86
|
Oligos Etc
7751 ggacggtagtaggtgtatgatggagatatagttgggtcgtctgggcc 7751 Ggacggtagtaggtgtatgatggagatatagttgggtcgtctgggcc, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/7751 ggacggtagtaggtgtatgatggagatatagttgggtcgtctgggcc/product/Oligos Etc Average 86 stars, based on 1 article reviews Price from $9.99 to $1999.99
7751 ggacggtagtaggtgtatgatggagatatagttgggtcgtctgggcc - by Bioz Stars,
2023-09
86/100 stars
|
Buy from Supplier |
86
|
ATCC
16s rrna gene sequence identity to type strain atcc 7751  16s Rrna Gene Sequence Identity To Type Strain Atcc 7751, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/16s rrna gene sequence identity to type strain atcc 7751/product/ATCC Average 86 stars, based on 1 article reviews Price from $9.99 to $1999.99
16s rrna gene sequence identity to type strain atcc 7751 - by Bioz Stars,
2023-09
86/100 stars
|
Buy from Supplier |
86
|
Chemie GmbH
angewandte chemie communications 7751 angew Angewandte Chemie Communications 7751 Angew, supplied by Chemie GmbH, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/angewandte chemie communications 7751 angew/product/Chemie GmbH Average 86 stars, based on 1 article reviews Price from $9.99 to $1999.99
angewandte chemie communications 7751 angew - by Bioz Stars,
2023-09
86/100 stars
|
Buy from Supplier |
86
|
Merck & Co
nalco 7751 cationic flocculant Nalco 7751 Cationic Flocculant, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nalco 7751 cationic flocculant/product/Merck & Co Average 86 stars, based on 1 article reviews Price from $9.99 to $1999.99
nalco 7751 cationic flocculant - by Bioz Stars,
2023-09
86/100 stars
|
Buy from Supplier |
86
|
Canon inc
caj 7751 Caj 7751, supplied by Canon inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caj 7751/product/Canon inc Average 86 stars, based on 1 article reviews Price from $9.99 to $1999.99
caj 7751 - by Bioz Stars,
2023-09
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Emerging Infectious Diseases
Article Title: Corynebacterium bovis Eye Infections, Washington, USA, 2013
doi: 10.3201/eid2109.150520
Figure Lengend Snippet: Characteristics and test results for 4 isolates of Corynebacterium bovis from patients with eye infections, Washington, USA, 2013*
Article Snippet:
Techniques: Isolation, Sequencing