M0227 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 84
    New England Biolabs gpc methyltransferase
    Gpc Methyltransferase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 84/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gpc methyltransferase/product/New England Biolabs
    Average 84 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    gpc methyltransferase - by Bioz Stars, 2020-01
    84/100 stars
      Buy from Supplier

    N/A
    Accession number MIMAT0004601 Mature sequence GGAUUCCUGGAAAUACUGUUCU hsa miR 145 3p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor structures miRNAs
      Buy from Supplier

    N/A
    The Ephrin B Antibody RM0227 12A31 Biotin from Novus Biologicals is a rat monoclonal antibody to Ephrin B This antibody reacts with mouse The Ephrin B Antibody RM0227 12A31 Biotin
      Buy from Supplier

    N/A
    Anti DUSP1 Rabbit Monoclonal Antibodytested for Flow Cytometry IP IF IHC ICC WB in Human Mouse Rat
      Buy from Supplier

    Image Search Results