60 °c Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    ATCC c pasteurianum
    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. <t>pasteurianum,</t> and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).
    C Pasteurianum, supplied by ATCC, used in various techniques. Bioz Stars score: 88/100, based on 125 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c pasteurianum/product/ATCC
    Average 88 stars, based on 125 article reviews
    Price from $9.99 to $1999.99
    c pasteurianum - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    97
    Thermo Fisher snp cyp2b6 c 7817765 60
    Scatter plots showing significant differences in plasma nevirapine concentrations between patients based on <t>CYP2B6</t> c.516G > T genotypes (A), CYP2B6 c.785A > G genotypes (B), CYP2B6 c.983T > C genotypes (C) and gender (D)
    Snp Cyp2b6 C 7817765 60, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 80 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snp cyp2b6 c 7817765 60/product/Thermo Fisher
    Average 97 stars, based on 80 article reviews
    Price from $9.99 to $1999.99
    snp cyp2b6 c 7817765 60 - by Bioz Stars, 2020-09
    97/100 stars
      Buy from Supplier

    94
    Cole-Parmer masterflex c l dual channel variable speed tubing pump 10 to 60 rpm 115 230 vac
    Scatter plots showing significant differences in plasma nevirapine concentrations between patients based on <t>CYP2B6</t> c.516G > T genotypes (A), CYP2B6 c.785A > G genotypes (B), CYP2B6 c.983T > C genotypes (C) and gender (D)
    Masterflex C L Dual Channel Variable Speed Tubing Pump 10 To 60 Rpm 115 230 Vac, supplied by Cole-Parmer, used in various techniques. Bioz Stars score: 94/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/masterflex c l dual channel variable speed tubing pump 10 to 60 rpm 115 230 vac/product/Cole-Parmer
    Average 94 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    masterflex c l dual channel variable speed tubing pump 10 to 60 rpm 115 230 vac - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    85
    Nano C nano c 60 cytotoxicity
    Scatter plots showing significant differences in plasma nevirapine concentrations between patients based on <t>CYP2B6</t> c.516G > T genotypes (A), CYP2B6 c.785A > G genotypes (B), CYP2B6 c.983T > C genotypes (C) and gender (D)
    Nano C 60 Cytotoxicity, supplied by Nano C, used in various techniques. Bioz Stars score: 85/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nano c 60 cytotoxicity/product/Nano C
    Average 85 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    nano c 60 cytotoxicity - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    94
    Thermo Fisher 60 f 4
    Scatter plots showing significant differences in plasma nevirapine concentrations between patients based on <t>CYP2B6</t> c.516G > T genotypes (A), CYP2B6 c.785A > G genotypes (B), CYP2B6 c.983T > C genotypes (C) and gender (D)
    60 F 4, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/60 f 4/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    60 f 4 - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    90
    Thermo Fisher pre warmed 60°c trizol
    Scatter plots showing significant differences in plasma nevirapine concentrations between patients based on <t>CYP2B6</t> c.516G > T genotypes (A), CYP2B6 c.785A > G genotypes (B), CYP2B6 c.983T > C genotypes (C) and gender (D)
    Pre Warmed 60°C Trizol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pre warmed 60°c trizol/product/Thermo Fisher
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    pre warmed 60°c trizol - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    85
    Thermo Fisher snp cyp2a6 c 27861808 60
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Snp Cyp2a6 C 27861808 60, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snp cyp2a6 c 27861808 60/product/Thermo Fisher
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    snp cyp2a6 c 27861808 60 - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    85
    Thermo Fisher snp ppard c 8851955 60
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Snp Ppard C 8851955 60, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snp ppard c 8851955 60/product/Thermo Fisher
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    snp ppard c 8851955 60 - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    93
    GL Sciences unibeads c 60 80
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Unibeads C 60 80, supplied by GL Sciences, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/unibeads c 60 80/product/GL Sciences
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    unibeads c 60 80 - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    85
    Thermo Fisher 18s 60°c classic
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    18s 60°C Classic, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/18s 60°c classic/product/Thermo Fisher
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    18s 60°c classic - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    99
    GE Healthcare 80o c hiprep 26 60 sephacryl s 300
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    80o C Hiprep 26 60 Sephacryl S 300, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/80o c hiprep 26 60 sephacryl s 300/product/GE Healthcare
    Average 99 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    80o c hiprep 26 60 sephacryl s 300 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    85
    Cell Signaling Technology Inc aml1
    Mll dictates the level of H3K4 tri-methylation at PU.1 regulatory regions. (A) Western blot of nuclear extracts from control cells (lane1) and Mll knockdown cells (lane 2) with indicated antibodies, anti-MLL, <t>anti-AML1,</t> anti-PU.1, anti-H3, anti-H3K4me3,
    Aml1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 85/100, based on 123 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aml1/product/Cell Signaling Technology Inc
    Average 85 stars, based on 123 article reviews
    Price from $9.99 to $1999.99
    aml1 - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    99
    ATCC atcc14028
    Immunodetection of σ S , His 6 -YncC and His 6 -McbR. A) Detection of His 6 -McbR and His 6 -YncC produced from p mcbR HIS and p yncC HIS , respectively. E. coli strains, harboring p yncC HIS , p mcbR HIS and the vectors pACBg and pQE30, were grown to stationary phase in LB at 37 °C and analyzed by Western blotting with anti-His antibodies. A 5-μg aliquot of total protein was loaded in each slot. 1: MC4100 yciE-lacZ (pQE30), 2: MC4100 yciE-lacZ (p yncC HIS ), 3: MC4100 yciE-lacZ (pCABg), 4: MC4100 yciE-lacZ (p mcbR HIS ). Compared with the wild-type YncC/McbR proteins, the His 6 -McbR and His 6 -YncC proteins contain 18 and 10 additional amino acids; thus, His 6 -McbR migrates more slowly on SDS-PAGE than the His 6 -YncC protein. B–D , Detection of σ S in Salmonella (STM) and E. coli K-12 (ECO) strains. Salmonella and E. coli strains in exponential phase ( D ) or stationary phase ( B , C ) in LB at 37 °C were analyzed by Western blotting with anti-σ S antibodies. 10 μg of total protein was loaded in each slot. 1: MC1061, 2: MG1655, 3: MC4100 rpoS , 4: MC4100, 5: <t>ATCC14028,</t> 6: ATCC rpoS , 7: ATCC hns , 8: MC4100 hns , 9: MG1655 hns , 10: MC1061 hns , 11: ATCC2922K, 12: ATCC rpoS LT2 , 13:ATCC rpoS LT2 hns , 14: ATCC2922K hns , 15: ATCC2922K rpoS .
    Atcc14028, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atcc14028/product/ATCC
    Average 99 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    atcc14028 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    85
    ATCC azole susceptible strain c albicans atcc 28526
    Immunodetection of σ S , His 6 -YncC and His 6 -McbR. A) Detection of His 6 -McbR and His 6 -YncC produced from p mcbR HIS and p yncC HIS , respectively. E. coli strains, harboring p yncC HIS , p mcbR HIS and the vectors pACBg and pQE30, were grown to stationary phase in LB at 37 °C and analyzed by Western blotting with anti-His antibodies. A 5-μg aliquot of total protein was loaded in each slot. 1: MC4100 yciE-lacZ (pQE30), 2: MC4100 yciE-lacZ (p yncC HIS ), 3: MC4100 yciE-lacZ (pCABg), 4: MC4100 yciE-lacZ (p mcbR HIS ). Compared with the wild-type YncC/McbR proteins, the His 6 -McbR and His 6 -YncC proteins contain 18 and 10 additional amino acids; thus, His 6 -McbR migrates more slowly on SDS-PAGE than the His 6 -YncC protein. B–D , Detection of σ S in Salmonella (STM) and E. coli K-12 (ECO) strains. Salmonella and E. coli strains in exponential phase ( D ) or stationary phase ( B , C ) in LB at 37 °C were analyzed by Western blotting with anti-σ S antibodies. 10 μg of total protein was loaded in each slot. 1: MC1061, 2: MG1655, 3: MC4100 rpoS , 4: MC4100, 5: <t>ATCC14028,</t> 6: ATCC rpoS , 7: ATCC hns , 8: MC4100 hns , 9: MG1655 hns , 10: MC1061 hns , 11: ATCC2922K, 12: ATCC rpoS LT2 , 13:ATCC rpoS LT2 hns , 14: ATCC2922K hns , 15: ATCC2922K rpoS .
    Azole Susceptible Strain C Albicans Atcc 28526, supplied by ATCC, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/azole susceptible strain c albicans atcc 28526/product/ATCC
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    azole susceptible strain c albicans atcc 28526 - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    91
    Olympus c 60 zoom digital camera
    Immunodetection of σ S , His 6 -YncC and His 6 -McbR. A) Detection of His 6 -McbR and His 6 -YncC produced from p mcbR HIS and p yncC HIS , respectively. E. coli strains, harboring p yncC HIS , p mcbR HIS and the vectors pACBg and pQE30, were grown to stationary phase in LB at 37 °C and analyzed by Western blotting with anti-His antibodies. A 5-μg aliquot of total protein was loaded in each slot. 1: MC4100 yciE-lacZ (pQE30), 2: MC4100 yciE-lacZ (p yncC HIS ), 3: MC4100 yciE-lacZ (pCABg), 4: MC4100 yciE-lacZ (p mcbR HIS ). Compared with the wild-type YncC/McbR proteins, the His 6 -McbR and His 6 -YncC proteins contain 18 and 10 additional amino acids; thus, His 6 -McbR migrates more slowly on SDS-PAGE than the His 6 -YncC protein. B–D , Detection of σ S in Salmonella (STM) and E. coli K-12 (ECO) strains. Salmonella and E. coli strains in exponential phase ( D ) or stationary phase ( B , C ) in LB at 37 °C were analyzed by Western blotting with anti-σ S antibodies. 10 μg of total protein was loaded in each slot. 1: MC1061, 2: MG1655, 3: MC4100 rpoS , 4: MC4100, 5: <t>ATCC14028,</t> 6: ATCC rpoS , 7: ATCC hns , 8: MC4100 hns , 9: MG1655 hns , 10: MC1061 hns , 11: ATCC2922K, 12: ATCC rpoS LT2 , 13:ATCC rpoS LT2 hns , 14: ATCC2922K hns , 15: ATCC2922K rpoS .
    C 60 Zoom Digital Camera, supplied by Olympus, used in various techniques. Bioz Stars score: 91/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c 60 zoom digital camera/product/Olympus
    Average 91 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    c 60 zoom digital camera - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    94
    Millipore c 60
    ( a ) Model for two binding states of a <t>C</t> 60 molecule. STM images of the C 60 molecule before, during and after the switching are presented in inserts. (b) Dependence of potential barrier separating two adjacent in energy C 60 molecule’s orientations on the applied bias voltage.
    C 60, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c 60/product/Millipore
    Average 94 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    c 60 - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    91
    ATCC c acidovorans atcc 17438
    ( a ) Model for two binding states of a <t>C</t> 60 molecule. STM images of the C 60 molecule before, during and after the switching are presented in inserts. (b) Dependence of potential barrier separating two adjacent in energy C 60 molecule’s orientations on the applied bias voltage.
    C Acidovorans Atcc 17438, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c acidovorans atcc 17438/product/ATCC
    Average 91 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    c acidovorans atcc 17438 - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    99
    Millipore c amplification
    ( a ) Model for two binding states of a <t>C</t> 60 molecule. STM images of the C 60 molecule before, during and after the switching are presented in inserts. (b) Dependence of potential barrier separating two adjacent in energy C 60 molecule’s orientations on the applied bias voltage.
    C Amplification, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c amplification/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    c amplification - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    93
    ATCC c haemulonii atcc 22991
    ( a ) Model for two binding states of a <t>C</t> 60 molecule. STM images of the C 60 molecule before, during and after the switching are presented in inserts. (b) Dependence of potential barrier separating two adjacent in energy C 60 molecule’s orientations on the applied bias voltage.
    C Haemulonii Atcc 22991, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c haemulonii atcc 22991/product/ATCC
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    c haemulonii atcc 22991 - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    88
    Pasteur Institute c perfringens cip 60 61
    PCR identification of cpe gene. Lane M: Marker (DNA ladder, 100 bp); Lane 1: C+ CIP 60.61 C. <t>perfringens</t> ( cpa + , cpb + , etx +, cpb2 + ) and lane 2: C+ CIP 106157: Positive controls; Lane 3 negative control; Lanes 4,5,6,7,8,9,10,11: C. perfringens type C isolates with cpe gene; Lanes 12 , 13 and 14: C. perfringens type A isolates
    C Perfringens Cip 60 61, supplied by Pasteur Institute, used in various techniques. Bioz Stars score: 88/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c perfringens cip 60 61/product/Pasteur Institute
    Average 88 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    c perfringens cip 60 61 - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    99
    Millipore c terminal 60 amino acids
    PCR identification of cpe gene. Lane M: Marker (DNA ladder, 100 bp); Lane 1: C+ CIP 60.61 C. <t>perfringens</t> ( cpa + , cpb + , etx +, cpb2 + ) and lane 2: C+ CIP 106157: Positive controls; Lane 3 negative control; Lanes 4,5,6,7,8,9,10,11: C. perfringens type C isolates with cpe gene; Lanes 12 , 13 and 14: C. perfringens type A isolates
    C Terminal 60 Amino Acids, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/c terminal 60 amino acids/product/Millipore
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    c terminal 60 amino acids - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    86
    Merck & Co heat activated 700°c lichroprep si 60
    PCR identification of cpe gene. Lane M: Marker (DNA ladder, 100 bp); Lane 1: C+ CIP 60.61 C. <t>perfringens</t> ( cpa + , cpb + , etx +, cpb2 + ) and lane 2: C+ CIP 106157: Positive controls; Lane 3 negative control; Lanes 4,5,6,7,8,9,10,11: C. perfringens type C isolates with cpe gene; Lanes 12 , 13 and 14: C. perfringens type A isolates
    Heat Activated 700°C Lichroprep Si 60, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/heat activated 700°c lichroprep si 60/product/Merck & Co
    Average 86 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    heat activated 700°c lichroprep si 60 - by Bioz Stars, 2020-09
    86/100 stars
      Buy from Supplier

    99
    GE Healthcare heat inactivated 60°c fetal bovine serum
    PCR identification of cpe gene. Lane M: Marker (DNA ladder, 100 bp); Lane 1: C+ CIP 60.61 C. <t>perfringens</t> ( cpa + , cpb + , etx +, cpb2 + ) and lane 2: C+ CIP 106157: Positive controls; Lane 3 negative control; Lanes 4,5,6,7,8,9,10,11: C. perfringens type C isolates with cpe gene; Lanes 12 , 13 and 14: C. perfringens type A isolates
    Heat Inactivated 60°C Fetal Bovine Serum, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/heat inactivated 60°c fetal bovine serum/product/GE Healthcare
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    heat inactivated 60°c fetal bovine serum - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. pasteurianum, and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).

    Journal: ISRN biotechnology

    Article Title: Fermentation and Hydrogen Metabolism Affect Uranium Reduction by Clostridia

    doi: 10.5402/2013/657160

    Figure Lengend Snippet: Growth, total gas production, hydrogen production, and pH change in Clostridia . Note that all four strains including Clostridium sp., C. acetobutylicum , C. pasteurianum, and C. sphenoides were grown in MSM medium, while C. sphenoides was also in SCM medium (marked with dashed line).

    Article Snippet: We purchased C. sphenoides (ATCC 19403), C. acetobutylicum (ATCC 824), and C. pasteurianum (ATCC 7040) from the American Type Culture Center (ATCC).

    Techniques:

    Scatter plots showing significant differences in plasma nevirapine concentrations between patients based on CYP2B6 c.516G > T genotypes (A), CYP2B6 c.785A > G genotypes (B), CYP2B6 c.983T > C genotypes (C) and gender (D)

    Journal: British Journal of Clinical Pharmacology

    Article Title: Pharmacogenetics of artemether‐lumefantrine influence on nevirapine disposition: Clinically significant drug–drug interaction?) Pharmacogenetics of artemether‐lumefantrine influence on nevirapine disposition: Clinically significant drug–drug interaction?

    doi: 10.1111/bcp.13821

    Figure Lengend Snippet: Scatter plots showing significant differences in plasma nevirapine concentrations between patients based on CYP2B6 c.516G > T genotypes (A), CYP2B6 c.785A > G genotypes (B), CYP2B6 c.983T > C genotypes (C) and gender (D)

    Article Snippet: TaqMan® Genotyping Master Mix and assays for CYP2B6 c.516G > T (rs3745274; ID: C_7817765_60), CYP2B6 c.785A > G (rs2279343; ID: C_26823974_30), CYP2B6 c.983T > C (rs28399499; ID: C_60732328_20), CYP3A4 c.522‐191C > T (rs35599367; ID: C_59013445_10), CYP3A5 c.6986A > G (rs776746; ID: C_26201809_30), POR c.1508C > T (rs1057868; ID: C_8890131_30) and PPARA c.208 + 3819A > G (rs4823613; ID: C_2985275_10) SNPs were obtained from Life Technologies Ltd (Paisley, Renfrewshire, UK).

    Techniques:

    Allelic discrimination plot of CYP2A6*2 rs1801272 genotypes

    Journal: BMC Cancer

    Article Title: Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population

    doi: 10.1186/s12885-018-4342-5

    Figure Lengend Snippet: Allelic discrimination plot of CYP2A6*2 rs1801272 genotypes

    Article Snippet: For CYP2A6*2 (1799 T > A ) [rs1801272; assay ID: C_27861808_60], the VIC/FAM sequence was as follows: CCCCTGCTCACCGCCAGTGCCCCGG[T/A]GGGCGTCGATGAGGAAGCCCGCCTC.

    Techniques:

    Allelic discrimination plot of CYP2A6*9 rs28399433 genotypes

    Journal: BMC Cancer

    Article Title: Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population

    doi: 10.1186/s12885-018-4342-5

    Figure Lengend Snippet: Allelic discrimination plot of CYP2A6*9 rs28399433 genotypes

    Article Snippet: For CYP2A6*2 (1799 T > A ) [rs1801272; assay ID: C_27861808_60], the VIC/FAM sequence was as follows: CCCCTGCTCACCGCCAGTGCCCCGG[T/A]GGGCGTCGATGAGGAAGCCCGCCTC.

    Techniques:

    Mll dictates the level of H3K4 tri-methylation at PU.1 regulatory regions. (A) Western blot of nuclear extracts from control cells (lane1) and Mll knockdown cells (lane 2) with indicated antibodies, anti-MLL, anti-AML1, anti-PU.1, anti-H3, anti-H3K4me3,

    Journal: Blood

    Article Title: The ability of MLL to bind RUNX1 and methylate H3K4 at PU.1 regulatory regions is impaired by MDS/AML-associated RUNX1/AML1 mutations

    doi: 10.1182/blood-2010-11-317909

    Figure Lengend Snippet: Mll dictates the level of H3K4 tri-methylation at PU.1 regulatory regions. (A) Western blot of nuclear extracts from control cells (lane1) and Mll knockdown cells (lane 2) with indicated antibodies, anti-MLL, anti-AML1, anti-PU.1, anti-H3, anti-H3K4me3,

    Article Snippet: Using a series of AML1 N-terminal deletion constructs: [AML1 (1-453, 25-453, 51-453, 60-453, 91-453, and 106-453; C)], we determined that MLL interacts with the N-terminal portion of the Runt-domain and the region N-terminal to it, involving the region between amino acids 91 and 106 ( D).

    Techniques: Methylation, Western Blot

    The interaction between MLL and AML1 is impaired by some mutant AML1 proteins found in leukemia patients. (A) Diagram of a series of the N-terminal frame shift and misssense mutations. The black bar indicates the MID. The black area indicates the Runt-domain.

    Journal: Blood

    Article Title: The ability of MLL to bind RUNX1 and methylate H3K4 at PU.1 regulatory regions is impaired by MDS/AML-associated RUNX1/AML1 mutations

    doi: 10.1182/blood-2010-11-317909

    Figure Lengend Snippet: The interaction between MLL and AML1 is impaired by some mutant AML1 proteins found in leukemia patients. (A) Diagram of a series of the N-terminal frame shift and misssense mutations. The black bar indicates the MID. The black area indicates the Runt-domain.

    Article Snippet: Using a series of AML1 N-terminal deletion constructs: [AML1 (1-453, 25-453, 51-453, 60-453, 91-453, and 106-453; C)], we determined that MLL interacts with the N-terminal portion of the Runt-domain and the region N-terminal to it, involving the region between amino acids 91 and 106 ( D).

    Techniques: Mutagenesis

    Physical interaction between MLL and AML1. (A) Interaction between the endogenous MLL and AML1 proteins in HEL cells. HEL cell nuclear lysates were used for immunoprecipitation (lane 1-2) with IgG and anti-AML1 polyclonal antibodies cross-linked with

    Journal: Blood

    Article Title: The ability of MLL to bind RUNX1 and methylate H3K4 at PU.1 regulatory regions is impaired by MDS/AML-associated RUNX1/AML1 mutations

    doi: 10.1182/blood-2010-11-317909

    Figure Lengend Snippet: Physical interaction between MLL and AML1. (A) Interaction between the endogenous MLL and AML1 proteins in HEL cells. HEL cell nuclear lysates were used for immunoprecipitation (lane 1-2) with IgG and anti-AML1 polyclonal antibodies cross-linked with

    Article Snippet: Using a series of AML1 N-terminal deletion constructs: [AML1 (1-453, 25-453, 51-453, 60-453, 91-453, and 106-453; C)], we determined that MLL interacts with the N-terminal portion of the Runt-domain and the region N-terminal to it, involving the region between amino acids 91 and 106 ( D).

    Techniques: Immunoprecipitation

    Both Aml1 and Cbfβ are required for maintaining H3K4 tri-methylation at PU.1 regulatory regions. (A) ChIP assays were performed to assess the level of H3K4 trimethylation at the PU.1 locus in 416B cells in which knockdown of either Aml1 or Cbfβ

    Journal: Blood

    Article Title: The ability of MLL to bind RUNX1 and methylate H3K4 at PU.1 regulatory regions is impaired by MDS/AML-associated RUNX1/AML1 mutations

    doi: 10.1182/blood-2010-11-317909

    Figure Lengend Snippet: Both Aml1 and Cbfβ are required for maintaining H3K4 tri-methylation at PU.1 regulatory regions. (A) ChIP assays were performed to assess the level of H3K4 trimethylation at the PU.1 locus in 416B cells in which knockdown of either Aml1 or Cbfβ

    Article Snippet: Using a series of AML1 N-terminal deletion constructs: [AML1 (1-453, 25-453, 51-453, 60-453, 91-453, and 106-453; C)], we determined that MLL interacts with the N-terminal portion of the Runt-domain and the region N-terminal to it, involving the region between amino acids 91 and 106 ( D).

    Techniques: Methylation, Chromatin Immunoprecipitation

    MLL stabilizes AML1. (A) Stabilization of AML1 in 293T cells by coexpression of MLL or presence of MG132, a proteasome inhibitor. (B) Ratio of AML1/β-Actin is determined by densitometry based on the Western blot in A. (C) Real-time PCR

    Journal: Blood

    Article Title: The ability of MLL to bind RUNX1 and methylate H3K4 at PU.1 regulatory regions is impaired by MDS/AML-associated RUNX1/AML1 mutations

    doi: 10.1182/blood-2010-11-317909

    Figure Lengend Snippet: MLL stabilizes AML1. (A) Stabilization of AML1 in 293T cells by coexpression of MLL or presence of MG132, a proteasome inhibitor. (B) Ratio of AML1/β-Actin is determined by densitometry based on the Western blot in A. (C) Real-time PCR

    Article Snippet: Using a series of AML1 N-terminal deletion constructs: [AML1 (1-453, 25-453, 51-453, 60-453, 91-453, and 106-453; C)], we determined that MLL interacts with the N-terminal portion of the Runt-domain and the region N-terminal to it, involving the region between amino acids 91 and 106 ( D).

    Techniques: Western Blot, Real-time Polymerase Chain Reaction

    Immunodetection of σ S , His 6 -YncC and His 6 -McbR. A) Detection of His 6 -McbR and His 6 -YncC produced from p mcbR HIS and p yncC HIS , respectively. E. coli strains, harboring p yncC HIS , p mcbR HIS and the vectors pACBg and pQE30, were grown to stationary phase in LB at 37 °C and analyzed by Western blotting with anti-His antibodies. A 5-μg aliquot of total protein was loaded in each slot. 1: MC4100 yciE-lacZ (pQE30), 2: MC4100 yciE-lacZ (p yncC HIS ), 3: MC4100 yciE-lacZ (pCABg), 4: MC4100 yciE-lacZ (p mcbR HIS ). Compared with the wild-type YncC/McbR proteins, the His 6 -McbR and His 6 -YncC proteins contain 18 and 10 additional amino acids; thus, His 6 -McbR migrates more slowly on SDS-PAGE than the His 6 -YncC protein. B–D , Detection of σ S in Salmonella (STM) and E. coli K-12 (ECO) strains. Salmonella and E. coli strains in exponential phase ( D ) or stationary phase ( B , C ) in LB at 37 °C were analyzed by Western blotting with anti-σ S antibodies. 10 μg of total protein was loaded in each slot. 1: MC1061, 2: MG1655, 3: MC4100 rpoS , 4: MC4100, 5: ATCC14028, 6: ATCC rpoS , 7: ATCC hns , 8: MC4100 hns , 9: MG1655 hns , 10: MC1061 hns , 11: ATCC2922K, 12: ATCC rpoS LT2 , 13:ATCC rpoS LT2 hns , 14: ATCC2922K hns , 15: ATCC2922K rpoS .

    Journal: Molecular & Cellular Proteomics : MCP

    Article Title: A Proteomic Analysis Reveals Differential Regulation of the ?S-Dependent yciGFE(katN) Locus by YncC and H-NS in Salmonella and Escherichia coli K-12

    doi: 10.1074/mcp.M110.002493

    Figure Lengend Snippet: Immunodetection of σ S , His 6 -YncC and His 6 -McbR. A) Detection of His 6 -McbR and His 6 -YncC produced from p mcbR HIS and p yncC HIS , respectively. E. coli strains, harboring p yncC HIS , p mcbR HIS and the vectors pACBg and pQE30, were grown to stationary phase in LB at 37 °C and analyzed by Western blotting with anti-His antibodies. A 5-μg aliquot of total protein was loaded in each slot. 1: MC4100 yciE-lacZ (pQE30), 2: MC4100 yciE-lacZ (p yncC HIS ), 3: MC4100 yciE-lacZ (pCABg), 4: MC4100 yciE-lacZ (p mcbR HIS ). Compared with the wild-type YncC/McbR proteins, the His 6 -McbR and His 6 -YncC proteins contain 18 and 10 additional amino acids; thus, His 6 -McbR migrates more slowly on SDS-PAGE than the His 6 -YncC protein. B–D , Detection of σ S in Salmonella (STM) and E. coli K-12 (ECO) strains. Salmonella and E. coli strains in exponential phase ( D ) or stationary phase ( B , C ) in LB at 37 °C were analyzed by Western blotting with anti-σ S antibodies. 10 μg of total protein was loaded in each slot. 1: MC1061, 2: MG1655, 3: MC4100 rpoS , 4: MC4100, 5: ATCC14028, 6: ATCC rpoS , 7: ATCC hns , 8: MC4100 hns , 9: MG1655 hns , 10: MC1061 hns , 11: ATCC2922K, 12: ATCC rpoS LT2 , 13:ATCC rpoS LT2 hns , 14: ATCC2922K hns , 15: ATCC2922K rpoS .

    Article Snippet: This hypothesis was ruled out because similar levels of σS were detected in MG1655, MC4100, MC1061, and ATCC14028 ( B , C , D ).

    Techniques: Immunodetection, Produced, Western Blot, SDS Page

    ( a ) Model for two binding states of a C 60 molecule. STM images of the C 60 molecule before, during and after the switching are presented in inserts. (b) Dependence of potential barrier separating two adjacent in energy C 60 molecule’s orientations on the applied bias voltage.

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: ( a ) Model for two binding states of a C 60 molecule. STM images of the C 60 molecule before, during and after the switching are presented in inserts. (b) Dependence of potential barrier separating two adjacent in energy C 60 molecule’s orientations on the applied bias voltage.

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .

    Techniques: Binding Assay

    A tunneling microscope tip is located above a fluctuating C 60 molecule. Right panel: The time-evolution of the STM tip-surface distance for the switching C 60 molecule measured at a sample bias, V b = −1.1 V and tunneling current I t = 0.087 nA . The acquisition time was 10 ms per point. Five different states are present indicated by dashed lines. Left panel: Histogram of C 60 molecule residence in different states.

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: A tunneling microscope tip is located above a fluctuating C 60 molecule. Right panel: The time-evolution of the STM tip-surface distance for the switching C 60 molecule measured at a sample bias, V b = −1.1 V and tunneling current I t = 0.087 nA . The acquisition time was 10 ms per point. Five different states are present indicated by dashed lines. Left panel: Histogram of C 60 molecule residence in different states.

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .

    Techniques: Microscopy, Mass Spectrometry

    Constant-current STM images (14 × 14 nm 2 ) of the same area of the C 60 monolayer on the WO 2 /W(110) surface, I t = 0.1 nA (a) V b = 1.2 V ; (b) V b = −1.9 V .

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: Constant-current STM images (14 × 14 nm 2 ) of the same area of the C 60 monolayer on the WO 2 /W(110) surface, I t = 0.1 nA (a) V b = 1.2 V ; (b) V b = −1.9 V .

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .

    Techniques:

    ( a ) Schematics of C 60 molecule bonded to WO 2 /W(110) surface by coordination (on the left) and van der Waals (on the right) forces. ( b ) Equivalent circuit of C 60 molecule coupled in STM tunnelling junction. ( c ) Schematics of image charge of negatively charged C 60 .

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: ( a ) Schematics of C 60 molecule bonded to WO 2 /W(110) surface by coordination (on the left) and van der Waals (on the right) forces. ( b ) Equivalent circuit of C 60 molecule coupled in STM tunnelling junction. ( c ) Schematics of image charge of negatively charged C 60 .

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .

    Techniques:

    Kugel fountain as a model of rotating C 60 molecule. Image courtesy of M. Grassick.

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: Kugel fountain as a model of rotating C 60 molecule. Image courtesy of M. Grassick.

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .

    Techniques:

    The time evolution of the STM current (a) and tip-surface distance (b) for the switching C 60 molecule between two lowest in energy orientations when the tunneling microscope tip is located above a fluctuating C 60 molecule. V b = −1.1 V .

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: The time evolution of the STM current (a) and tip-surface distance (b) for the switching C 60 molecule between two lowest in energy orientations when the tunneling microscope tip is located above a fluctuating C 60 molecule. V b = −1.1 V .

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .

    Techniques: Microscopy

    (a) 160 × 160 nm 2 STM image of nano-islands acquired after the deposition of 0.5 ML of C 60 molecules onto the WO 2 /W(110) surface. V b = 1.0 V , I t = 0.1 nA . (b) A line profile (along the line marked in (a) ) indicating the height of C 60 nano-island. (c) Dependence of C 60 nano-island height on the temperature. Abrupt increase of the height at temperature of rotation phase transition indicates break of C 60 coordination bonds.

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: (a) 160 × 160 nm 2 STM image of nano-islands acquired after the deposition of 0.5 ML of C 60 molecules onto the WO 2 /W(110) surface. V b = 1.0 V , I t = 0.1 nA . (b) A line profile (along the line marked in (a) ) indicating the height of C 60 nano-island. (c) Dependence of C 60 nano-island height on the temperature. Abrupt increase of the height at temperature of rotation phase transition indicates break of C 60 coordination bonds.

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .

    Techniques: Sublimation

    (a) 390 × 390 nm 2 Low-temperature STM images acquired after the deposition of 0.5 ML of C 60 molecules onto the WO 2 /W(110) surface. V b = 1 V , I t = 0.1 nA . (b) 13 × 10 nm 2 Image of C 60 at low temperature with the details of the sub-molecular structure. V b = 0.97 V , I t = 0.07 nA , T = 78 K . (c) 16 × 16 nm 2 STM image of the same C 60 film acquired at T = 315 K . All molecules in (c) appear as perfect spheres due their fast rotation. V b = −1.4 V , I t = 0.1 nA .

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: (a) 390 × 390 nm 2 Low-temperature STM images acquired after the deposition of 0.5 ML of C 60 molecules onto the WO 2 /W(110) surface. V b = 1 V , I t = 0.1 nA . (b) 13 × 10 nm 2 Image of C 60 at low temperature with the details of the sub-molecular structure. V b = 0.97 V , I t = 0.07 nA , T = 78 K . (c) 16 × 16 nm 2 STM image of the same C 60 film acquired at T = 315 K . All molecules in (c) appear as perfect spheres due their fast rotation. V b = −1.4 V , I t = 0.1 nA .

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .

    Techniques:

    (a,b) Constant-current STM images (5.5 × 5.5 nm 2 ) of the same area of the C 60 monolayer on the WO 2 /W(110) surface, V b = 1.0 V , I t = 0.1 nA . The molecule at the center of these images switches between static and rotating states, changing its appearance. The molecule in (b) rotates faster than the time scale of the STM experiment. (c) A line profile (along the line marked in (b) ) indicating the height difference between the rotating and static C 60 molecules in the monolayer.

    Journal: Scientific Reports

    Article Title: Control of binding of C60 molecules to the substrate by Coulomb blockade

    doi: 10.1038/s41598-019-52544-4

    Figure Lengend Snippet: (a,b) Constant-current STM images (5.5 × 5.5 nm 2 ) of the same area of the C 60 monolayer on the WO 2 /W(110) surface, V b = 1.0 V , I t = 0.1 nA . The molecule at the center of these images switches between static and rotating states, changing its appearance. The molecule in (b) rotates faster than the time scale of the STM experiment. (c) A line profile (along the line marked in (b) ) indicating the height difference between the rotating and static C 60 molecules in the monolayer.

    Article Snippet: C 60 (Aldrich Chemicals) was evaporated in the preparation chamber isolated from the STM chamber at a rate of about 0.2 ML (monolayer) per min from a deposition cell operated at a temperature of approximately 700 K .

    Techniques:

    PCR identification of cpe gene. Lane M: Marker (DNA ladder, 100 bp); Lane 1: C+ CIP 60.61 C. perfringens ( cpa + , cpb + , etx +, cpb2 + ) and lane 2: C+ CIP 106157: Positive controls; Lane 3 negative control; Lanes 4,5,6,7,8,9,10,11: C. perfringens type C isolates with cpe gene; Lanes 12 , 13 and 14: C. perfringens type A isolates

    Journal: Veterinary Research Forum

    Article Title: Genotyping of Clostridium perfringens isolated from broiler meat in northeastern of Iran

    doi:

    Figure Lengend Snippet: PCR identification of cpe gene. Lane M: Marker (DNA ladder, 100 bp); Lane 1: C+ CIP 60.61 C. perfringens ( cpa + , cpb + , etx +, cpb2 + ) and lane 2: C+ CIP 106157: Positive controls; Lane 3 negative control; Lanes 4,5,6,7,8,9,10,11: C. perfringens type C isolates with cpe gene; Lanes 12 , 13 and 14: C. perfringens type A isolates

    Article Snippet: Two strains, C. perfringens CIP 106157 (cpa+ , cpe+ ) and C. perfringens CIP 60.61 (cpa+ , cpb+ , etx+, cpb2+ ) obtained from Pasteur Institute Collection (CIP; Paris, France) were used as positive controls.

    Techniques: Polymerase Chain Reaction, Marker, Negative Control