note, the IgM highlights the mantle zone B-cells (B). (D) Very rare CD138(+) plasma cells are noted (original magnification 200x).
    N Boc L Selenomethionine, supplied by BOC Sciences, used in various techniques. Bioz Stars score: 89/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/n boc l selenomethionine/product/BOC Sciences
    Average 89 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    n boc l selenomethionine - by Bioz Stars, 2021-01
    89/100 stars
      Buy from Supplier

    99
    Millipore anti human igm
    Receiver operating characteristic (ROC) curves of anti-Gal <t>IgM</t> Ratio7/0 and <t>IgG</t> Ratio7/0 for the prediction of early graft failure (loss of graft function within a month) in porcine islet transplantation (PITx) analyzed from the data of all recipients (n=35, A) and from the data of the recipients receiving CD40 pathway blockade (n=28, B). Using an in-house ELISA, the levels of anti-Gal IgG and IgM were quantitatively measured in the plasma samples obtained from the rhesus monkey recipients prior to PITx (day 0) and on day 7 (±2) of PITx. The values of anti-Gal IgM Ratio7/0 and IgG Ratio7/0 for each recipient were calculated from the equation: (antibody level on day 7)/(antibody level on day 0). The area under the ROC curve (AUC) with P value, sensitivity, and specificity at a given optimal criterion are summarized. Abbreviation: CI, confidence interval.
    Anti Human Igm, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 240 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti human igm/product/Millipore
    Average 99 stars, based on 240 article reviews
    Price from $9.99 to $1999.99
    anti human igm - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    91
    Hirschmann bennett wm
    Receiver operating characteristic (ROC) curves of anti-Gal <t>IgM</t> Ratio7/0 and <t>IgG</t> Ratio7/0 for the prediction of early graft failure (loss of graft function within a month) in porcine islet transplantation (PITx) analyzed from the data of all recipients (n=35, A) and from the data of the recipients receiving CD40 pathway blockade (n=28, B). Using an in-house ELISA, the levels of anti-Gal IgG and IgM were quantitatively measured in the plasma samples obtained from the rhesus monkey recipients prior to PITx (day 0) and on day 7 (±2) of PITx. The values of anti-Gal IgM Ratio7/0 and IgG Ratio7/0 for each recipient were calculated from the equation: (antibody level on day 7)/(antibody level on day 0). The area under the ROC curve (AUC) with P value, sensitivity, and specificity at a given optimal criterion are summarized. Abbreviation: CI, confidence interval.
    Bennett Wm, supplied by Hirschmann, used in various techniques. Bioz Stars score: 91/100, based on 145 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bennett wm/product/Hirschmann
    Average 91 stars, based on 145 article reviews
    Price from $9.99 to $1999.99
    bennett wm - by Bioz Stars, 2021-01
    91/100 stars
      Buy from Supplier

    88
    Thermo Fisher mouse igm monoclonal antibody
    Generation and characterization of Igh V H locus inversion mouse model. a , Schematic diagram showing CRISPR-Cas9-mediated entire Igh V H locus inversion upstream V H 81X in embryonic stem cells (ES cells) on the Igh allele in C57BL/6 genetic background. Cut1 and Cut2 showing the location of 2 sgRNAs. Details as shown in Fig. 1a . b , Confirmation of the upstream and downstream inversion junctions by Sanger sequencing. The sgRNA-targeting sequence is underlined, and the PAM sequence is labelled in red. sgRNAs and oligos used are listed in Supplementary Table 4. c , Schematic showing the generation of Igh V H locus inversion mouse model and further assays for phenotype and mechanism analysis. d, e , Representative flow cytometry analysis of <t>IgM</t> - bone marrow (BM) B cell populations in 4∼6-week-old WT ( d ) and Igh V H locus inversion ( e ) mice. <t>B220</t> + IgM - B cells were gated and shown in the left plot ( d, e ). B220 + CD43 + pro-B and B220 + CD43 - pre-B cell populations are indicated in the right plot ( d, e ).
    Mouse Igm Monoclonal Antibody, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 191 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse igm monoclonal antibody/product/Thermo Fisher
    Average 88 stars, based on 191 article reviews
    Price from $9.99 to $1999.99
    mouse igm monoclonal antibody - by Bioz Stars, 2021-01
    88/100 stars
      Buy from Supplier

    88
    EuroClone fluocycle ii sybr
    Generation and characterization of Igh V H locus inversion mouse model. a , Schematic diagram showing CRISPR-Cas9-mediated entire Igh V H locus inversion upstream V H 81X in embryonic stem cells (ES cells) on the Igh allele in C57BL/6 genetic background. Cut1 and Cut2 showing the location of 2 sgRNAs. Details as shown in Fig. 1a . b , Confirmation of the upstream and downstream inversion junctions by Sanger sequencing. The sgRNA-targeting sequence is underlined, and the PAM sequence is labelled in red. sgRNAs and oligos used are listed in Supplementary Table 4. c , Schematic showing the generation of Igh V H locus inversion mouse model and further assays for phenotype and mechanism analysis. d, e , Representative flow cytometry analysis of <t>IgM</t> - bone marrow (BM) B cell populations in 4∼6-week-old WT ( d ) and Igh V H locus inversion ( e ) mice. <t>B220</t> + IgM - B cells were gated and shown in the left plot ( d, e ). B220 + CD43 + pro-B and B220 + CD43 - pre-B cell populations are indicated in the right plot ( d, e ).
    Fluocycle Ii Sybr, supplied by EuroClone, used in various techniques. Bioz Stars score: 88/100, based on 105 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluocycle ii sybr/product/EuroClone
    Average 88 stars, based on 105 article reviews
    Price from $9.99 to $1999.99
    fluocycle ii sybr - by Bioz Stars, 2021-01
    88/100 stars
      Buy from Supplier

    99
    Thermo Fisher nacl
    Generation and characterization of Igh V H locus inversion mouse model. a , Schematic diagram showing CRISPR-Cas9-mediated entire Igh V H locus inversion upstream V H 81X in embryonic stem cells (ES cells) on the Igh allele in C57BL/6 genetic background. Cut1 and Cut2 showing the location of 2 sgRNAs. Details as shown in Fig. 1a . b , Confirmation of the upstream and downstream inversion junctions by Sanger sequencing. The sgRNA-targeting sequence is underlined, and the PAM sequence is labelled in red. sgRNAs and oligos used are listed in Supplementary Table 4. c , Schematic showing the generation of Igh V H locus inversion mouse model and further assays for phenotype and mechanism analysis. d, e , Representative flow cytometry analysis of <t>IgM</t> - bone marrow (BM) B cell populations in 4∼6-week-old WT ( d ) and Igh V H locus inversion ( e ) mice. <t>B220</t> + IgM - B cells were gated and shown in the left plot ( d, e ). B220 + CD43 + pro-B and B220 + CD43 - pre-B cell populations are indicated in the right plot ( d, e ).
    Nacl, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 14230 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nacl/product/Thermo Fisher
    Average 99 stars, based on 14230 article reviews
    Price from $9.99 to $1999.99
    nacl - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier


    Image Search Results


    Kinetics of LPS-specific (A) and β-Gal-specific (B) serum IgG (solid symbols) and IgM (open symbols) antibody responses in mice ( n = 5) after oral immunization with either MvP101(pAH97) (●), HH104(pAH97) (▴), SL7207(pAH97) (■), or carrier alone (⧫). Results are expressed as the reciprocal log 2 of the geometric mean endpoint titer (GMT). Standard deviations are indicated by vertical lines. Immunizations are indicated by arrows.

    Journal: Infection and Immunity

    Article Title: Pathogenicity Island 2 Mutants of Salmonella typhimurium Are Efficient Carriers for Heterologous Antigens and Enable Modulation of Immune Responses

    doi:

    Figure Lengend Snippet: Kinetics of LPS-specific (A) and β-Gal-specific (B) serum IgG (solid symbols) and IgM (open symbols) antibody responses in mice ( n = 5) after oral immunization with either MvP101(pAH97) (●), HH104(pAH97) (▴), SL7207(pAH97) (■), or carrier alone (⧫). Results are expressed as the reciprocal log 2 of the geometric mean endpoint titer (GMT). Standard deviations are indicated by vertical lines. Immunizations are indicated by arrows.

    Article Snippet: To determine the concentration of total Ig present in the intestinal lavages, serial dilutions of the corresponding samples were incubated in microtiter plates that were coated with goat anti-mouse IgG, IgM, and IgA (Sigma) as capture antibodies (100 μl/well); serial dilutions of purified mouse IgG, IgM, and IgA (Sigma) were used to generate standard curves.

    Techniques: Mouse Assay

    Transgenic mice expressing MDM2-ALT1 in B cells show significantly reduced populations of cells with B cell markers and defects in proliferation in spleens compared to controls A. Spleens of age-matched control ( MDM2-ALT1 −/− ; CD19-Cre +/− ; p53 +/+ ) and experimental ( 2C12-MDM2-ALT1 +/− ; CD19-Cre +/− ; p53 +/+ ) mice were harvested at 18 months and the splenocytes were stained for B cell markers CD19, B220, IgG or IgM or T cell markers CD3e or CD5. Compared to MDM2-ALT1-negative control mice ( n = 18) the MDM2-ALT1-positive experimental ( n = 15) mice showed a statistically significant decrease in the population of cells expressing B cell markers but no changes in T cell population. B. Splenocytes isolated from control ( n = 4) and experimental ( n = 5) mice were labeled with a fluorescence marker, CFSE, and stimulated for 72 hours with lipopolysaccharides (LPS), CD40 ligand, or anti-IgM molecules. When stimulated with CD40, the MDM2-ALT1 expressing experimental cohort showed a significantly lower proliferative response compared to splenocytes from control mice. The proliferating population was measured by gating for cells displaying low CFSE fluorescence intensity, indicative of dilution of the dye upon cell division. The percent proliferating population from each group was normalized to the respective non-stimulated control set (No stim). * indicates p

    Journal: Oncogene

    Article Title: A novel mouse model of rhabdomyosarcoma underscores the dichotomy of MDM2-ALT1 function in vivo

    doi: 10.1038/onc.2017.282

    Figure Lengend Snippet: Transgenic mice expressing MDM2-ALT1 in B cells show significantly reduced populations of cells with B cell markers and defects in proliferation in spleens compared to controls A. Spleens of age-matched control ( MDM2-ALT1 −/− ; CD19-Cre +/− ; p53 +/+ ) and experimental ( 2C12-MDM2-ALT1 +/− ; CD19-Cre +/− ; p53 +/+ ) mice were harvested at 18 months and the splenocytes were stained for B cell markers CD19, B220, IgG or IgM or T cell markers CD3e or CD5. Compared to MDM2-ALT1-negative control mice ( n = 18) the MDM2-ALT1-positive experimental ( n = 15) mice showed a statistically significant decrease in the population of cells expressing B cell markers but no changes in T cell population. B. Splenocytes isolated from control ( n = 4) and experimental ( n = 5) mice were labeled with a fluorescence marker, CFSE, and stimulated for 72 hours with lipopolysaccharides (LPS), CD40 ligand, or anti-IgM molecules. When stimulated with CD40, the MDM2-ALT1 expressing experimental cohort showed a significantly lower proliferative response compared to splenocytes from control mice. The proliferating population was measured by gating for cells displaying low CFSE fluorescence intensity, indicative of dilution of the dye upon cell division. The percent proliferating population from each group was normalized to the respective non-stimulated control set (No stim). * indicates p

    Article Snippet: Cells were stained for 30 minutes at 4°C with a combination of either anti-B220, anti-CD5, anti-IgM and anti-CD19 or anti-IgG, anti-CD3e, anti-IgM and anti-CD19 antibodies, then stained with PE-p53, FITC-Bcl-2, FITC-Annexin V (Life Technologies) or fixed and stained with propidium iodide.

    Techniques: Transgenic Assay, Mouse Assay, Expressing, Staining, Negative Control, Isolation, Labeling, Fluorescence, Marker

    Antigen binding by tumor cells of patient 1152 correlates positively with BCR expression. A single-cell suspension of the tumor biopsy was analyzed by flow cytometry to assess antigen binding by individual cells. Recombinant myoferlin with an HA tag or fused to mouse IgG2a FC was used to stain the cells. Antigen binding was detected with goat anti-HA or goat anti–mouse IgG2a. Lysate from untransfected 293T cells served as a negative control (UT). Cells are gated on CD3 − CD20 + B cells; tumor B cells and nontumor B cells were identified with CD20 hi IgM − and CD20 int IgM + gates, respectively.

    Journal: Blood

    Article Title: Self-antigen recognition by follicular lymphoma B-cell receptors

    doi: 10.1182/blood-2012-05-427534

    Figure Lengend Snippet: Antigen binding by tumor cells of patient 1152 correlates positively with BCR expression. A single-cell suspension of the tumor biopsy was analyzed by flow cytometry to assess antigen binding by individual cells. Recombinant myoferlin with an HA tag or fused to mouse IgG2a FC was used to stain the cells. Antigen binding was detected with goat anti-HA or goat anti–mouse IgG2a. Lysate from untransfected 293T cells served as a negative control (UT). Cells are gated on CD3 − CD20 + B cells; tumor B cells and nontumor B cells were identified with CD20 hi IgM − and CD20 int IgM + gates, respectively.

    Article Snippet: A total of 100 μL of antigen prep, or anti-IgG or anti-IgM (Southern Biotechnology, 2041-14 or 2022-14) at a final concentration of 10 μg/mL, was added to cells and incubated at 37°C for 45 minutes.

    Techniques: Binding Assay, Expressing, Flow Cytometry, Cytometry, Recombinant, Staining, Negative Control

    Myoferlin stimulates phosphorylation of S6 ribosomal protein in tumor cells. A single-cell suspension of the tumor biopsy was stimulated with 100 μL of detergent-adsorbed lysate of either untransfected 293T cells (UT), or 293T cells transfected to express recombinant myoferlin containing an HA tag or myoferlin fused to mouse IgG2a Fc. A total of 10 μg/mL of goat anti-IgG and IgM was used as positive control for BCR signaling for tumor and nontumor B cells, respectively. Cells were stimulated for 45 minutes at 37°C. Cells were then fixed with 1.6% paraformaldehyde and permeabilized with methanol. Cells were stained for expression of CD3, CD20, and phosphorylated S6 ribosomal proteins. Tumor and nontumor B cells were identified with CD3 − CD20 hi and CD3 − CD20 int gates, respectively. Values adjacent to histograms indicate median fluorescent intensities.

    Journal: Blood

    Article Title: Self-antigen recognition by follicular lymphoma B-cell receptors

    doi: 10.1182/blood-2012-05-427534

    Figure Lengend Snippet: Myoferlin stimulates phosphorylation of S6 ribosomal protein in tumor cells. A single-cell suspension of the tumor biopsy was stimulated with 100 μL of detergent-adsorbed lysate of either untransfected 293T cells (UT), or 293T cells transfected to express recombinant myoferlin containing an HA tag or myoferlin fused to mouse IgG2a Fc. A total of 10 μg/mL of goat anti-IgG and IgM was used as positive control for BCR signaling for tumor and nontumor B cells, respectively. Cells were stimulated for 45 minutes at 37°C. Cells were then fixed with 1.6% paraformaldehyde and permeabilized with methanol. Cells were stained for expression of CD3, CD20, and phosphorylated S6 ribosomal proteins. Tumor and nontumor B cells were identified with CD3 − CD20 hi and CD3 − CD20 int gates, respectively. Values adjacent to histograms indicate median fluorescent intensities.

    Article Snippet: A total of 100 μL of antigen prep, or anti-IgG or anti-IgM (Southern Biotechnology, 2041-14 or 2022-14) at a final concentration of 10 μg/mL, was added to cells and incubated at 37°C for 45 minutes.

    Techniques: Transfection, Recombinant, Positive Control, Staining, Expressing

    Effect of gramicidin on ceramide abundance. ( A ) Original histogram of ceramide abundance at the erythrocyte surface following exposure for 24 h to Ringer solution without (grey shadow) and with (black line) presence of 2.5 µg/mL gramicidin; ( B ) Arithmetic means ± SD ( n = 4) of ceramide abundance after a 24 h incubation in Ringer solution without (white bars) or with 2.5 µg/mL gramicidin (black bars). Shown is the respective fluorescence intensity utilizing ceramide antibody (left bars) or isotype IgM (middle bars) or IgG (right bars) antibodies. ** ( p

    Journal: Toxins

    Article Title: Enhanced Eryptosis Following Gramicidin Exposure

    doi: 10.3390/toxins7051396

    Figure Lengend Snippet: Effect of gramicidin on ceramide abundance. ( A ) Original histogram of ceramide abundance at the erythrocyte surface following exposure for 24 h to Ringer solution without (grey shadow) and with (black line) presence of 2.5 µg/mL gramicidin; ( B ) Arithmetic means ± SD ( n = 4) of ceramide abundance after a 24 h incubation in Ringer solution without (white bars) or with 2.5 µg/mL gramicidin (black bars). Shown is the respective fluorescence intensity utilizing ceramide antibody (left bars) or isotype IgM (middle bars) or IgG (right bars) antibodies. ** ( p

    Article Snippet: After two washing steps with PBS-BSA, cells were stained for 30 min with polyclonal fluorescein-isothiocyanate (FITC)-conjugated goat anti-mouse IgG and IgM specific antibody (Pharmingen, Hamburg, Germany) diluted 1:50 in PBS-BSA.

    Techniques: Incubation, Fluorescence

    Co-localization of PAB-reactive PLTA antigen, IgA, IgM, and C3c detected by double fluorescence immunohistochemistry. A: Anti-IgA antibody (red) vs PAB antibody (green) after MT treatment, B: anti-IgM antibody (red) vs PAB antibody (green) after MT treatment, C: anti-IgM antibody (red) vs anti-IgA antibody (green), and D: anti-C3c antibody (red) vs PAB antibody (green) after MT treatment. Many PAB-reactive SRBs were also positive for IgA, IgM, and C3c, showing yellow-colored double-positive signals (A, B, and D, respectively). Both IgA and IgM colocalized with these SRBs, indicated by yellow-colored double-positive signals (C).

    Journal: PLoS ONE

    Article Title: Propionibacterium acnes-derived insoluble immune complexes in sinus macrophages of lymph nodes affected by sarcoidosis

    doi: 10.1371/journal.pone.0192408

    Figure Lengend Snippet: Co-localization of PAB-reactive PLTA antigen, IgA, IgM, and C3c detected by double fluorescence immunohistochemistry. A: Anti-IgA antibody (red) vs PAB antibody (green) after MT treatment, B: anti-IgM antibody (red) vs PAB antibody (green) after MT treatment, C: anti-IgM antibody (red) vs anti-IgA antibody (green), and D: anti-C3c antibody (red) vs PAB antibody (green) after MT treatment. Many PAB-reactive SRBs were also positive for IgA, IgM, and C3c, showing yellow-colored double-positive signals (A, B, and D, respectively). Both IgA and IgM colocalized with these SRBs, indicated by yellow-colored double-positive signals (C).

    Article Snippet: After the initial incubation, the plates were further incubated for 60 min at 37°C with unlabeled mouse anti-PLTA antibody (PAB) diluted 1:500; unlabeled rabbit anti-human C1q and C3c (DAKO 0136 and A062, respectively) diluted 1:500; or biotinylated goat anti-human IgG, IgA, or IgM antibody (Invitrogen, Carlsbad, CA, USA) diluted 1:5000.

    Techniques: Fluorescence, Immunohistochemistry

    Immuno-electron microscopy images of SRBs in sinus macrophages of sarcoid lymph nodes. A and B: IHC with PAB antibody after MT treatment, C: IHC with anti-IgA antibody, and D: IHC with anti-IgM antibody. Note that dense black-colored reaction products by each antibody were located along the peripheral rim of the SRBs. A similar distribution of PAB-reactivity was observed in a large spherical-shaped HW body (A).

    Journal: PLoS ONE

    Article Title: Propionibacterium acnes-derived insoluble immune complexes in sinus macrophages of lymph nodes affected by sarcoidosis

    doi: 10.1371/journal.pone.0192408

    Figure Lengend Snippet: Immuno-electron microscopy images of SRBs in sinus macrophages of sarcoid lymph nodes. A and B: IHC with PAB antibody after MT treatment, C: IHC with anti-IgA antibody, and D: IHC with anti-IgM antibody. Note that dense black-colored reaction products by each antibody were located along the peripheral rim of the SRBs. A similar distribution of PAB-reactivity was observed in a large spherical-shaped HW body (A).

    Article Snippet: After the initial incubation, the plates were further incubated for 60 min at 37°C with unlabeled mouse anti-PLTA antibody (PAB) diluted 1:500; unlabeled rabbit anti-human C1q and C3c (DAKO 0136 and A062, respectively) diluted 1:500; or biotinylated goat anti-human IgG, IgA, or IgM antibody (Invitrogen, Carlsbad, CA, USA) diluted 1:5000.

    Techniques: Immuno-Electron Microscopy, Immunohistochemistry

    Insoluble immune complexes in sinus macrophages of control lymph nodes from colon cancer patients. In a representative case of control lymph nodes with IICs from colon cancer patients, identical areas of the lymphatic sinus are shown in semi-serial sections; HE stain (A), IHC with anti-human IgG (B), IgA (C), and IgM (D) antibody, IHC with PAB antibody (E), and IHC with PAB antibody after MT treatment (F). In the sinus macrophages, many IgA-positive and a few IgM-positive small particles were detected (C and D, respectively), although a few PAB-reactive SRBs were detected with no difference in the number between the sections with and without MT treatment (F and E, respectively). Scale bar: 20 μm.

    Journal: PLoS ONE

    Article Title: Propionibacterium acnes-derived insoluble immune complexes in sinus macrophages of lymph nodes affected by sarcoidosis

    doi: 10.1371/journal.pone.0192408

    Figure Lengend Snippet: Insoluble immune complexes in sinus macrophages of control lymph nodes from colon cancer patients. In a representative case of control lymph nodes with IICs from colon cancer patients, identical areas of the lymphatic sinus are shown in semi-serial sections; HE stain (A), IHC with anti-human IgG (B), IgA (C), and IgM (D) antibody, IHC with PAB antibody (E), and IHC with PAB antibody after MT treatment (F). In the sinus macrophages, many IgA-positive and a few IgM-positive small particles were detected (C and D, respectively), although a few PAB-reactive SRBs were detected with no difference in the number between the sections with and without MT treatment (F and E, respectively). Scale bar: 20 μm.

    Article Snippet: After the initial incubation, the plates were further incubated for 60 min at 37°C with unlabeled mouse anti-PLTA antibody (PAB) diluted 1:500; unlabeled rabbit anti-human C1q and C3c (DAKO 0136 and A062, respectively) diluted 1:500; or biotinylated goat anti-human IgG, IgA, or IgM antibody (Invitrogen, Carlsbad, CA, USA) diluted 1:5000.

    Techniques: H&E Stain, Immunohistochemistry

    Insoluble immune complexes in sinus macrophages of control lymph nodes from patients with reactive lymphadenitis. In a representative case of control lymph nodes with IICs from patients with reactive lymphadenitis, identical areas of the lymphatic sinus are shown in semi-serial sections; HE stain (A), IHC with anti-human IgG (B), IgA (C), and IgM (D) antibody, IHC with PAB antibody (E), and IHC with PAB antibody after MT treatment (F). In the sinus macrophages, IgA- and IgM-positive SRBs were detected (C and D, respectively), and PAB-reactive SRBs were also detected with a small increase in the number after MT treatment (F). Scale bar: 20 μm.

    Journal: PLoS ONE

    Article Title: Propionibacterium acnes-derived insoluble immune complexes in sinus macrophages of lymph nodes affected by sarcoidosis

    doi: 10.1371/journal.pone.0192408

    Figure Lengend Snippet: Insoluble immune complexes in sinus macrophages of control lymph nodes from patients with reactive lymphadenitis. In a representative case of control lymph nodes with IICs from patients with reactive lymphadenitis, identical areas of the lymphatic sinus are shown in semi-serial sections; HE stain (A), IHC with anti-human IgG (B), IgA (C), and IgM (D) antibody, IHC with PAB antibody (E), and IHC with PAB antibody after MT treatment (F). In the sinus macrophages, IgA- and IgM-positive SRBs were detected (C and D, respectively), and PAB-reactive SRBs were also detected with a small increase in the number after MT treatment (F). Scale bar: 20 μm.

    Article Snippet: After the initial incubation, the plates were further incubated for 60 min at 37°C with unlabeled mouse anti-PLTA antibody (PAB) diluted 1:500; unlabeled rabbit anti-human C1q and C3c (DAKO 0136 and A062, respectively) diluted 1:500; or biotinylated goat anti-human IgG, IgA, or IgM antibody (Invitrogen, Carlsbad, CA, USA) diluted 1:5000.

    Techniques: H&E Stain, Immunohistochemistry

    P . acnes -derived insoluble immune complexes in sinus macrophages of sarcoid lymph nodes. In a representative case of sarcoid lymph nodes, identical areas of the lesion including a lymphatic sinus and adjacent paracortical area with a sarcoid granuloma are shown in semi-serial sections; HE stain (A), IHC with anti-human IgG (B), IgA (C), and IgM (D) antibody, IHC with PAB antibody (E), and IHC with PAB antibody after MT treatment (F). In the sinus macrophages, the distributions of IgA- and IgM-positive SRBs (C and D) and PAB-reactive SRBs (F) were similar. Note the few PAB-reactive SRBs with weak intensity (indicated by the arrow) in the granuloma after MT treatment (F). Scale bar: 20 μm.

    Journal: PLoS ONE

    Article Title: Propionibacterium acnes-derived insoluble immune complexes in sinus macrophages of lymph nodes affected by sarcoidosis

    doi: 10.1371/journal.pone.0192408

    Figure Lengend Snippet: P . acnes -derived insoluble immune complexes in sinus macrophages of sarcoid lymph nodes. In a representative case of sarcoid lymph nodes, identical areas of the lesion including a lymphatic sinus and adjacent paracortical area with a sarcoid granuloma are shown in semi-serial sections; HE stain (A), IHC with anti-human IgG (B), IgA (C), and IgM (D) antibody, IHC with PAB antibody (E), and IHC with PAB antibody after MT treatment (F). In the sinus macrophages, the distributions of IgA- and IgM-positive SRBs (C and D) and PAB-reactive SRBs (F) were similar. Note the few PAB-reactive SRBs with weak intensity (indicated by the arrow) in the granuloma after MT treatment (F). Scale bar: 20 μm.

    Article Snippet: After the initial incubation, the plates were further incubated for 60 min at 37°C with unlabeled mouse anti-PLTA antibody (PAB) diluted 1:500; unlabeled rabbit anti-human C1q and C3c (DAKO 0136 and A062, respectively) diluted 1:500; or biotinylated goat anti-human IgG, IgA, or IgM antibody (Invitrogen, Carlsbad, CA, USA) diluted 1:5000.

    Techniques: Derivative Assay, H&E Stain, Immunohistochemistry

    (A-C) The majority of the lymphoma cells are positive for IgG (A) but negative for IgM (B) and IgA (C) (original magnification for (A-C) are 200x, 100x, and 100x, respectively). Please note, the IgM highlights the mantle zone B-cells (B). (D) Very rare CD138(+) plasma cells are noted (original magnification 200x).

    Journal: International Journal of Clinical and Experimental Pathology

    Article Title: Nodal involvement by marginal zone B-cell lymphoma harboring t(14;22)(q32;q11) involving immunoglobulin heavy chain and light chain lambda as the sole karyotypically recognizable abnormality in a patient with systemic lupus erythematosus

    doi:

    Figure Lengend Snippet: (A-C) The majority of the lymphoma cells are positive for IgG (A) but negative for IgM (B) and IgA (C) (original magnification for (A-C) are 200x, 100x, and 100x, respectively). Please note, the IgM highlights the mantle zone B-cells (B). (D) Very rare CD138(+) plasma cells are noted (original magnification 200x).

    Article Snippet: The dilution of each antibody and its source are as follows: CD3 (1:50; Thermo Scientific, Waltham, MA, USA), CD19 (1:30; Epitomics Inc., Burlingame, CA, USA), CD20 (1:250; Dako), CD138 (1:60; abD Serotec, Taleigh, NC, USA), Ki-67 (1:120; Dako), IgA (1: 30,000; Dako), IgG (1:1600; Thermo Scientific), IgM (1:5600; Dako), kappa (1;1600; Thermo Scientific), and lambda (1:16000; Dako).

    Techniques:

    Receiver operating characteristic (ROC) curves of anti-Gal IgM Ratio7/0 and IgG Ratio7/0 for the prediction of early graft failure (loss of graft function within a month) in porcine islet transplantation (PITx) analyzed from the data of all recipients (n=35, A) and from the data of the recipients receiving CD40 pathway blockade (n=28, B). Using an in-house ELISA, the levels of anti-Gal IgG and IgM were quantitatively measured in the plasma samples obtained from the rhesus monkey recipients prior to PITx (day 0) and on day 7 (±2) of PITx. The values of anti-Gal IgM Ratio7/0 and IgG Ratio7/0 for each recipient were calculated from the equation: (antibody level on day 7)/(antibody level on day 0). The area under the ROC curve (AUC) with P value, sensitivity, and specificity at a given optimal criterion are summarized. Abbreviation: CI, confidence interval.

    Journal: Annals of Laboratory Medicine

    Article Title: Increase in Anti-Gal IgM Level is Associated With Early Graft Failure in Intraportal Porcine Islet Xenotransplantation

    doi: 10.3343/alm.2015.35.6.611

    Figure Lengend Snippet: Receiver operating characteristic (ROC) curves of anti-Gal IgM Ratio7/0 and IgG Ratio7/0 for the prediction of early graft failure (loss of graft function within a month) in porcine islet transplantation (PITx) analyzed from the data of all recipients (n=35, A) and from the data of the recipients receiving CD40 pathway blockade (n=28, B). Using an in-house ELISA, the levels of anti-Gal IgG and IgM were quantitatively measured in the plasma samples obtained from the rhesus monkey recipients prior to PITx (day 0) and on day 7 (±2) of PITx. The values of anti-Gal IgM Ratio7/0 and IgG Ratio7/0 for each recipient were calculated from the equation: (antibody level on day 7)/(antibody level on day 0). The area under the ROC curve (AUC) with P value, sensitivity, and specificity at a given optimal criterion are summarized. Abbreviation: CI, confidence interval.

    Article Snippet: Subsequently, antibody binding was detected with peroxidase-conjugated anti-human IgG or anti-human IgM (Sigma-Aldrich, St. Louis, MO, USA) and subsequent color reactions.

    Techniques: Transplantation Assay, Enzyme-linked Immunosorbent Assay

    Generation and characterization of Igh V H locus inversion mouse model. a , Schematic diagram showing CRISPR-Cas9-mediated entire Igh V H locus inversion upstream V H 81X in embryonic stem cells (ES cells) on the Igh allele in C57BL/6 genetic background. Cut1 and Cut2 showing the location of 2 sgRNAs. Details as shown in Fig. 1a . b , Confirmation of the upstream and downstream inversion junctions by Sanger sequencing. The sgRNA-targeting sequence is underlined, and the PAM sequence is labelled in red. sgRNAs and oligos used are listed in Supplementary Table 4. c , Schematic showing the generation of Igh V H locus inversion mouse model and further assays for phenotype and mechanism analysis. d, e , Representative flow cytometry analysis of IgM - bone marrow (BM) B cell populations in 4∼6-week-old WT ( d ) and Igh V H locus inversion ( e ) mice. B220 + IgM - B cells were gated and shown in the left plot ( d, e ). B220 + CD43 + pro-B and B220 + CD43 - pre-B cell populations are indicated in the right plot ( d, e ).

    Journal: bioRxiv

    Article Title: Loop Extrusion Mediates Physiological Locus Contraction for V(D)J Recombination

    doi: 10.1101/2020.06.30.181222

    Figure Lengend Snippet: Generation and characterization of Igh V H locus inversion mouse model. a , Schematic diagram showing CRISPR-Cas9-mediated entire Igh V H locus inversion upstream V H 81X in embryonic stem cells (ES cells) on the Igh allele in C57BL/6 genetic background. Cut1 and Cut2 showing the location of 2 sgRNAs. Details as shown in Fig. 1a . b , Confirmation of the upstream and downstream inversion junctions by Sanger sequencing. The sgRNA-targeting sequence is underlined, and the PAM sequence is labelled in red. sgRNAs and oligos used are listed in Supplementary Table 4. c , Schematic showing the generation of Igh V H locus inversion mouse model and further assays for phenotype and mechanism analysis. d, e , Representative flow cytometry analysis of IgM - bone marrow (BM) B cell populations in 4∼6-week-old WT ( d ) and Igh V H locus inversion ( e ) mice. B220 + IgM - B cells were gated and shown in the left plot ( d, e ). B220 + CD43 + pro-B and B220 + CD43 - pre-B cell populations are indicated in the right plot ( d, e ).

    Article Snippet: B220+ CD43hi+ IgM- pro-B cells were isolated by staining with anti-B220-APC (eBioscience, #17-0452-83), anti-CD43-PE (BD PharMingen, #553271), and anti-IgM-FITC (eBioscience, #11-5790-81) antibodies for 30 minutes at 4 °C and then purified by FACS, the purified primary pro-B cells were subjected to HTGTS-V(D)J-seq.

    Techniques: CRISPR, Sequencing, Flow Cytometry, Mouse Assay