7156 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    strong MicroRNA hsa miR 7156 5p strong Accession Number MIMAT0028222 Mature Sequence UUGUUCUCAAACUGGCUGUCAGA hsa miR 7156 5p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
      Buy from Supplier

    86
    Santa Cruz Biotechnology sc 7156
    Sc 7156, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sc 7156/product/Santa Cruz Biotechnology
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sc 7156 - by Bioz Stars, 2024-06
    86/100 stars
      Buy from Supplier

    86
    Verlag GmbH gas phase zuschriften 7156
    Gas Phase Zuschriften 7156, supplied by Verlag GmbH, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gas phase zuschriften 7156/product/Verlag GmbH
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    gas phase zuschriften 7156 - by Bioz Stars, 2024-06
    86/100 stars
      Buy from Supplier

    86
    Mauna Kea Technologies 7156 mauna loa sw rift zone
    7156 Mauna Loa Sw Rift Zone, supplied by Mauna Kea Technologies, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/7156 mauna loa sw rift zone/product/Mauna Kea Technologies
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    7156 mauna loa sw rift zone - by Bioz Stars, 2024-06
    86/100 stars
      Buy from Supplier

    N/A
    strong MicroRNA hsa miR 7156 3p strong Accession Number MIMAT0028223 Mature Sequence CUGCAGCCACUUGGGGAACUGGU hsa miR 7156 3p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
      Buy from Supplier

    Image Search Results