84
|
New England Biolabs
gpc methyltransferase Gpc Methyltransferase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 84/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gpc methyltransferase/product/New England Biolabs Average 84 stars, based on 11 article reviews Price from $9.99 to $1999.99
gpc methyltransferase - by Bioz Stars,
2020-01
84/100 stars
|
Buy from Supplier |
N/A
|
Accession number MIMAT0004601 Mature sequence GGAUUCCUGGAAAUACUGUUCU hsa miR 145 3p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor structures miRNAs
|
Buy from Supplier |
N/A
|
The Ephrin B Antibody RM0227 12A31 Biotin from Novus Biologicals is a rat monoclonal antibody to Ephrin B This antibody reacts with mouse The Ephrin B Antibody RM0227 12A31 Biotin
|
Buy from Supplier |
N/A
|
Anti DUSP1 Rabbit Monoclonal Antibodytested for Flow Cytometry IP IF IHC ICC WB in Human Mouse Rat
|
Buy from Supplier |