M0304 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs endonuclease iv
    Endonuclease Iv, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/endonuclease iv/product/New England Biolabs
    Average 95 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    endonuclease iv - by Bioz Stars, 2020-01
    95/100 stars
      Buy from Supplier

    N/A
    Accession number MIMAT0002175 Mature sequence AGAGGCUGGCCGUGAUGAAUUC hsa miR 485 5p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor structures miRNAs
      Buy from Supplier

    Image Search Results