N/A
strong MicroRNA hsa miR 4486 strong Accession Number MIMAT0019020 Mature Sequence GCUGGGCGAGGCUGGCA hsa miR 4486 are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor structures miRNAs
|
Buy from Supplier |
N/A
strong MicroRNA mmu miR 467g strong Accession Number MIMAT0005854 Mature Sequence UAUACAUACACACACAUAUAU mmu miR 467g are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor structures miRNAs
|
Buy from Supplier |
N/A
strong MicroRNA hsa miR 1537 3p strong Accession Number MIMAT0007399 Mature Sequence AAAACCGUCUAGUUACAGUUGU hsa miR 1537 3p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
|
Buy from Supplier |
N/A
strong MicroRNA hsa miR 6831 3p strong Accession Number MIMAT0027563 Mature Sequence UGACUAACUCCCACUCUACAG hsa miR 6831 3p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
|
Buy from Supplier |
N/A
strong MicroRNA mmu miR 7024 3p strong Accession Number MIMAT0027953 Mature Sequence CCAGCAGUCCCUGCUCCCUACAG mmu miR 7024 3p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
|
Buy from Supplier |